MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-172B24
Chromosome	6 (Build37)
Map Location	71,165,601 - 71,165,849
singlet/doublet	singlet
Overlap gene	Smyd1
Upstream gene	Igk, Igkv6-25, Igkv8-24, Igkv8-23-1, Igkv6-23, LOC667829, Igkv8-22, Igk-V8-21, EG667840, Igk-V19-20, Igk-V8-19, Igk-V8-18, LOC667863, Igk-V19-17, Igk-V8-16, Igk-V19-15, LOC667872, LOC620497, Igk-V19-14, LOC667889, Igk-V19-13, LOC667902, Igkv3-12-1, Igk-V21-12, Igk-V21-11, Igk-V21-10, Igk-V21-9, Igk-V21-8, Igk-V21-7, Igk-V21-6, Igk-V21-5, Igk-V21-4, Igk-V21-3, Igk-V21-2, Igk-V21-1, Igk-J1, Igk-J2, Igk-J3, Igk-J4, Igk-J5, Igk-C, Rpia, Eif2ak3, 1700011F03Rik, LOC232077, LOC619547, Thnsl2, Fabp1
Downstream gene	Krcc1, Gm1070, Cd8b1, LOC100042853, Cd8a, Rmnd5a, LOC100042863, Rnf103, Vps24, Jmjd1a, Ppia-ps6_731.1, LOC668029, LOC668034, Reep1, Mrpl35, Immt, Ptcd3, Rpo1-4, LOC668057, St3gal5, Atoh8
Link	Open Mouse BAC browser

Click to get alignment info.

name	Igk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243469 MGI:96494
definition	gene_synonym : kappa note : immunoglobulin kappa chain complex

name	Igkv6-25 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:381784 IMGT/GENE-DB:IGKV6-25
definition	gene_synonym : 19-25 note : immunoglobulin kappa chain variable 6-25

name	Igkv8-24 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:677858 IMGT/GENE-DB:IGKV8-24
definition	note : immunoglobulin kappa chain variable 8-24

name	Igkv8-23-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:434685
definition	note : immunoglobulin kappa variable 8-23-1

name	Igkv6-23 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:637227 IMGT/GENE-DB:IGKV6-23
definition	gene_synonym : 19-23; IgK note : immunoglobulin kappa chain variable 6-23

name	LOC667829 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667829
definition	note : ornithine decarboxylase, structural 1 pseudogene pseudo : _no_value

name	Igkv8-22 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:620387 IMGT/GENE-DB:IGKV8-22
definition	note : immunoglobulin kappa chain variable 8-22 pseudo : _no_value

name	Igk-V8-21 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:620400 IMGT/GENE-DB:IGKV8-21 MGI:1330840
definition	gene_synonym : IGKV8-21 note : immunoglobulin kappa chain variable 8 (V8)-21

name	EG667840 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667840 MGI:3647577
definition	note : predicted gene, EG667840; S-adenosylmethionine decarboxylase 1 pseudogene pseudo : _no_value

name	Igk-V19-20 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108024 IMGT/GENE-DB:IGKV6-20 MGI:1330836
definition	gene_synonym : IGKV6-20 note : immunoglobulin kappa chain variable 19 (V19)-20

name	Igk-V8-19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232065 IMGT/GENE-DB:IGKV8-19 MGI:1330844
definition	gene_synonym : IGKV8-19 note : immunoglobulin kappa chain variable 8 (V8)-19

name	Igk-V8-18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667859 IMGT/GENE-DB:IGKV8-18 MGI:1330845
definition	gene_synonym : IGKV8-18 note : immunoglobulin kappa chain variable 8 (V8)-18

name	LOC667863 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667863
definition	note : ornithine decarboxylase, structural 1 pseudogene pseudo : _no_value

name	Igk-V19-17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667865 IMGT/GENE-DB:IGKV6-17 MGI:1330833
definition	gene_synonym : IGKV6-17 note : immunoglobulin kappa chain variable 19 (V19)-17

name	Igk-V8-16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:640340 IMGT/GENE-DB:IGKV8-16 MGI:1330843
definition	gene_synonym : IGKV8-16 note : immunoglobulin kappa chain variable 8 (V8)-16

name	Igk-V19-15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108022 IMGT/GENE-DB:IGKV6-15 MGI:1330831
definition	gene_synonym : IGKV6-15 note : immunoglobulin kappa chain variable 19 (V19)-15

name	LOC667872 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667872
definition	note : ornithine decarboxylase, structural 1 pseudogene pseudo : _no_value

name	LOC620497 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:620497
definition	note : solute carrier family 5 (sodium-dependent vitamin transporter), member 6 pseudogene pseudo : _no_value

name	Igk-V19-14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667881 IMGT/GENE-DB:IGKV6-14 MGI:1330830
definition	gene_synonym : IGKV6-14 note : immunoglobulin kappa chain variable 19 (V19)-14

name	LOC667889 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667889
definition	note : ornithine decarboxylase, structural 1 pseudogene pseudo : _no_value

name	Igk-V19-13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667899 IMGT/GENE-DB:IGKV6-13 MGI:1330829
definition	gene_synonym : IGKV6-13 note : immunoglobulin kappa chain variable 19 (V19)-13

name	LOC667902 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667902
definition	note : ornithine decarboxylase, structural 1 pseudogene pseudo : _no_value

name	Igkv3-12-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667908 IMGT/GENE-DB:IGKV3-12-1
definition	note : immunoglobulin kappa chain variable 3-12-1 pseudo : _no_value

name	Igk-V21-12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667914 IMGT/GENE-DB:IGKV3-12 MGI:1330815
definition	gene_synonym : IgK21-12; IGKV3-12 note : immunoglobulin kappa chain variable 21 (V21)-12

name	Igk-V21-11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667917 IMGT/GENE-DB:IGKV3-11 MGI:1330820
definition	gene_synonym : IGKV3-11 note : immunoglobulin kappa chain variable 21 (V21)-11 pseudo : _no_value

name	Igk-V21-10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667924 IMGT/GENE-DB:IGKV3-10 MGI:1330821
definition	gene_synonym : IgK21-10; IGKV3-10 note : immunoglobulin kappa chain variable 21 (V21)-10

name	Igk-V21-9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667928 IMGT/GENE-DB:IGKV3-9 MGI:1330856
definition	gene_synonym : IGKV3-9 note : immunoglobulin kappa chain variable 21 (V21)-9

name	Igk-V21-8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108010 IMGT/GENE-DB:IGKV3-8 MGI:1330857
definition	gene_synonym : IGKV3-8 note : immunoglobulin kappa chain variable 21 (V21)-8 pseudo : _no_value

name	Igk-V21-7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108005 IMGT/GENE-DB:IGKV3-7 MGI:1330852
definition	gene_synonym : IgK21-7; IGKV3-7 note : immunoglobulin kappa chain variable 21 (V21)-7

name	Igk-V21-6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667936 IMGT/GENE-DB:IGKV3-6 MGI:1330853
definition	gene_synonym : IGKV3-6 note : immunoglobulin kappa chain variable 21 (V21)-6 pseudo : _no_value

name	Igk-V21-5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667940 IMGT/GENE-DB:IGKV3-5 MGI:1330854
definition	gene_synonym : IgK21-5; IGKV3-5 note : immunoglobulin kappa chain variable 21 (V21)-5

name	Igk-V21-4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:626347 IMGT/GENE-DB:IGKV3-4 MGI:1330855
definition	gene_synonym : IGKV3-4 note : immunoglobulin kappa chain variable 21 (V21)-4

name	Igk-V21-3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667946 IMGT/GENE-DB:IGKV3-3 MGI:1330849
definition	gene_synonym : IGKV3-3 note : immunoglobulin kappa chain variable 21 (V21)-3

name	Igk-V21-2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:626583 IMGT/GENE-DB:IGKV3-2 MGI:1330850
definition	gene_synonym : IgK; IgK21-2; IGKV3-2 note : immunoglobulin kappa chain variable 21 (V21)-2

name	Igk-V21-1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108004 IMGT/GENE-DB:IGKV3-1 MGI:1330851
definition	gene_synonym : IgK21-1; IGKV3-1 note : immunoglobulin kappa chain variable 21 (V21)-1

name	Igk-J1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110759 IMGT/GENE-DB:IGKJ1 MGI:1316689
definition	note : immunoglobulin kappa chain, joining region, 1

name	Igk-J2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110760 IMGT/GENE-DB:IGKJ2 MGI:1316690
definition	note : immunoglobulin kappa chain, joining region, 2

name	Igk-J3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110761 IMGT/GENE-DB:IGKJ3 MGI:1316691
definition	note : immunoglobulin kappa chain, joining region, 3

name	Igk-J4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110762 IMGT/GENE-DB:IGKJ4 MGI:1316692
definition	note : immunoglobulin kappa chain, joining region, 4

name	Igk-J5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110763 IMGT/GENE-DB:IGKJ5 MGI:1316738
definition	note : immunoglobulin kappa chain, joining region, 5

name	Igk-C (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16071 IMGT/GENE-DB:IGKC MGI:96495
definition	gene_synonym : IGKC; MGC118128 note : immunoglobulin kappa chain, constant region

name	Rpia (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19895 MGI:103254
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eif2ak3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13666 MGI:1341830
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700011F03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74221 MGI:1921471
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC232077 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:232077
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 53 Proteins

name	LOC619547 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:619547
definition	note : ribosomal protein L34 pseudogene pseudo : _no_value

name	Thnsl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232078 MGI:3041254
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Fabp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14080 MGI:95479
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Smyd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12180 MGI:104790
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krcc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57896 MGI:1889377
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm1070 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381785 MGI:2685916
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd8b1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12526 MGI:88347
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042853 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042853
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins pseudo : _no_value

name	Cd8a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12525 MGI:88346
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rmnd5a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68477 MGI:1915727
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042863 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042863
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	Rnf103 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22644 MGI:109483
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vps24 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66700 MGI:1913950
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Jmjd1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104263 MGI:98847
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Ppia-ps6_731.1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:606532
definition	note : peptidylprolyl isomerase A pseudogene 6_731.1 pseudo : _no_value

name	LOC668029 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668029
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	LOC668034 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668034
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 7 Proteins pseudo : _no_value

name	Reep1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52250 MGI:1098827
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrpl35 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66223 MGI:1913473
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Immt (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76614 MGI:1923864
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ptcd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69956 MGI:1917206
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpo1-4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20019 MGI:1096397
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668057 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668057
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	St3gal5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20454 MGI:1339963
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Atoh8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71093 MGI:1918343
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpia (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94536843 GeneID:19895 MGI:103254
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribose 5-phosphate isomerase A transcript_id : NM_009075.2

name	Eif2ak3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124001563 GeneID:13666 MGI:1341830
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 2 alpha kinase 3 transcript_id : NM_010121.2

name	1700011F03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802938 GeneID:74221 MGI:1921471
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700011F03 gene transcript_id : NM_028825.2

name	LOC232077 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255209 GeneID:232077
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 53 Proteins product : similar to hCG33270 transcript_id : XM_144880.5

name	Thnsl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76677924 GeneID:232078 MGI:3041254
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : threonine synthase-like 2 (bacterial) transcript_id : NM_001033929.1

name	Thnsl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76677921 GeneID:232078 MGI:3041254
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : threonine synthase-like 2 (bacterial) transcript_id : NM_178413.4

name	Fabp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802687 GeneID:14080 MGI:95479
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fatty acid binding protein 1, liver transcript_id : NM_017399.2

name	Smyd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10257424 GeneID:12180 MGI:104790
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SET and MYND domain containing 1 transcript_id : NM_009762.1

name	Krcc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47271541 GeneID:57896 MGI:1889377
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lysine-rich coiled-coil 1 transcript_id : NM_145568.3

name	Gm1070 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142360133 GeneID:381785 MGI:2685916
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 1070, (NCBI) transcript_id : NM_001033462.2

name	Cd8b1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129874 GeneID:12526 MGI:88347
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD8 antigen, beta chain 1 transcript_id : NM_009858.2

name	Cd8a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126722839 GeneID:12525 MGI:88346
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD8 antigen, alpha chain transcript_id : NM_001081110.2

name	Rmnd5a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31044428 GeneID:68477 MGI:1915727
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : required for meiotic nuclear division 5 homolog A (S. cerevisiae) transcript_id : NM_024288.1

name	LOC100042863 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255212 GeneID:100042863
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : similar to retinitis pigmentosa GTPase regulator interacting protein 1 transcript_id : XM_001478945.1

name	Rnf103 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678630 GeneID:22644 MGI:109483
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger protein 103 transcript_id : NM_009543.1

name	Vps24 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368166 GeneID:66700 MGI:1913950
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vacuolar protein sorting 24 (yeast) transcript_id : NM_025783.3

name	Jmjd1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84662716 GeneID:104263 MGI:98847
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : jumonji domain containing 1A transcript_id : NM_173001.1

name	Jmjd1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84662720 GeneID:104263 MGI:98847
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : jumonji domain containing 1A transcript_id : NM_001038695.1

name	Reep1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802230 GeneID:52250 MGI:1098827
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : receptor accessory protein 1 transcript_id : NM_178608.3

name	Mrpl35 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372564 GeneID:66223 MGI:1913473
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein L35 transcript_id : NM_025430.2

name	Immt (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70608130 GeneID:76614 MGI:1923864
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : inner membrane protein, mitochondrial transcript_id : NM_029673.2

name	Ptcd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:91982770 GeneID:69956 MGI:1917206
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Pentatricopeptide repeat domain 3 transcript_id : NM_027275.3

name	Rpo1-4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328145 GeneID:20019 MGI:1096397
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA polymerase 1-4 transcript_id : NM_009088.2

name	St3gal5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:78126168 GeneID:20454 MGI:1339963
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ST3 beta-galactoside alpha-2,3-sialyltransferase 5 transcript_id : NM_011375.2

name	St3gal5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:78126156 GeneID:20454 MGI:1339963
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ST3 beta-galactoside alpha-2,3-sialyltransferase 5 transcript_id : NM_001035228.1

name	Atoh8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130066 GeneID:71093 MGI:1918343
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : atonal homolog 8 (Drosophila) transcript_id : NM_153778.3

name	Igkv6-25 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:381784 IMGT/GENE-DB:IGKV6-25
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : 19-25

name	Igkv8-24 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:677858 IMGT/GENE-DB:IGKV8-24
definition	codon_start : 1 exception : rearrangement required for product

name	Igkv8-23-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:434685
definition	codon_start : 1 exception : rearrangement required for product

name	Igkv6-23 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:637227 IMGT/GENE-DB:IGKV6-23
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : 19-23; IgK

name	Igkv8-22 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:620387 IMGT/GENE-DB:IGKV8-22
definition	codon_start : 1 pseudo : _no_value

name	Igk-V8-21 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:620400 IMGT/GENE-DB:IGKV8-21 MGI:1330840
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGKV8-21

name	Igk-V19-20 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:108024 IMGT/GENE-DB:IGKV6-20 MGI:1330836
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGKV6-20

name	Igk-V8-19 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:232065 IMGT/GENE-DB:IGKV8-19 MGI:1330844
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGKV8-19

name	Igk-V8-18 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:667859 IMGT/GENE-DB:IGKV8-18 MGI:1330845
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGKV8-18

name	Igk-V19-17 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:667865 IMGT/GENE-DB:IGKV6-17 MGI:1330833
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGKV6-17

name	Igk-V8-16 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:640340 IMGT/GENE-DB:IGKV8-16 MGI:1330843
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGKV8-16

name	Igk-V19-15 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:108022 IMGT/GENE-DB:IGKV6-15 MGI:1330831
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGKV6-15

name	Igk-V19-14 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:667881 IMGT/GENE-DB:IGKV6-14 MGI:1330830
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGKV6-14

name	Igk-V19-13 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:667899 IMGT/GENE-DB:IGKV6-13 MGI:1330829
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGKV6-13

name	Igkv3-12-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:667908 IMGT/GENE-DB:IGKV3-12-1
definition	codon_start : 1 pseudo : _no_value

name	Igk-V21-12 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:667914 IMGT/GENE-DB:IGKV3-12 MGI:1330815
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IgK21-12; IGKV3-12

name	Igk-V21-11 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:667917 IMGT/GENE-DB:IGKV3-11 MGI:1330820
definition	codon_start : 1 gene_synonym : IGKV3-11 pseudo : _no_value

name	Igk-V21-10 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:667924 IMGT/GENE-DB:IGKV3-10 MGI:1330821
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IgK21-10; IGKV3-10

name	Igk-V21-9 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:667928 IMGT/GENE-DB:IGKV3-9 MGI:1330856
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGKV3-9

name	Igk-V21-8 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:108010 IMGT/GENE-DB:IGKV3-8 MGI:1330857
definition	codon_start : 1 gene_synonym : IGKV3-8 pseudo : _no_value

name	Igk-V21-7 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:108005 IMGT/GENE-DB:IGKV3-7 MGI:1330852
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IgK21-7; IGKV3-7

name	Igk-V21-6 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:667936 IMGT/GENE-DB:IGKV3-6 MGI:1330853
definition	codon_start : 1 gene_synonym : IGKV3-6 pseudo : _no_value

name	Igk-V21-5 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:667940 IMGT/GENE-DB:IGKV3-5 MGI:1330854
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IgK21-5; IGKV3-5

name	Igk-V21-4 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:626347 IMGT/GENE-DB:IGKV3-4 MGI:1330855
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGKV3-4

name	Igk-V21-3 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:667946 IMGT/GENE-DB:IGKV3-3 MGI:1330849
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGKV3-3

name	Igk-V21-2 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:626583 IMGT/GENE-DB:IGKV3-2 MGI:1330850
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IgK; IgK21-2; IGKV3-2

name	Igk-V21-1 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:108004 IMGT/GENE-DB:IGKV3-1 MGI:1330851
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IgK21-1; IGKV3-1

name	Igk-J1 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:110759 IMGT/GENE-DB:IGKJ1 MGI:1316689
definition	codon_start : 1 exception : rearrangement required for product

name	Igk-J2 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:110760 IMGT/GENE-DB:IGKJ2 MGI:1316690
definition	codon_start : 1 exception : rearrangement required for product

name	Igk-J3 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:110761 IMGT/GENE-DB:IGKJ3 MGI:1316691
definition	codon_start : 1 exception : rearrangement required for product

name	Igk-J4 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:110762 IMGT/GENE-DB:IGKJ4 MGI:1316692
definition	codon_start : 1 exception : rearrangement required for product

name	Igk-J5 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:110763 IMGT/GENE-DB:IGKJ5 MGI:1316738
definition	codon_start : 1 exception : rearrangement required for product

name	Igk-C (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:16071 IMGT/GENE-DB:IGKC MGI:96495
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGKC; MGC118128

name	Rpia (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94536844 GeneID:19895 MGI:103254
definition	GO_function : GO:0016853 - isomerase activity [Evidence IEA]; GO:0004751 - ribose-5-phosphate isomerase activity [Evidence IEA] GO_process : GO:0009052 - pentose-phosphate shunt, non-oxidative branch [Evidence IEA] codon_start : 1 product : ribose 5-phosphate isomerase A protein_id : NP_033101.2

name	Eif2ak3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124001564 CCDS:CCDS20223.1 GeneID:13666 MGI:1341830
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005783 - endoplasmic reticulum [Evidence IEA] [Evidence IDA]; GO:0005789 - endoplasmic reticulum membrane [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IDA] [Evidence IEA] [Evidence IMP]; GO:0004674 - protein serine/threonine kinase activity [Evidence IDA] [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0008632 - apoptotic program [Evidence IMP]; GO:0030282 - bone mineralization [Evidence IMP]; GO:0019722 - calcium-mediated signaling [Evidence IMP]; GO:0006919 - caspase activation [Evidence IMP]; GO:0002063 - chondrocyte development [Evidence IMP]; GO:0006118 - electron transport [Evidence IEA]; GO:0007029 - endoplasmic reticulum organization and biogenesis [Evidence IMP]; GO:0030073 - insulin secretion [Evidence IMP]; GO:0048009 - insulin-like growth factor receptor signaling pathway [Evidence IMP]; GO:0031642 - negative regulation of myelination [Evidence IMP]; GO:0016478 - negative regulation of translation [Evidence IGI] [Evidence IDA] [Evidence IMP]; GO:0031016 - pancreas development [Evidence IMP]; GO:0032092 - positive regulation of protein binding [Evidence IMP]; GO:0046777 - protein amino acid autophosphorylation [Evidence IMP] [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IMP] [Evidence IEA] [Evidence IDA]; GO:0006412 - protein biosynthesis [Evidence IDA]; GO:0006417 - regulation of protein biosynthesis [Evidence IEA]; GO:0006445 - regulation of translation [Evidence IEA]; GO:0006986 - response to unfolded protein [Evidence IEA]; GO:0001501 - skeletal development [Evidence IMP]; GO:0030968 - unfolded protein response [Evidence IMP] [Evidence IDA]; GO:0006926 - virus-infected cell apoptosis [Evidence IMP] codon_start : 1 product : eukaryotic translation initiation factor 2 alpha kinase 3 protein_id : NP_034251.2

name	1700011F03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037359 CCDS:CCDS20224.1 GeneID:74221 MGI:1921471
definition	codon_start : 1 product : hypothetical protein LOC74221 protein_id : NP_083101.1

name	LOC232077 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:83029183 GeneID:232077
definition	codon_start : 1 product : similar to hCG33270 protein_id : XP_144880.3

name	Thnsl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:76677925 CCDS:CCDS20225.1 GeneID:232078 MGI:3041254
definition	GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0004795 - threonine synthase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA]; GO:0009088 - threonine biosynthesis [Evidence IEA] codon_start : 1 product : threonine synthase-like 2 protein_id : NP_001029101.1

name	Thnsl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:76677922 CCDS:CCDS20225.1 GeneID:232078 MGI:3041254
definition	GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0004795 - threonine synthase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA]; GO:0009088 - threonine biosynthesis [Evidence IEA] codon_start : 1 product : threonine synthase-like 2 protein_id : NP_848500.3

name	Fabp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8393343 CCDS:CCDS20226.1 GeneID:14080 MGI:95479
definition	GO_function : GO:0005488 - binding [Evidence IEA]; GO:0003682 - chromatin binding [Evidence IDA]; GO:0005504 - fatty acid binding [Evidence ISS]; GO:0008289 - lipid binding [Evidence IEA]; GO:0008430 - selenium binding [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : fatty acid binding protein liver product : fatty acid binding protein 1, liver protein_id : NP_059095.1

name	Smyd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10257425 CCDS:CCDS20227.1 GeneID:12180 MGI:104790
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA]; GO:0016469 - proton-transporting two-sector ATPase complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046933 - hydrogen-transporting ATP synthase activity, rotational mechanism [Evidence IEA]; GO:0046961 - hydrogen-transporting ATPase activity, rotational mechanism [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003714 - transcription corepressor activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0015986 - ATP synthesis coupled proton transport [Evidence IEA]; GO:0006338 - chromatin remodeling [Evidence IPI]; GO:0007507 - heart development [Evidence IMP]; GO:0016481 - negative regulation of transcription [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : CD8beta opposite strand product : SET and MYND domain containing 1 protein_id : NP_033892.1

name	Krcc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704142 CCDS:CCDS20228.1 GeneID:57896 MGI:1889377
definition	codon_start : 1 product : lysine-rich coiled-coil 1 protein_id : NP_663543.1

name	Gm1070 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701979 GeneID:381785 MGI:2685916
definition	codon_start : 1 product : hypothetical protein LOC381785 protein_id : NP_001028634.1

name	Cd8b1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753358 GeneID:12526 MGI:88347
definition	GO_component : GO:0009986 - cell surface [Evidence IDA]; GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0042101 - T cell receptor complex [Evidence ISS] GO_function : GO:0015026 - coreceptor activity [Evidence ISS]; GO:0042288 - MHC class I protein binding [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS] [Evidence IPI] GO_process : GO:0006955 - immune response [Evidence IEA] [Evidence ISS]; GO:0042110 - T cell activation [Evidence ISS]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence ISS] codon_start : 1 product : CD8 antigen, beta chain 1 protein_id : NP_033988.1

name	Cd8a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487437 GeneID:12525 MGI:88346
definition	GO_component : GO:0009986 - cell surface [Evidence IDA]; GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0042101 - T cell receptor complex [Evidence ISS] GO_function : GO:0015026 - coreceptor activity [Evidence ISS]; GO:0042288 - MHC class I protein binding [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0007166 - cell surface receptor linked signal transduction [Evidence IDA]; GO:0006968 - cellular defense response [Evidence IMP]; GO:0045065 - cytotoxic T cell differentiation [Evidence IMP]; GO:0006955 - immune response [Evidence ISS] [Evidence IEA]; GO:0050850 - positive regulation of calcium-mediated signaling [Evidence IDA]; GO:0042110 - T cell activation [Evidence ISS]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence ISS] codon_start : 1 note : Lyt-2.1 lymphocyte differentiation antigen (AA at 100) product : CD8 antigen, alpha chain protein_id : NP_001074579.1

name	Rmnd5a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31044429 CCDS:CCDS20231.1 GeneID:68477 MGI:1915727
definition	codon_start : 1 exception : mismatches in translation product : required for meiotic nuclear division 5 homolog A protein_id : NP_077250.1

name	LOC100042863 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255213 GeneID:100042863
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478995.1

name	Rnf103 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678631 GeneID:22644 MGI:109483
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : zinc finger protein 103 product : ring finger protein 103 protein_id : NP_033569.1

name	Vps24 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31541959 CCDS:CCDS20232.1 GeneID:66700 MGI:1913950
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : neuroendocrine differentiation factor protein_id : NP_080059.2

name	Jmjd1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84662717 CCDS:CCDS20233.1 GeneID:104263 MGI:98847
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016702 - oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; testis specific gene A product : jumonji domain containing 1A isoform 1 protein_id : NP_766589.1

name	Jmjd1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84662721 GeneID:104263 MGI:98847
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016702 - oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform 2 is encoded by transcript variant 2; testis specific gene A product : jumonji domain containing 1A isoform 2 protein_id : NP_001033784.1

name	Reep1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30519931 GeneID:52250 MGI:1098827
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : receptor expression enhancing protein 1 protein_id : NP_848723.1

name	Mrpl35 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384830 CCDS:CCDS20234.1 GeneID:66223 MGI:1913473
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 product : mitochondrial ribosomal protein L35 protein_id : NP_079706.1

name	Immt (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70608131 GeneID:76614 MGI:1923864
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence ISS]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : inner membrane protein, mitochondrial protein_id : NP_083949.2

name	Ptcd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33469980 CCDS:CCDS20235.1 GeneID:69956 MGI:1917206
definition	codon_start : 1 product : Pentatricopeptide repeat domain 3 protein_id : NP_081551.2

name	Rpo1-4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328146 CCDS:CCDS20236.1 GeneID:20019 MGI:1096397
definition	GO_component : GO:0005736 - DNA-directed RNA polymerase I complex [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003899 - DNA-directed RNA polymerase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : RNA polymerase 1-4 (194 kDa subunit) product : RNA polymerase 1-4 protein_id : NP_033114.2

name	St3gal5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:78126157 CCDS:CCDS20237.1 GeneID:20454 MGI:1339963
definition	EC_number : 2.4.99.9 GO_component : GO:0000139 - Golgi membrane [Evidence ISS]; GO:0030173 - integral to Golgi membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0047291 - lactosylceramide alpha-2,3-sialyltransferase activity [Evidence IEA] [Evidence ISS]; GO:0008373 - sialyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0001574 - ganglioside biosynthesis [Evidence ISS]; GO:0006486 - protein amino acid glycosylation [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; ST3Gal V; mST3Gal V; GM3 synthase; GM3-specific sialytransferase; sialyltransferase 9 (CMP-NeuAc:lactosylceramide alpha-2,3-sialyltransferase) product : ST3 beta-galactoside alpha-2,3-sialyltransferase 5 isoform a protein_id : NP_001030305.1

name	St3gal5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:78126169 GeneID:20454 MGI:1339963
definition	EC_number : 2.4.99.9 GO_component : GO:0000139 - Golgi membrane [Evidence ISS]; GO:0030173 - integral to Golgi membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0047291 - lactosylceramide alpha-2,3-sialyltransferase activity [Evidence IEA] [Evidence ISS]; GO:0008373 - sialyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0001574 - ganglioside biosynthesis [Evidence ISS]; GO:0006486 - protein amino acid glycosylation [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; ST3Gal V; mST3Gal V; GM3 synthase; GM3-specific sialytransferase; sialyltransferase 9 (CMP-NeuAc:lactosylceramide alpha-2,3-sialyltransferase) product : ST3 beta-galactoside alpha-2,3-sialyltransferase 5 isoform b protein_id : NP_035505.2

name	Atoh8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24418872 GeneID:71093 MGI:1918343
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA] codon_start : 1 note : basic helix-loop-helix transcription factor 6 product : okadin protein_id : NP_722473.1

name	LOC100042853 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042853
definition	number : 1 pseudo : _no_value

name	LOC100042853 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042853
definition	number : 2 pseudo : _no_value

name	LOC100042853 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042853
definition	number : 3 pseudo : _no_value

name	LOC668029 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668029
definition	number : 2 pseudo : _no_value

name	LOC668029 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668029
definition	number : 1 pseudo : _no_value

name	LOC668057 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668057
definition	number : 1 pseudo : _no_value

name	Igkv6-25 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:381784
definition	gene_synonym : 19-25 standard_name : IGKV6-25

name	Igkv8-24 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:677858
definition	standard_name : IGKV8-24

name	Igkv8-23-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:434685
definition	standard_name : IGKV8-23-1

name	Igkv6-23 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:637227
definition	gene_synonym : 19-23; IgK standard_name : IGKV6-23

name	Igkv8-22 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:620387
definition	pseudo : _no_value standard_name : IGKV8-22

name	Igk-V8-21 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:620400
definition	gene_synonym : IGKV8-21 standard_name : IGKV8-21

name	Igk-V19-20 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:108024
definition	gene_synonym : IGKV6-20 standard_name : IGKV6-20

name	Igk-V8-19 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:232065
definition	gene_synonym : IGKV8-19 standard_name : IGKV8-19

name	Igk-V8-18 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:667859
definition	gene_synonym : IGKV8-18 standard_name : IGKV8-18

name	Igk-V19-17 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:667865
definition	gene_synonym : IGKV6-17 standard_name : IGKV6-17

name	Igk-V8-16 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:640340
definition	gene_synonym : IGKV8-16 standard_name : IGKV8-16

name	Igk-V19-15 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:108022
definition	gene_synonym : IGKV6-15 standard_name : IGKV6-15

name	Igk-V19-14 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:667881
definition	gene_synonym : IGKV6-14 standard_name : IGKV6-14

name	Igk-V19-13 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:667899
definition	gene_synonym : IGKV6-13 standard_name : IGKV6-13

name	Igkv3-12-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:667908
definition	pseudo : _no_value standard_name : IGKV3-12-1

name	Igk-V21-12 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:667914
definition	gene_synonym : IgK21-12; IGKV3-12 standard_name : IGKV3-12

name	Igk-V21-11 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:667917
definition	gene_synonym : IGKV3-11 pseudo : _no_value standard_name : IGKV3-11

name	Igk-V21-10 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:667924
definition	gene_synonym : IgK21-10; IGKV3-10 standard_name : IGKV3-10

name	Igk-V21-9 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:667928
definition	gene_synonym : IGKV3-9 standard_name : IGKV3-9

name	Igk-V21-8 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:108010
definition	gene_synonym : IGKV3-8 pseudo : _no_value standard_name : IGKV3-8

name	Igk-V21-7 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:108005
definition	gene_synonym : IgK21-7; IGKV3-7 standard_name : IGKV3-7

name	Igk-V21-6 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:667936
definition	gene_synonym : IGKV3-6 pseudo : _no_value standard_name : IGKV3-6

name	Igk-V21-5 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:667940
definition	gene_synonym : IgK21-5; IGKV3-5 standard_name : IGKV3-5

name	Igk-V21-4 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:626347
definition	gene_synonym : IGKV3-4 standard_name : IGKV3-4

name	Igk-V21-3 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:667946
definition	gene_synonym : IGKV3-3 standard_name : IGKV3-3

name	Igk-V21-2 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:626583
definition	gene_synonym : IgK; IgK21-2; IGKV3-2 standard_name : IGKV3-2

name	Igk-V21-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:108004
definition	gene_synonym : IgK21-1; IGKV3-1 standard_name : IGKV3-1

name	Igk-J1 (CDS detail)
type	J_segment
link	vega ensembl
xref	GeneID:110759
definition	standard_name : IGKJ1

name	Igk-J2 (CDS detail)
type	J_segment
link	vega ensembl
xref	GeneID:110760
definition	standard_name : IGKJ2

name	Igk-J3 (CDS detail)
type	J_segment
link	vega ensembl
xref	GeneID:110761
definition	standard_name : IGKJ3

name	Igk-J4 (CDS detail)
type	J_segment
link	vega ensembl
xref	GeneID:110762
definition	standard_name : IGKJ4

name	Igk-J5 (CDS detail)
type	J_segment
link	vega ensembl
xref	GeneID:110763
definition	standard_name : IGKJ5

name	Igk-C (CDS detail)
type	C_region
link	vega ensembl
xref	GeneID:16071
definition	gene_synonym : IGKC; MGC118128 standard_name : IGKC

name	(CDS detail)
type	STS
link
xref	UniSTS:42890
definition	standard_name : Z72372

name	(CDS detail)
type	STS
link
xref	UniSTS:143513
definition	standard_name : Igk-V19

name	(CDS detail)
type	STS
link
xref	UniSTS:11298
definition	standard_name : Z72373

name	(CDS detail)
type	STS
link
xref	UniSTS:46172
definition	standard_name : Z72374

name	(CDS detail)
type	STS
link
xref	UniSTS:143516
definition	standard_name : Igk-V21

name	(CDS detail)
type	STS
link
xref	UniSTS:237935
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:270499
definition	standard_name : PMC125515P1

name	(CDS detail)
type	STS
link
xref	UniSTS:273058
definition	standard_name : PMC316908P1

name	(CDS detail)
type	STS
link
xref	UniSTS:270579
definition	standard_name : PMC129040P1

name	(CDS detail)
type	STS
link
xref	UniSTS:273059
definition	standard_name : PMC316908P2

name	(CDS detail)
type	STS
link
xref	UniSTS:143507
definition	standard_name : Igk-C

name	(CDS detail)
type	STS
link
xref	UniSTS:143505
definition	standard_name : Igk-C

name	(CDS detail)
type	STS
link
xref	UniSTS:210946
definition	standard_name : RH127636

name	(CDS detail)
type	STS
link
xref	UniSTS:143506
definition	standard_name : Igk-C

name	(CDS detail)
type	STS
link
xref	UniSTS:179389
definition	standard_name : AV061724

name	(CDS detail)
type	STS
link
xref	UniSTS:271801
definition	standard_name : PMC196178P1

name	(CDS detail)
type	STS
link
xref	UniSTS:142601
definition	standard_name : D6Nds6

name	(CDS detail)
type	STS
link
xref	UniSTS:207976
definition	standard_name : AU017435

name	(CDS detail)
type	STS
link
xref	UniSTS:67437
definition	standard_name : Z72375

name	(CDS detail)
type	STS
link
xref	UniSTS:272318
definition	standard_name : PMC262586P2

name	(CDS detail)
type	STS
link
xref	UniSTS:86985
definition	standard_name : RH91182

name	(CDS detail)
type	STS
link
xref	UniSTS:159520
definition	standard_name : AI427929

name	(CDS detail)
type	STS
link
xref	UniSTS:471074
definition	standard_name : Foxi3

name	(CDS detail)
type	STS
link
xref	UniSTS:207975
definition	standard_name : RH126677

name	(CDS detail)
type	STS
link
xref	UniSTS:130714
definition	standard_name : D6Mit17

name	(CDS detail)
type	STS
link
xref	UniSTS:21714
definition	standard_name : D7S2425

name	(CDS detail)
type	STS
link
xref	UniSTS:130793
definition	standard_name : D6Mit244

name	(CDS detail)
type	STS
link
xref	UniSTS:159519
definition	standard_name : C78565

name	(CDS detail)
type	STS
link
xref	UniSTS:163389
definition	standard_name : AA792894

name	(CDS detail)
type	STS
link
xref	UniSTS:235465
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:130703
definition	standard_name : D6Mit16

name	(CDS detail)
type	STS
link
xref	UniSTS:141300
definition	standard_name : Cd8b

name	(CDS detail)
type	STS
link
xref	UniSTS:130665
definition	standard_name : D6Mit124

name	(CDS detail)
type	STS
link
xref	UniSTS:270412
definition	standard_name : PMC122808P1

name	(CDS detail)
type	STS
link
xref	UniSTS:141298
definition	standard_name : Cd8a

name	(CDS detail)
type	STS
link
xref	UniSTS:125906
definition	standard_name : Y00157

name	(CDS detail)
type	STS
link
xref	UniSTS:159518
definition	standard_name : Y00157

name	(CDS detail)
type	STS
link
xref	UniSTS:185670
definition	standard_name : BB154331

name	(CDS detail)
type	STS
link
xref	UniSTS:212677
definition	standard_name : RH129483

name	(CDS detail)
type	STS
link
xref	UniSTS:207974
definition	standard_name : AU024348

name	(CDS detail)
type	STS
link
xref	UniSTS:235471
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:235466
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:235467
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:268851
definition	standard_name : MARC_24177-24178:1033563974:1

name	(CDS detail)
type	STS
link
xref	UniSTS:179393
definition	standard_name : AW146237

name	(CDS detail)
type	STS
link
xref	UniSTS:271309
definition	standard_name : PMC154372P1

name	(CDS detail)
type	STS
link
xref	UniSTS:214171
definition	standard_name : RH130887

name	(CDS detail)
type	STS
link
xref	UniSTS:207977
definition	standard_name : C79882

name	(CDS detail)
type	STS
link
xref	UniSTS:167475
definition	standard_name : RH126761

name	(CDS detail)
type	STS
link
xref	UniSTS:224291
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:162108
definition	standard_name : RH125286

name	(CDS detail)
type	STS
link
xref	UniSTS:125633
definition	standard_name : T25656

name	(CDS detail)
type	STS
link
xref	UniSTS:130686
definition	standard_name : D6Mit143

name	(CDS detail)
type	STS
link
xref	UniSTS:159515
definition	standard_name : C87808

name	(CDS detail)
type	STS
link
xref	UniSTS:179390
definition	standard_name : AW558420

name	(CDS detail)
type	STS
link
xref	UniSTS:161843
definition	standard_name : RH125021

name	(CDS detail)
type	STS
link
xref	UniSTS:235469
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:159517
definition	standard_name : AF000938

name	(CDS detail)
type	STS
link
xref	UniSTS:130872
definition	standard_name : D6Mit319

name	(CDS detail)
type	STS
link
xref	UniSTS:271220
definition	standard_name : PMC152312P1

name	(CDS detail)
type	STS
link
xref	UniSTS:209590
definition	standard_name : Siat9

name	LOC668034 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149255251 GeneID:668034
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 7 Proteins product : similar to Ribosomal protein L19 pseudo : _no_value transcript_id : XR_034118.1

clone name	MSMg01-143P11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-148A16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-124P05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-424N12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-213H14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-148B14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-139O07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-084F09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-179H17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-368E24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-303E22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-483K03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-489N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-192M11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-192M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-436A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-260B08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-504M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351O15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-383L24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-271C03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-183L15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-213J06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-373D03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-341O21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-539H06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-172B24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-407B10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-460D03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-495L14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-054L21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-337M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-076P19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-079C07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-380D04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-521G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-481E17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-420J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-426P21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-292D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-524M13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502M21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-489L24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-053B24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-389F12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-186D14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-264C01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-298G18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-183N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-144O07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-430N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-068E06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-387D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-317L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-533O20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-267C03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-455E01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-540H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-411M17
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-189A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462H24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-475D11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-169K05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-362F09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-309G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-469M16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-490N16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-154C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-501G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-511B06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-092G14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-262C12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052D05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-142F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-453M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-376N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-039E14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029B24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-028I06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078O24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-191O02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-195B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290K23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-058A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-053J02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-281L16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-321I15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-072G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269H10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-059K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191O02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-098E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119M19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088F17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-303O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307K13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150J19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003J08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317E13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196M19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344I02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-152J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350G10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-218H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275O06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-218H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-346B02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-004N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278D19
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-172B24.T7 (MSMg01no172_b24.b1)	MSMg01-172B24.TJ (MSMg01no172_b24.g1)
ACC	AG368138	AG368139
length	740	785
length of high quality (start - end)	572 (34 - 605)	250 (68 - 317)
definition	CHROMAT_FILE: MSMg01no172_b24.b1 PHD_FILE: MSMg01no172_b24.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 19:42:31 2005	CHROMAT_FILE: MSMg01no172_b24.g1 PHD_FILE: MSMg01no172_b24.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 19:42:31 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXCGCGGAATTCAAAGCTA CTCTCCCTATAGTGATTTTGAGGCCAGCCTTGACTGCATGAGACCCTATC TCAAAGCAAAATACCAAAAACAAACGAATAAAAATACTAGACAGAAAAAG GATACCAGAAGTTGAGGAGATGTCTCATTTGGTAAGGAGCTTGCCTGAGT TCAGTCCCCAGTGCCCAAATAAATATCTGGCCCTGGTGATATGAGCGTGT GATCCCAATGCTAGAGCAACAGAGAAAGGAGGATAGCTGGGCTCAAGAAT CACCAAACTGGTGATTTCCAAAGAGTGTCTCAAAAGAGGTAGACAGTACC CAGGAAGATGACACTAGAGGTTTGCTTCTTTATTCTTCTATTCCGGTTTT TGTTTGTTTTGTTTTTTTGAGACAAGGTCTTACTGTGTAACTCTGTCTGG CCGGGAATTCATAGAGATCTGCCTGCCTCTGTATCCTGAGAGTTGGGAGT AAAGGCTTGTGCCACCAAGTCTAGTTTATGTATTCTAATTACACTTATTT ATTGTGTATGTGTGCTTGTACATGTAGGTGTGTGTATTAATAGGTCATGA AACTAGAACGAAGGCCATGAGAGGTAAGGAATAGATCTTACGTGTAACAA GGTATGCCAATGATATCTTGTGTTTGTACGTTTATGTCAGCCAATTATTC TAATTTCCTCCCTTTCCTCTCTTTTTTTTTTCCTCCCTCC	GTGTXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXATGTATCACAAGATGCGAGAGGCTGCCCTGTAC AACCAGCCCATGCAGGTCATGGCTGAGCCTAGCAATGAACCAGCCCCCGC TCTGTTCCATAAGAAGCAGTGAGGACCTTGTTGGAGGGTGGGGGGGCTGT GGCTGGGGAGCTGAGGAAATGACTACTCTGTGTCCTCCACTGTCGTTTTG GTTCAATTCAATTCAGTTTAGTTCTCTTTCATTTCAGACCAACTCTTTCT ACATGTGTCAGGTGCTTTTTTTCGCCATCTATTTAATAAGGGAGCCCCAA ATATAATTTTTTTTTTTCCCCAAAACCGNCCCCACATAAGGTATAGGATA ATAGTAAATGCCGTGCCCACCTCTAAAAAAAAAATTATAGGGGAGGGGGG TGGGTGCGTCCTCTTCTTTTTTTTTTTATCTTTCATTTTATGTGTGTTGT TGTCCGTTTCGCGTTGTTTATTGTTGTGTTATCTCGGTTTGTATCTTTTG TCTCTCTCATTGATTATTTTGTGCTCGTGTCAGTGTGGTTTTGTTGCGTT TTTGATCCTGTGTTTCTCCTTTGTTGCCTGTATGTTTGGTGCTGCCTTGT CCTTGCCGCTGTTTTGTGCTCCTTTTGTTTCTTCTTGTCTGCTTTTTGCT GTCCCCACCCCTGCGCCGCAGTCTTTGTCTTGTAATGTGCTTCTGTTGTC TTTACTGCGTTGGTTCTCTCTGTTCTTTCCCTTTG
quality values	Open. Hide. 12 12 21 21 19 10 9 9 19 19 39 44 48 30 28 28 28 28 30 21 16 9 9 9 11 9 11 21 15 22 28 29 29 31 39 59 59 36 36 36 50 50 50 36 36 33 50 50 50 28 27 17 22 22 25 22 28 34 34 41 41 41 33 33 33 36 36 36 57 57 53 53 50 37 42 47 47 47 59 59 53 53 53 53 68 57 59 59 59 59 59 59 59 59 59 59 57 57 57 38 36 36 36 36 44 47 47 41 41 34 27 22 15 11 13 13 18 28 34 41 37 39 44 44 59 53 53 53 53 53 50 50 50 50 50 50 47 57 57 50 50 53 57 57 57 59 59 59 57 42 42 42 42 43 43 57 68 68 68 68 68 68 68 68 68 68 68 50 50 50 51 50 50 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 59 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 59 59 57 57 57 68 68 68 68 57 57 57 57 57 59 59 59 57 57 57 57 57 68 68 57 57 57 57 57 57 59 59 57 57 57 57 57 68 68 68 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 68 68 68 68 68 68 68 62 62 52 52 62 43 62 62 43 35 43 62 62 62 62 62 62 68 68 68 68 68 62 62 62 62 62 62 62 62 68 68 68 62 62 62 62 62 62 62 62 62 43 41 39 35 33 33 35 43 43 43 43 43 39 44 31 31 31 43 35 35 39 62 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 68 68 62 62 62 62 39 39 43 43 45 45 62 62 68 68 68 68 68 57 57 57 57 57 57 59 59 59 57 68 68 68 68 68 59 59 59 59 68 68 68 68 68 68 57 57 52 57 57 57 57 57 57 59 57 43 57 57 57 57 68 68 68 68 68 68 59 68 68 68 59 59 52 57 52 59 59 59 59 57 57 57 57 52 57 57 57 57 59 59 52 50 50 59 59 44 44 33 35 35 43 43 32 32 17 17 17 41 34 43 43 44 44 44 48 57 57 57 57 57 54 57 57 59 57 68 68 68 68 68 68 68 59 59 48 48 48 59 59 59 59 48 48 48 57 57 68 57 59 48 48 40 43 30 30 28 37 32 42 42 43 30 30 17 17 17 30 25 28 31 24 21 21 12 15 15 29 29 23 23 23 23 19 15 13 10 10 10 10 11 11 19 23 28 34 28 33 31 32 23 22 20 31 18 16 13 12 12 22 12 12 12 10 10 12 12 18 19 17 11 12 11 13 13 11 11 11 13 13 10 10 10 8 10 8 8 8 8 13 11 10 10 10 10 9 10 10 10 11 10 10 10 9 9 9 9 10 9 9 10 13 8 8 8 8 8 8 8 7 8 12 10 11 9 12 11 8 8 8 8 10 10 10 6 6 8 8 11 18 12 13 11 10 8 8 8 8 8 8 8 8 10 8 8 13 24 12 8 8 8 11 15 16 12 13 17 22 22 25 19 22 14 14 11 13 16 16 18 15 12 10 10 25 26 30 24 17 12 10 10	Open. Hide. 8 10 8 6 6 8 19 19 59 46 46 46 43 46 46 48 57 57 59 59 57 57 57 57 48 48 48 47 43 37 36 36 36 48 42 43 43 40 40 42 46 48 54 54 54 54 57 57 54 54 54 57 50 50 50 50 46 50 57 57 57 41 41 41 41 50 41 47 47 57 54 47 57 47 47 47 47 47 47 57 57 57 57 54 54 54 50 50 50 59 59 68 68 68 59 59 57 47 47 47 52 52 52 52 52 52 57 57 52 52 52 52 52 52 52 52 52 37 52 43 43 43 59 57 57 52 52 57 59 57 52 52 43 37 52 44 50 43 43 57 46 47 48 57 59 59 50 57 48 48 57 57 57 57 57 59 57 48 48 44 46 44 48 48 46 46 47 47 43 47 47 57 42 47 47 47 57 57 59 54 54 48 48 48 48 48 47 43 43 47 47 43 48 48 48 48 47 43 29 29 40 40 43 28 28 12 12 11 19 21 40 34 31 23 22 28 31 39 39 37 39 37 39 35 35 35 47 30 30 12 12 11 23 28 47 47 47 40 40 43 43 43 48 48 48 48 25 27 12 11 11 23 23 43 43 43 43 42 39 39 39 35 39 36 42 42 46 46 37 32 23 23 23 44 44 59 68 57 57 54 54 54 57 57 42 37 30 30 37 37 33 43 43 43 59 59 59 57 48 47 34 23 23 14 15 8 9 11 27 23 28 28 24 15 15 9 10 10 10 11 8 8 8 8 9 21 24 24 28 19 23 23 30 28 25 25 19 25 15 15 14 18 18 34 34 43 43 43 48 41 41 29 29 18 17 14 14 11 16 13 14 14 14 27 25 21 18 16 11 12 9 9 6 6 6 6 6 3 0 3 12 12 12 10 12 12 11 23 22 15 12 8 10 10 19 21 23 30 37 30 28 18 17 11 11 9 11 11 17 15 15 10 8 6 6 8 8 9 9 10 13 16 11 12 12 11 10 14 18 23 23 15 14 10 11 11 13 19 15 15 16 16 12 12 12 19 15 11 10 6 7 6 8 8 8 8 8 8 8 8 8 11 10 10 8 8 8 8 8 12 10 12 12 12 15 10 10 10 8 8 8 8 6 8 8 9 13 15 9 9 9 10 8 6 6 6 8 12 8 8 8 8 8 8 8 7 10 12 12 12 8 8 8 8 6 6 8 8 9 9 10 13 10 10 8 8 8 8 8 8 10 11 8 8 8 8 8 10 12 8 8 8 8 8 8 8 8 8 8 8 6 7 8 8 8 8 6 6 8 8 8 8 6 6 6 6 8 6 8 6 6 8 8 8 8 8 8 8 8 8 8 8 8 6 6 8 8 6 6 8 8 10 8 8 8 10 11 11 10 10 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 9 9 10 10 11 8 8 8 8 6 6 8 8 10 8 8 8 9 9 9 9 10 8 8 8 7 8 8 8 10 10 8 8 8 8 8 10 8 8 8 8 8 8 8 8 8 11 8 14 10 10 8 8 8 8 8 8 8 10 7 6 6 8 8 9 9 9 9 9 9 9 9 9 9 8 8 8 8 8 11 16 11 12 8 8 15 10 8 11 11 11 11 8 8 8 8 8 8 8 8 8 8 8 8 8 6 6 8 8 8 8 8 8 8 11 10 9 8 8 8 8 8 10 10 8 8 8 8 11 8 8 6 6 8 8 8 10 8 8 8 6 7 8 8 8 6 6 8 8 11 13 8 8 6 6 8 8 8 8 8 8 8 8 8 10 8 8 8 8 8

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no172_b24.g1 MSMg01no172_b24.g1 CHROMAT_FILE:
MSMg01no172_b24.g1 PHD_FILE: MSMg01no172_b24.g1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 19:42:31 2005
         (250 letters)



>mm_chr6_71165401_71166050
          Length = 650

 Score =  466 bits (241), Expect = e-136
 Identities = 247/249 (99%)
 Strand = Plus / Minus

                                                                       
Query: 1   atgtatcacaagatgcgagaggctgccctgtacaaccagcccatgcaggtcatggctgag 60
           |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 449 atgtatcacaagatgcgagaggctgccctgaacaaccagcccatgcaggtcatggctgag 390

                                                                       
Query: 61  cctagcaatgaaccagcccccgctctgttccataagaagcagtgaggaccttgttggagg 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 389 cctagcaatgaaccagcccccgctctgttccataagaagcagtgaggaccttgttggagg 330

                                                                       
Query: 121 gtgggggggctgtggctggggagctgaggaaatgactactctgtgtcctccactgtcgtt 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 329 gtgggggggctgtggctggggagctgaggaaatgactactctgtgtcctccactgtcgtt 270

                                                                       
Query: 181 ttggttcaattcaattcagtttagttctctttcatttcagaccaactctttctacatgtg 240
           |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 269 ttggttcaattcaattcagtttagttctctttcatttcagaccaactcttcctacatgtg 210

                    
Query: 241 tcaggtgct 249
           |||||||||
Sbjct: 209 tcaggtgct 201


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 14
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 250
Length of database: 650
Length adjustment: 9
Effective length of query: 241
Effective length of database: 641
Effective search space:   154481
Effective search space used:   154481
X1: 7 (13.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 7 (14.4 bits)
S2: 7 (14.3 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information