MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-197A06
Chromosome	6 (Build37)
Map Location	67,971,329 - 67,971,942
singlet/doublet	singlet
Overlap gene	Igk
Upstream gene	Gadd45a, E230016M11Rik, EG667310, LOC667318, Serbp1, Il12rb2, LOC667324, EG667326, LOC672137, EG209589, LOC100042890, Il23r, Tacstd2, Igkv2-137, 4930515G16Rik, Igkv1-136, Igkv1-135, LOC723992, EG628006, Igkv14-134-1, Igkv17-134, EG628027, LOC384401, EG628042, EG243423, EG628056, EG628072, Igkv9-129, Igkv9-128, EG243433, Igkv14-126-1, LOC723993, EG628127, ENSMUSG00000050218, EG243431, EG628144, Igkv1-122
Downstream gene	EG667435, EG434025, Igkv9-119, Igkv14-118-2, Igkv14-118-1, EG384405, Igkv11-118, Igkv1-117, EG434026, EG628206, Igkv11-114, Igkv2-113, LOC232047, EG381776, Igkv14-111, Igkv1-110, Igkv2-109, Igkv1-108, Igkv2-107, Igkv11-106, Igkv2-105, LOC384408, Gm1067, Igkv15-103, Igkv15-102, Igkv20-101-2, Igkv15-101-1, Igkv15-101, Igkv14-100, Igkv1-99, Igkv12-98, Igkv15-97, Igkv10-96, Igkv2-95-2, Igkv2-95-1, EG434031, EG667550, Igkv2-93-1, Igkv19-93, Gm1408, ENSMUSG00000056850, Igkv4-90, Igkv13-89-1, Igkv12-89, Igkv1-88, Igkv13-87, Gm459, Igkv13-85, Igkv13-84, Igkv4-83, Igkv13-82, Gm460, Igkv13-80-1, Igkv4-80
Link	Open Mouse BAC browser

Click to get alignment info.

name	Gadd45a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13197 MGI:107799
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	E230016M11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320172 MGI:2443524
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs

name	EG667310 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667310 MGI:3647296
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 177 ESTs, 14 Proteins

name	LOC667318 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667318
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Serbp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66870 MGI:1914120
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Il12rb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16162 MGI:1270861
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667324 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667324
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	EG667326 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667326 MGI:3643886
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC672137 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:672137
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	EG209589 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209589 MGI:3648855
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins

name	LOC100042890 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042890
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 4 Proteins pseudo : _no_value

name	Il23r (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209590 MGI:2181693
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tacstd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56753 MGI:1861606
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Igk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243469 MGI:96494
definition	gene_synonym : kappa note : immunoglobulin kappa chain complex

name	Igkv2-137 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:692187 IMGT/GENE-DB:IGKV2-137
definition	note : immunoglobulin kappa chain variable 2-137

name	4930515G16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75070 MGI:1922320
definition	note : RIKEN cDNA 4930515G16 gene; myc induced nuclear antigen pseudogene pseudo : _no_value

name	Igkv1-136 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:692186 IMGT/GENE-DB:IGKV1-136
definition	gene_synonym : bc1 note : immunoglobulin kappa chain variable 1-136 pseudo : _no_value

name	Igkv1-135 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:243420 IMGT/GENE-DB:IGKV1-135
definition	gene_synonym : bd2 note : immunoglobulin kappa chain variable 1-135

name	LOC723992 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:723992
definition	note : tubulin, alpha 1 pseudogene pseudo : _no_value

name	EG628006 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628006 MGI:3648164
definition	note : predicted gene, EG628006; ribosomal protein L18a pseudogene pseudo : _no_value

name	Igkv14-134-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:692185
definition	gene_synonym : cx9 note : immunoglobulin kappa chain variable 14-134-1 pseudo : _no_value

name	Igkv17-134 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:692184 IMGT/GENE-DB:IGKV17-134
definition	gene_synonym : Igk-Vk20(294A9) note : immunoglobulin kappa chain variable 17-134 pseudo : _no_value

name	EG628027 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628027 IMGT/GENE-DB:IGKV1-133 MGI:3648380
definition	gene_synonym : Igk-Vk2(70/1); Igkv1-133 note : predicted gene, EG628027

name	LOC384401 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:384401
definition	note : tubulin, alpha 1 pseudogene pseudo : _no_value

name	EG628042 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628042 MGI:3648591
definition	note : predicted gene, EG628042; ribosomal protein L18a pseudogene pseudo : _no_value

name	EG243423 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243423 IMGT/GENE-DB:IGKV1-132 MGI:3648800
definition	gene_synonym : bi2; Igkv1-132 note : predicted gene, EG243423

name	EG628056 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628056 IMGT/GENE-DB:IGKV1-131 MGI:3645551
definition	gene_synonym : bh2; Igkv1-131 note : predicted gene, EG628056

name	EG628072 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628072 IMGT/GENE-DB:IGKV14-130 MGI:3645770
definition	gene_synonym : cb9; Igkv14-130 note : predicted gene, EG628072

name	Igkv9-129 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:692182 IMGT/GENE-DB:IGKV9-129
definition	note : immunoglobulin kappa chain variable 9-129

name	Igkv9-128 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:692181 IMGT/GENE-DB:IGKV9-128
definition	note : immunoglobulin kappa chain variable 9-128 pseudo : _no_value

name	EG243433 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243433 IMGT/GENE-DB:IGKV17-127 MGI:3646891
definition	gene_synonym : bw20; Igkv17-127 note : predicted gene, EG243433

name	Igkv14-126-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:692180 IMGT/GENE-DB:IGKV14-126-1
definition	gene_synonym : co9 note : immunoglobulin kappa chain variable 14-126-1 pseudo : _no_value

name	LOC723993 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:723993
definition	note : ARP2 actin-related protein 2 homolog (yeast) pseudogene pseudo : _no_value

name	EG628127 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628127 IMGT/GENE-DB:IGKV14-126 MGI:3643131
definition	gene_synonym : br9; Igkv14-126 note : predicted gene, EG628127 pseudo : _no_value

name	ENSMUSG00000050218 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243428 IMGT/GENE-DB:IGKV11-125 MGI:3642338
definition	gene_synonym : if11; Igkv11-125 note : predicted gene, ENSMUSG00000050218

name	EG243431 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243431 IMGT/GENE-DB:IGKV9-124 MGI:3646892
definition	gene_synonym : Igkv9-124 note : predicted gene, EG243431

name	EG628144 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628144 IMGT/GENE-DB:IGKV9-123 MGI:3643848
definition	gene_synonym : Igkv9-123 note : predicted gene, EG628144

name	Igkv1-122 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:434024 IMGT/GENE-DB:IGKV1-122
definition	gene_synonym : bl1 note : immunoglobulin kappa chain variable 1-122

name	EG667435 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667435 IMGT/GENE-DB:IGKV17-121 MGI:3647671
definition	gene_synonym : bt20; Igkv17-121 note : predicted gene, EG667435

name	EG434025 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434025 IMGT/GENE-DB:IGKV9-120 MGI:3647784
definition	gene_synonym : Igkv9-120 note : predicted gene, EG434025

name	Igkv9-119 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:692177 IMGT/GENE-DB:IGKV9-119
definition	gene_synonym : bp9 note : immunoglobulin kappa chain variable 9-119 pseudo : _no_value

name	Igkv14-118-2 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:692176 IMGT/GENE-DB:IGKV14-118-2
definition	gene_synonym : bq9 note : immunoglobulin kappa chain variable 14-118-2 pseudo : _no_value

name	Igkv14-118-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:692175 IMGT/GENE-DB:IGKV14-118-1
definition	note : immunoglobulin kappa chain variable 14-118-1 pseudo : _no_value

name	EG384405 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384405 MGI:3646419
definition	note : predicted gene, EG384405; nucleosome assembly protein 1-like 1 pseudogene pseudo : _no_value

name	Igkv11-118 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:692174 IMGT/GENE-DB:IGKV11-118
definition	gene_synonym : ie11 note : immunoglobulin kappa chain variable 11-118 pseudo : _no_value

name	Igkv1-117 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:16098 IMGT/GENE-DB:IGKV1-117
definition	gene_synonym : Igk-V21; V(k)45.1 note : immunoglobulin kappa chain variable 1-117

name	EG434026 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434026 IMGT/GENE-DB:IGKV2-116 MGI:3647785
definition	gene_synonym : IGKhk24; Igkv2-116 note : predicted gene, EG434026 pseudo : _no_value

name	EG628206 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628206 IMGT/GENE-DB:IGKV1-115 MGI:3644873
definition	gene_synonym : cz1; Igkv1-115 note : predicted gene, EG628206 pseudo : _no_value

name	Igkv11-114 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:692173 IMGT/GENE-DB:IGKV11-114
definition	gene_synonym : ic11 note : immunoglobulin kappa chain variable pseudo : _no_value

name	Igkv2-113 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:692172 IMGT/GENE-DB:IGKV2-113
definition	gene_synonym : ha24 note : immunoglobulin kappa chain variable 2-113 pseudo : _no_value

name	LOC232047 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:232047
definition	note : cortactin pseudogene pseudo : _no_value

name	EG381776 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381776 IMGT/GENE-DB:IGKV2-112 MGI:3644894
definition	gene_synonym : hg24; Igkv2-112 note : predicted gene, EG381776

name	Igkv14-111 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545847 IMGT/GENE-DB:IGKV14-111
definition	note : immunoglobulin kappa chain variable 14-111

name	Igkv1-110 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:381777 IMGT/GENE-DB:IGKV1-110
definition	gene_synonym : Igk; K5.1 note : immunoglobulin kappa chain variable 1-110

name	Igkv2-109 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628268 IMGT/GENE-DB:IGKV2-109
definition	gene_synonym : he24 note : immunoglobulin kappa chain variable 2-109

name	Igkv1-108 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628272 IMGT/GENE-DB:IGKV1-108
definition	note : immunoglobulin kappa chain variable 1-108 pseudo : _no_value

name	Igkv2-107 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628283 IMGT/GENE-DB:IGKV2-107
definition	gene_synonym : hc24 note : immunoglobulin kappa chain variable 2-107 pseudo : _no_value

name	Igkv11-106 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628293 IMGT/GENE-DB:IGKV11-106
definition	gene_synonym : ia11 note : Ig kappa chain variable region ia11 pseudo : _no_value

name	Igkv2-105 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:692170 IMGT/GENE-DB:IGKV2-105
definition	gene_synonym : hd24 note : immunoglobulin kappa chain variable 2-105 pseudo : _no_value

name	LOC384408 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:384408
definition	note : cortactin pseudogene pseudo : _no_value

name	Gm1067 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381778 IMGT/GENE-DB:IGKV16-104 MGI:2685913
definition	gene_synonym : IGKV16-104; rf note : gene model 1067, (NCBI)

name	Igkv15-103 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:692169 IMGT/GENE-DB:IGKV15-103
definition	note : immunoglobulin kappa chain variable 15-103

name	Igkv15-102 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:692171 IMGT/GENE-DB:IGKV15-102
definition	note : immunoglobulin kappa chain variable 15-102 pseudo : _no_value

name	Igkv20-101-2 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:724035 IMGT/GENE-DB:IGKV20-101-2
definition	note : immunoglobulin kappa chain variable 20-101-2

name	Igkv15-101-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:692167 IMGT/GENE-DB:IGKV15-101-1
definition	note : immunoglobulin kappa chain variable 15-101-1 pseudo : _no_value

name	Igkv15-101 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:692168 IMGT/GENE-DB:IGKV15-101
definition	note : immunoglobulin kappa chain variable 15-101 pseudo : _no_value

name	Igkv14-100 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:243439 IMGT/GENE-DB:IGKV14-100
definition	gene_synonym : cf9 note : immunoglobulin kappa chain variable 14-100

name	Igkv1-99 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:434028 IMGT/GENE-DB:IGKV1-99
definition	gene_synonym : cv1 note : immunoglobulin light chain variable region

name	Igkv12-98 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:435900 IMGT/GENE-DB:IGKV12-98
definition	gene_synonym : ci12 note : immunoglobulin light chain variable region

name	Igkv15-97 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:692166 IMGT/GENE-DB:IGKV15-97
definition	note : immunoglobulin kappa chain variable 15-97 pseudo : _no_value

name	Igkv10-96 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:692165 IMGT/GENE-DB:IGKV10-96
definition	note : immunoglobulin kappa chain variable

name	Igkv2-95-2 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:692164 IMGT/GENE-DB:IGKV2-95-2
definition	gene_synonym : hi24 note : immunoglobulin kappa chain variable 2-95-2 pseudo : _no_value

name	Igkv2-95-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:692163 IMGT/GENE-DB:IGKV2-95-1
definition	gene_synonym : hb24 note : immunoglobulin kappa chain variable pseudo : _no_value

name	EG434031 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434031 IMGT/GENE-DB:IGKV10-95 MGI:3644598
definition	gene_synonym : Igkv10-95; Vk10c note : predicted gene, EG434031

name	EG667550 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667550 IMGT/GENE-DB:IGKV10-94 MGI:3646140
definition	gene_synonym : AJ2; Igkv10-94 note : predicted gene, EG667550

name	Igkv2-93-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:692162 IMGT/GENE-DB:IGKV2-93-1
definition	gene_synonym : hh24 note : immunoglobulin kappa chain variable 2-93-1 pseudo : _no_value

name	Igkv19-93 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:692161 IMGT/GENE-DB:IGKV19-93
definition	note : immunoglobulin kappa chain variable 19-93

name	Gm1408 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384410 IMGT/GENE-DB:IGKV4-92 MGI:2686254
definition	gene_synonym : Igkay4; IGKV4-92 note : gene model 1408, (NCBI)

name	ENSMUSG00000056850 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434033 IMGT/GENE-DB:IGKV4-91 MGI:3642277
definition	gene_synonym : Igkv4-91; kf4 note : predicted gene, ENSMUSG00000056850

name	Igkv4-90 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:434034 IMGT/GENE-DB:IGKV4-90
definition	gene_synonym : an4 note : immunoglobulin light chain variable region

name	Igkv13-89-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:692155 IMGT/GENE-DB:IGKV13-89-1
definition	gene_synonym : gf33 note : immunoglobulin kappa chain variable 13-89-1 pseudo : _no_value

name	Igkv12-89 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:384411 IMGT/GENE-DB:IGKV12-89
definition	gene_synonym : fl12 note : immunoglobulin light chain variable region

name	Igkv1-88 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:692154 IMGT/GENE-DB:IGKV1-88
definition	note : immunoglobulin kappa chain variable 1-88

name	Igkv13-87 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:692153 IMGT/GENE-DB:IGKV13-87
definition	note : immunoglobulin kappa chain variable 13-87 pseudo : _no_value

name	Gm459 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243451 IMGT/GENE-DB:IGKV4-86 MGI:2685305
definition	gene_synonym : IGKV4-86; kb4 note : gene model 459, (NCBI)

name	Igkv13-85 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:434036 IMGT/GENE-DB:IGKV13-85
definition	gene_synonym : gn33 note : immunoglobulin light chain variable region

name	Igkv13-84 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:692152 IMGT/GENE-DB:IGKV13-84
definition	gene_synonym : gm33 note : immunoglobulin kappa chain variable 13-84

name	Igkv4-83 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:692145 IMGT/GENE-DB:IGKV4-83
definition	gene_synonym : kg4 note : immunoglobulin kappa chain variable 4-83 pseudo : _no_value

name	Igkv13-82 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:692144 IMGT/GENE-DB:IGKV13-82
definition	note : immunoglobulin kappa chain variable 13-82 pseudo : _no_value

name	Gm460 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243453 IMGT/GENE-DB:IGKV4-81 MGI:2685306
definition	gene_synonym : IGKV4-81; IgVkag4 note : gene model 460, (NCBI)

name	Igkv13-80-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:692143 IMGT/GENE-DB:IGKV13-80-1
definition	note : immunoglobulin kappa chain variable 13-80-1 pseudo : _no_value

name	Igkv4-80 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545848 IMGT/GENE-DB:IGKV4-80
definition	gene_synonym : af4 note : immunoglobulin kappa chain variable 4-80

name	Gadd45a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6681148 GeneID:13197 MGI:107799
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : growth arrest and DNA-damage-inducible 45 alpha transcript_id : NM_007836.1

name	E230016M11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255184 GeneID:320172 MGI:2443524
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs product : RIKEN cDNA E230016M11 gene transcript_id : XM_989634.2

name	EG667310 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255211 GeneID:667310 MGI:3647296
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 177 ESTs, 14 Proteins product : predicted gene, EG667310 transcript_id : XM_989693.2

name	Serbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13385279 GeneID:66870 MGI:1914120
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Serpine1 mRNA binding protein 1 transcript_id : NM_025814.1

name	Il12rb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803153 GeneID:16162 MGI:1270861
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 12 receptor, beta 2 transcript_id : NM_008354.2

name	EG209589 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255190 GeneID:209589 MGI:3648855
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins product : predicted gene, EG209589 transcript_id : XM_144761.6

name	Il23r (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21362352 GeneID:209590 MGI:2181693
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 23 receptor transcript_id : NM_144548.1

name	Tacstd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113866004 GeneID:56753 MGI:1861606
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tumor-associated calcium signal transducer 2 transcript_id : NM_020047.3

name	4930515G16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110347557 GeneID:75070 MGI:1922320
definition	product : RIKEN cDNA 4930515G16 gene pseudo : _no_value transcript_id : NR_003100.1

name	Gadd45a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681149 CCDS:CCDS20217.1 GeneID:13197 MGI:107799
definition	GO_component : GO:0005634 - nucleus [Evidence TAS] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0007050 - cell cycle arrest [Evidence IEA]; GO:0007098 - centrosome cycle [Evidence IGI]; GO:0006469 - negative regulation of protein kinase activity [Evidence IDA]; GO:0000074 - regulation of progression through cell cycle [Evidence IDA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 note : DNA-damage inducible transcript 1; Gadd45alpha; growth arrest and DNA-damage-inducible, alpha product : growth arrest and DNA-damage-inducible 45 alpha protein_id : NP_031862.1

name	E230016M11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94377407 GeneID:320172 MGI:2443524
definition	codon_start : 1 product : hypothetical protein LOC320172 protein_id : XP_994728.1

name	EG667310 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94377409 GeneID:667310 MGI:3647296
definition	codon_start : 1 product : hypothetical protein protein_id : XP_994787.1

name	Serbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385280 CCDS:CCDS20219.1 GeneID:66870 MGI:1914120
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003730 - mRNA 3'-UTR binding [Evidence ISS]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : PAI-1 mRNA-binding protein product : SERPINE1 mRNA binding protein 1 protein_id : NP_080090.1

name	Il12rb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680401 CCDS:CCDS20220.1 GeneID:16162 MGI:1270861
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004896 - hematopoietin/interferon-class (D200-domain) cytokine receptor activity [Evidence IEA]; GO:0004907 - interleukin receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007166 - cell surface receptor linked signal transduction [Evidence IEA] codon_start : 1 note : interferon response to microorganisms product : interleukin 12 receptor, beta 2 protein_id : NP_032380.1

name	EG209589 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255191 GeneID:209589 MGI:3648855
definition	codon_start : 1 product : similar to ribosomal protein S7 protein_id : XP_144761.6

name	Il23r (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21362353 GeneID:209590 MGI:2181693
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0042019 - interleukin-23 binding [Evidence ISS]; GO:0042020 - interleukin-23 receptor activity [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0019221 - cytokine and chemokine mediated signaling pathway [Evidence ISS]; GO:0007259 - JAK-STAT cascade [Evidence ISS]; GO:0002443 - leukocyte mediated immunity [Evidence ISS] codon_start : 1 product : interleukin 23 receptor protein_id : NP_653131.1

name	Tacstd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560359 CCDS:CCDS20221.1 GeneID:56753 MGI:1861606
definition	GO_component : GO:0005886 - plasma membrane [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA] codon_start : 1 note : lymphocyte antigen 97; tunor-associated calcium signal transducer 2 product : tumor-associated calcium signal transducer 2 protein_id : NP_064431.2

name	Igkv2-137 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:692187 IMGT/GENE-DB:IGKV2-137
definition	codon_start : 1 exception : rearrangement required for product

name	Igkv1-136 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:692186 IMGT/GENE-DB:IGKV1-136
definition	codon_start : 1 gene_synonym : bc1 pseudo : _no_value

name	Igkv1-135 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:243420 IMGT/GENE-DB:IGKV1-135
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : bd2

name	Igkv14-134-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:692185
definition	codon_start : 1 gene_synonym : cx9 pseudo : _no_value

name	Igkv17-134 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:692184 IMGT/GENE-DB:IGKV17-134
definition	codon_start : 1 gene_synonym : Igk-Vk20(294A9) pseudo : _no_value

name	EG628027 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:628027 IMGT/GENE-DB:IGKV1-133 MGI:3648380
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : Igk-Vk2(70/1); Igkv1-133

name	EG243423 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:243423 IMGT/GENE-DB:IGKV1-132 MGI:3648800
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : bi2; Igkv1-132

name	EG628056 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:628056 IMGT/GENE-DB:IGKV1-131 MGI:3645551
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : bh2; Igkv1-131

name	EG628072 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:628072 IMGT/GENE-DB:IGKV14-130 MGI:3645770
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : cb9; Igkv14-130

name	Igkv9-129 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:692182 IMGT/GENE-DB:IGKV9-129
definition	codon_start : 1 exception : rearrangement required for product

name	Igkv9-128 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:692181 IMGT/GENE-DB:IGKV9-128
definition	codon_start : 1 pseudo : _no_value

name	EG243433 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:243433 IMGT/GENE-DB:IGKV17-127 MGI:3646891
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : bw20; Igkv17-127

name	Igkv14-126-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:692180 IMGT/GENE-DB:IGKV14-126-1
definition	codon_start : 1 gene_synonym : co9 pseudo : _no_value

name	EG628127 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:628127 IMGT/GENE-DB:IGKV14-126 MGI:3643131
definition	codon_start : 1 gene_synonym : br9; Igkv14-126 pseudo : _no_value

name	ENSMUSG00000050218 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:243428 IMGT/GENE-DB:IGKV11-125 MGI:3642338
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : if11; Igkv11-125

name	EG243431 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:243431 IMGT/GENE-DB:IGKV9-124 MGI:3646892
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : Igkv9-124

name	EG628144 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:628144 IMGT/GENE-DB:IGKV9-123 MGI:3643848
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : Igkv9-123

name	Igkv1-122 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:434024 IMGT/GENE-DB:IGKV1-122
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : bl1

name	EG667435 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:667435 IMGT/GENE-DB:IGKV17-121 MGI:3647671
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : bt20; Igkv17-121

name	EG434025 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:434025 IMGT/GENE-DB:IGKV9-120 MGI:3647784
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : Igkv9-120

name	Igkv9-119 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:692177 IMGT/GENE-DB:IGKV9-119
definition	codon_start : 1 gene_synonym : bp9 pseudo : _no_value

name	Igkv14-118-2 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:692176 IMGT/GENE-DB:IGKV14-118-2
definition	codon_start : 1 gene_synonym : bq9 pseudo : _no_value

name	Igkv14-118-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:692175 IMGT/GENE-DB:IGKV14-118-1
definition	codon_start : 1 pseudo : _no_value

name	Igkv11-118 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:692174 IMGT/GENE-DB:IGKV11-118
definition	codon_start : 1 gene_synonym : ie11 pseudo : _no_value

name	Igkv1-117 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:16098 IMGT/GENE-DB:IGKV1-117
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : Igk-V21; V(k)45.1

name	EG434026 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:434026 IMGT/GENE-DB:IGKV2-116 MGI:3647785
definition	codon_start : 1 gene_synonym : IGKhk24; Igkv2-116 pseudo : _no_value

name	EG628206 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:628206 IMGT/GENE-DB:IGKV1-115 MGI:3644873
definition	codon_start : 1 gene_synonym : cz1; Igkv1-115 pseudo : _no_value

name	Igkv11-114 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:692173 IMGT/GENE-DB:IGKV11-114
definition	codon_start : 1 gene_synonym : ic11 pseudo : _no_value

name	Igkv2-113 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:692172 IMGT/GENE-DB:IGKV2-113
definition	codon_start : 1 gene_synonym : ha24 pseudo : _no_value

name	EG381776 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:381776 IMGT/GENE-DB:IGKV2-112 MGI:3644894
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : hg24; Igkv2-112

name	Igkv14-111 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:545847 IMGT/GENE-DB:IGKV14-111
definition	codon_start : 1 exception : rearrangement required for product

name	Igkv1-110 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:381777 IMGT/GENE-DB:IGKV1-110
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : Igk; K5.1

name	Igkv2-109 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:628268 IMGT/GENE-DB:IGKV2-109
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : he24

name	Igkv1-108 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:628272 IMGT/GENE-DB:IGKV1-108
definition	codon_start : 1 pseudo : _no_value

name	Igkv2-107 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:628283 IMGT/GENE-DB:IGKV2-107
definition	codon_start : 1 gene_synonym : hc24 pseudo : _no_value

name	Igkv11-106 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:628293 IMGT/GENE-DB:IGKV11-106
definition	codon_start : 1 gene_synonym : ia11 pseudo : _no_value

name	Igkv2-105 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:692170 IMGT/GENE-DB:IGKV2-105
definition	codon_start : 1 gene_synonym : hd24 pseudo : _no_value

name	Gm1067 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:381778 IMGT/GENE-DB:IGKV16-104 MGI:2685913
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGKV16-104; rf

name	Igkv15-103 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:692169 IMGT/GENE-DB:IGKV15-103
definition	codon_start : 1 exception : rearrangement required for product

name	Igkv15-102 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:692171 IMGT/GENE-DB:IGKV15-102
definition	codon_start : 1 pseudo : _no_value

name	Igkv20-101-2 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:724035 IMGT/GENE-DB:IGKV20-101-2
definition	codon_start : 1 exception : rearrangement required for product

name	Igkv15-101-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:692167 IMGT/GENE-DB:IGKV15-101-1
definition	codon_start : 1 pseudo : _no_value

name	Igkv15-101 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:692168 IMGT/GENE-DB:IGKV15-101
definition	codon_start : 1 pseudo : _no_value

name	Igkv14-100 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:243439 IMGT/GENE-DB:IGKV14-100
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : cf9

name	Igkv1-99 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:434028 IMGT/GENE-DB:IGKV1-99
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : cv1

name	Igkv12-98 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:435900 IMGT/GENE-DB:IGKV12-98
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : ci12

name	Igkv15-97 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:692166 IMGT/GENE-DB:IGKV15-97
definition	codon_start : 1 pseudo : _no_value

name	Igkv10-96 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:692165 IMGT/GENE-DB:IGKV10-96
definition	codon_start : 1 exception : rearrangement required for product

name	Igkv2-95-2 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:692164 IMGT/GENE-DB:IGKV2-95-2
definition	codon_start : 1 gene_synonym : hi24 pseudo : _no_value

name	Igkv2-95-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:692163 IMGT/GENE-DB:IGKV2-95-1
definition	codon_start : 1 gene_synonym : hb24 pseudo : _no_value

name	EG434031 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:434031 IMGT/GENE-DB:IGKV10-95 MGI:3644598
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : Igkv10-95; Vk10c

name	EG667550 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:667550 IMGT/GENE-DB:IGKV10-94 MGI:3646140
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : AJ2; Igkv10-94

name	Igkv2-93-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:692162 IMGT/GENE-DB:IGKV2-93-1
definition	codon_start : 1 gene_synonym : hh24 pseudo : _no_value

name	Igkv19-93 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:692161 IMGT/GENE-DB:IGKV19-93
definition	codon_start : 1 exception : rearrangement required for product

name	Gm1408 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:384410 IMGT/GENE-DB:IGKV4-92 MGI:2686254
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : Igkay4; IGKV4-92

name	ENSMUSG00000056850 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:434033 IMGT/GENE-DB:IGKV4-91 MGI:3642277
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : Igkv4-91; kf4

name	Igkv4-90 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:434034 IMGT/GENE-DB:IGKV4-90
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : an4

name	Igkv13-89-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:692155 IMGT/GENE-DB:IGKV13-89-1
definition	codon_start : 1 gene_synonym : gf33 pseudo : _no_value

name	Igkv12-89 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:384411 IMGT/GENE-DB:IGKV12-89
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : fl12

name	Igkv1-88 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:692154 IMGT/GENE-DB:IGKV1-88
definition	codon_start : 1 exception : rearrangement required for product

name	Igkv13-87 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:692153 IMGT/GENE-DB:IGKV13-87
definition	codon_start : 1 pseudo : _no_value

name	Gm459 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:243451 IMGT/GENE-DB:IGKV4-86 MGI:2685305
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGKV4-86; kb4

name	Igkv13-85 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:434036 IMGT/GENE-DB:IGKV13-85
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : gn33

name	Igkv13-84 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:692152 IMGT/GENE-DB:IGKV13-84
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : gm33

name	Igkv4-83 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:692145 IMGT/GENE-DB:IGKV4-83
definition	codon_start : 1 gene_synonym : kg4 pseudo : _no_value

name	Igkv13-82 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:692144 IMGT/GENE-DB:IGKV13-82
definition	codon_start : 1 pseudo : _no_value

name	Gm460 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:243453 IMGT/GENE-DB:IGKV4-81 MGI:2685306
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGKV4-81; IgVkag4

name	Igkv13-80-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:692143 IMGT/GENE-DB:IGKV13-80-1
definition	codon_start : 1 pseudo : _no_value

name	Igkv4-80 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:545848 IMGT/GENE-DB:IGKV4-80
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : af4

name	LOC667318 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667318
definition	number : 4 pseudo : _no_value

name	LOC667318 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667318
definition	number : 3 pseudo : _no_value

name	LOC667318 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667318
definition	number : 2 pseudo : _no_value

name	LOC667318 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667318
definition	number : 1 pseudo : _no_value

name	LOC667324 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667324
definition	number : 1 pseudo : _no_value

name	EG667326 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667326
definition	number : 1 pseudo : _no_value

name	LOC672137 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672137
definition	number : 1 pseudo : _no_value

name	Igkv2-137 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:692187
definition	standard_name : IGKV2-137

name	Igkv1-136 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:692186
definition	gene_synonym : bc1 pseudo : _no_value standard_name : IGKV1-136

name	Igkv1-135 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:243420
definition	gene_synonym : bd2 standard_name : IGKV1-135

name	Igkv14-134-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:692185
definition	gene_synonym : cx9 pseudo : _no_value standard_name : IGKV14-134-1

name	Igkv17-134 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:692184
definition	gene_synonym : Igk-Vk20(294A9) pseudo : _no_value standard_name : IGKV17-134

name	EG628027 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:628027
definition	gene_synonym : Igk-Vk2(70/1); Igkv1-133 standard_name : IGKV1-133

name	EG243423 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:243423
definition	gene_synonym : bi2; Igkv1-132 standard_name : IGKV1-132

name	EG628072 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:628072
definition	gene_synonym : cb9; Igkv14-130 standard_name : IGKV14-130

name	Igkv9-129 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:692182
definition	standard_name : IGKV9-129

name	Igkv9-128 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:692181
definition	pseudo : _no_value standard_name : IGKV9-128

name	EG243433 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:243433
definition	gene_synonym : bw20; Igkv17-127 standard_name : IGKV17-127

name	Igkv14-126-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:692180
definition	gene_synonym : co9 pseudo : _no_value standard_name : IGKV14-126-1

name	EG628127 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:628127
definition	gene_synonym : br9; Igkv14-126 pseudo : _no_value standard_name : IGKV14-126

name	ENSMUSG00000050218 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:243428
definition	gene_synonym : if11; Igkv11-125 standard_name : IGKV11-125

name	EG243431 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:243431
definition	gene_synonym : Igkv9-124 standard_name : IGKV9-124

name	EG628144 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:628144
definition	gene_synonym : Igkv9-123 standard_name : IGKV9-123

name	Igkv1-122 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:434024
definition	gene_synonym : bl1 standard_name : IGKV1-122

name	EG667435 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:667435
definition	gene_synonym : bt20; Igkv17-121 standard_name : IGKV17-121

name	EG434025 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:434025
definition	gene_synonym : Igkv9-120 standard_name : IGKV9-120

name	Igkv9-119 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:692177
definition	gene_synonym : bp9 pseudo : _no_value standard_name : IGKV9-119

name	Igkv14-118-2 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:692176
definition	gene_synonym : bq9 pseudo : _no_value standard_name : IGKV14-118-2

name	Igkv14-118-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:692175
definition	pseudo : _no_value standard_name : IGKV14-118-1

name	Igkv11-118 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:692174
definition	gene_synonym : ie11 pseudo : _no_value standard_name : IGKV11-118

name	Igkv1-117 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:16098
definition	gene_synonym : Igk-V21; V(k)45.1 standard_name : IGKV1-117

name	EG434026 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:434026
definition	gene_synonym : IGKhk24; Igkv2-116 pseudo : _no_value standard_name : IGKV2-116

name	EG628206 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:628206
definition	gene_synonym : cz1; Igkv1-115 pseudo : _no_value standard_name : IGKV1-115

name	Igkv11-114 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:692173
definition	gene_synonym : ic11 pseudo : _no_value standard_name : IGKV11-114

name	Igkv2-113 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:692172
definition	gene_synonym : ha24 pseudo : _no_value standard_name : IGKV2-113

name	EG381776 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:381776
definition	gene_synonym : hg24; Igkv2-112 standard_name : IGKV2-112

name	Igkv14-111 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:545847
definition	standard_name : IGKV14-111

name	Igkv1-110 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:381777
definition	gene_synonym : Igk; K5.1 standard_name : IGKV1-110

name	Igkv2-109 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:628268
definition	gene_synonym : he24 standard_name : IGKV2-109

name	Igkv1-108 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:628272
definition	pseudo : _no_value standard_name : IGKV1-108

name	Igkv2-107 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:628283
definition	gene_synonym : hc24 pseudo : _no_value standard_name : IGKV2-107

name	Igkv11-106 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:628293
definition	gene_synonym : ia11 pseudo : _no_value standard_name : IGKV11-106

name	Igkv2-105 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:692170
definition	gene_synonym : hd24 pseudo : _no_value standard_name : IGKV2-105

name	Gm1067 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:381778
definition	gene_synonym : IGKV16-104; rf standard_name : IGKV16-104

name	Igkv15-103 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:692169
definition	standard_name : IGKV15-103

name	Igkv15-102 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:692171
definition	pseudo : _no_value standard_name : IGKV15-102

name	Igkv20-101-2 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:724035
definition	standard_name : IGKV20-101-2

name	Igkv15-101-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:692167
definition	pseudo : _no_value standard_name : IGKV15-101-1

name	Igkv15-101 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:692168
definition	pseudo : _no_value standard_name : IGKV15-101

name	Igkv14-100 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:243439
definition	gene_synonym : cf9 standard_name : IGKV14-100

name	Igkv1-99 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:434028
definition	gene_synonym : cv1 standard_name : IGKV1-99

name	Igkv12-98 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:435900
definition	gene_synonym : ci12 standard_name : IGKV12-98

name	Igkv15-97 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:692166
definition	pseudo : _no_value standard_name : IGKV15-97

name	Igkv10-96 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:692165
definition	standard_name : IGKV10-96

name	Igkv2-95-2 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:692164
definition	gene_synonym : hi24 pseudo : _no_value standard_name : IGKV2-95-2

name	Igkv2-95-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:692163
definition	gene_synonym : hb24 pseudo : _no_value standard_name : IGKV2-95-1

name	EG434031 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:434031
definition	gene_synonym : Igkv10-95; Vk10c standard_name : IGKV10-95

name	EG667550 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:667550
definition	gene_synonym : AJ2; Igkv10-94 standard_name : IGKV10-94

name	Igkv2-93-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:692162
definition	gene_synonym : hh24 pseudo : _no_value standard_name : IGKV2-93-1

name	Igkv19-93 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:692161
definition	standard_name : IGKV19-93

name	Gm1408 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:384410
definition	gene_synonym : Igkay4; IGKV4-92 standard_name : IGKV4-92

name	ENSMUSG00000056850 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:434033
definition	gene_synonym : Igkv4-91; kf4 standard_name : IGKV4-91

name	Igkv4-90 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:434034
definition	gene_synonym : an4 standard_name : IGKV4-90

name	Igkv13-89-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:692155
definition	gene_synonym : gf33 pseudo : _no_value standard_name : IGKV13-89-1

name	Igkv12-89 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:384411
definition	gene_synonym : fl12 standard_name : IGKV12-89

name	Igkv1-88 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:692154
definition	standard_name : IGKV1-88

name	Igkv13-87 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:692153
definition	pseudo : _no_value standard_name : IGKV13-87

name	Gm459 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:243451
definition	allele : IGKV4-86 gene_synonym : IGKV4-86; kb4

name	Igkv13-85 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:434036
definition	gene_synonym : gn33 standard_name : IGKV13-85

name	Igkv13-84 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:692152
definition	gene_synonym : gm33 standard_name : IGKV13-84

name	Igkv4-83 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:692145
definition	gene_synonym : kg4 pseudo : _no_value standard_name : IGKV4-83

name	Igkv13-82 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:692144
definition	pseudo : _no_value standard_name : IGKV13-82

name	Gm460 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:243453
definition	gene_synonym : IGKV4-81; IgVkag4 standard_name : IGKV4-81

name	Igkv13-80-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:692143
definition	pseudo : _no_value standard_name : IGKV13-80-1

name	Igkv4-80 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:545848
definition	gene_synonym : af4 standard_name : IGKV4-80

name	(CDS detail)
type	STS
link
xref	UniSTS:142839
definition	standard_name : Gadd45a

name	(CDS detail)
type	STS
link
xref	UniSTS:125638
definition	standard_name : U00937

name	(CDS detail)
type	STS
link
xref	UniSTS:210543
definition	standard_name : RH136562

name	(CDS detail)
type	STS
link
xref	UniSTS:38389
definition	standard_name : Z72359

name	(CDS detail)
type	STS
link
xref	UniSTS:207972
definition	standard_name : BB208751

name	(CDS detail)
type	STS
link
xref	UniSTS:259146
definition	standard_name : Sod1

name	(CDS detail)
type	STS
link
xref	UniSTS:123299
definition	standard_name : 16.MMHAP26FLF1.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:94913
definition	standard_name : G43269

name	(CDS detail)
type	STS
link
xref	UniSTS:162252
definition	standard_name : RH125430

name	(CDS detail)
type	STS
link
xref	UniSTS:235462
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:163388
definition	standard_name : U64199

name	(CDS detail)
type	STS
link
xref	UniSTS:64232
definition	standard_name : Z72360

name	(CDS detail)
type	STS
link
xref	UniSTS:179387
definition	standard_name : AW493563

name	(CDS detail)
type	STS
link
xref	UniSTS:77145
definition	standard_name : Z72361

name	(CDS detail)
type	STS
link
xref	UniSTS:235463
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:179388
definition	standard_name : C80403

name	(CDS detail)
type	STS
link
xref	UniSTS:487866
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:167489
definition	standard_name : D6Ertd456e

name	(CDS detail)
type	STS
link
xref	UniSTS:56967
definition	standard_name : Z72362

name	(CDS detail)
type	STS
link
xref	UniSTS:13646
definition	standard_name : Z72364

name	(CDS detail)
type	STS
link
xref	UniSTS:41798
definition	standard_name : Z72365

name	(CDS detail)
type	STS
link
xref	UniSTS:44132
definition	standard_name : A004F15

name	(CDS detail)
type	STS
link
xref	UniSTS:12690
definition	standard_name : Z72366

name	(CDS detail)
type	STS
link
xref	UniSTS:19220
definition	standard_name : Z72367

name	(CDS detail)
type	STS
link
xref	UniSTS:124602
definition	standard_name : 46.MHAa56h10.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:46191
definition	standard_name : Z72368

name	(CDS detail)
type	STS
link
xref	UniSTS:143515
definition	standard_name : Igk-V20

name	(CDS detail)
type	STS
link
xref	UniSTS:143527
definition	standard_name : Igk-V9

name	(CDS detail)
type	STS
link
xref	UniSTS:235464
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:489614
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:143508
definition	standard_name : Igk-V1

name	(CDS detail)
type	STS
link
xref	UniSTS:130826
definition	standard_name : D6Mit279

name	(CDS detail)
type	STS
link
xref	UniSTS:131000
definition	standard_name : D6Mit97

name	(CDS detail)
type	STS
link
xref	UniSTS:143519
definition	standard_name : Igk-V24

name	(CDS detail)
type	STS
link
xref	UniSTS:489614
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:143508
definition	standard_name : Igk-V1

name	(CDS detail)
type	STS
link
xref	UniSTS:130076
definition	standard_name : D4Mit285

name	(CDS detail)
type	STS
link
xref	UniSTS:487865
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:143510
definition	standard_name : Igk-V10

name	(CDS detail)
type	STS
link
xref	UniSTS:487865
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:143523
definition	standard_name : Igk-V34

name	LOC100042890 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149255214 GeneID:100042890
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 4 Proteins product : similar to ribosomal protein L30 pseudo : _no_value transcript_id : XR_033999.1

clone name	MSMg01-107L04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-369M15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-413J16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424G18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-328F05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-368I05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-541F01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-361A08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-164O05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-214K04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-362A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-050O02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-164E08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-393N14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-103I03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-340L01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-075E06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-458J19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-354A14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-339D07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449C07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-201C21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-494N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-393F17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-500I15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-490J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-485M13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-361J08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-493I19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-160B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-137N15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-482I09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-341E22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-494F19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-051A09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-548M21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-050D04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-099F10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-147B02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-217L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-299L08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-415L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-216E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-197A06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-379M13
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-050H18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-141H08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-087I04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-470J19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-058I12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-520P20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-534E24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-402C11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-377B21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-417D14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-340B12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-499A10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-126B05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-345N21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-147B02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-299L08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-087I04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-504J20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-186B22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-046M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-341N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-534E24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-482P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-402C11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-136L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-192N15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-112M10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-177B22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-177L20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-261H20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-137L12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-106N02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-346J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-105L04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-099H17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-144I24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-421F12
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-261H20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-099H17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-105L04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-128I20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-341N17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-346J20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-302I01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-353L02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-114I08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-474F05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-338O17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-426O20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330G04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-484A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-422E23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-491H12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347K03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-119A03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-212M16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-330G04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-083L05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-087D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-369P09
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-108K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270C24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-257I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338D20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-338H19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319K16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-271B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080E20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131G03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-324H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152F23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139L17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-098I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-112D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192G10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-202D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-292O23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172K17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-057P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315H17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259O16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064M24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-202O08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-286L17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-286A04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-064M15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-039G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-097E13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-276J09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-199P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-281L16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318F08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-096G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-277I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-079I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331D21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-091D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-272A01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-079O12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189N19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318F08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-332J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039N07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290K22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-152E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-024B09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-282O09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132I02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-343H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-012B20
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-197A06.T7 (MSMg01no197_a06.b1)	MSMg01-197A06.TJ (MSMg01no197_a06.g1)
ACC	AG384911	AG384912
length	732	715
length of high quality (start - end)	643 (45 - 687)	615 (78 - 692)
definition	CHROMAT_FILE: MSMg01no197_a06.b1 PHD_FILE: MSMg01no197_a06.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 20:16:45 2005	CHROMAT_FILE: MSMg01no197_a06.g1 PHD_FILE: MSMg01no197_a06.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 20:16:45 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	TCATXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXCGCGGA ATTCACAACGGAGGTCTATTGAATAGCTAAGAAGCACTTAAAGAAGTGCT CAGAGTCCTTAGTCATCAGGGTATTGGAAATCAGAAGGACCCTGAGATTA CACCTTCCACCAAACAGATTGGCTAAAACTAAAATCTCAGGTTATGGCAC ATGTTGGCAAGAATGTGGAAAAAGAGGATCACTCCTCCATTGCTGGTGGG ATTGCAAACTGATACAAAACTCAGGAAATCAAATCTGGAGGTTTCTCAGA AAATTAGAAATAGATCTACTGCAAGACCCAGCTATAACACTATTGGTCAT ATACCCAAAAGATGCCCCACCTTGTCACAGGGGCACATTTGCCACTATGT TCATGGTGGCCTTATTTGCGGCAGCCAGAAGGTGAAAACAACCCAGATGT TCCATAATAGAAGAATGGATGCAGAAAATGTGGTTCATTTACAGAATGGA ATACTATTCACCTATTAATAATGAGGACATCATGAGTTTTTTAGGCAAAT GGATGGAACTAGAATATATCATCGTGAGTGTGGTAACTCAGACTCAAAAG GACATACATGGCATGCATTCACTAGTAATTGTATATTAGCTAANAATGTA CAGAATGCACAGAATACAATCAATAGAACTCAAGAAAGTTAACATACCAT TGGTCCTAAGCAAGGATGCCTCAATCCTACTT	CGAATGAXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXXXXXAGAGCCCCAAAGAAGGTATAAAG TATATAGCACTAACACTACAGAGCTCGAGAACATCAGTAGAAAGGGAACC CAAGTCAAGAGTGTCTTTCTAGACATCAAAGTGGATTAGCAGTCAAGTAT CAGAACCAATAGCAACACCCAGGAAAGACAATTGTGGGCAATTGTGCTTC AGAAATAGGAAGATGTAGATCTACTCCAGATCCATCTGCAAAGCACAAGT GCAGCAGTCACTGTGGCTTCCCACCATGCCCCTTTGCATCTCCTTGAATA GTCACGTACCTGTGACACCTAGGACTAAATCTTATTCTTCTCACCAAAGT AATACAAAATGTATCAAAATTCTAAGCATACAGTGGAATCTTTTGAATTT CCCAGAGGAAAAATTTCCATTTGGGTATATTCATGAAAGTTACATGAGGT GAGTTTACAGCTCCATAGAAGAAACAACATCTTTCCATCTTCTGGCTATT ATAAATAATACTGCTATAAACATAGTGAAACATGTGTCCTTCTTACATGT TAGAGCATCTTCTGGGTATATGCCCAGGAGTGGTATAGCTGGGACCTCAG GTCACAGTGTGGATACTTCTGTCCTTCTTAGAAGGGAGATCAAAATAACC ATGGGAGGAGATGCC
quality values	Open. Hide. 7 10 6 6 6 6 8 14 27 25 33 32 32 28 28 37 23 23 22 20 20 30 37 46 35 30 30 30 30 36 44 43 23 14 9 9 9 19 23 24 26 12 16 16 29 30 57 57 36 36 36 36 50 36 47 41 41 37 30 26 22 17 12 12 10 10 10 18 23 37 37 37 37 44 44 53 50 57 59 59 59 59 57 57 57 53 53 53 57 57 57 59 59 44 48 39 39 42 48 43 48 48 41 41 47 59 59 68 68 68 68 68 68 68 68 68 68 68 44 34 22 12 12 22 22 15 32 32 48 50 50 50 50 68 68 68 68 68 68 48 57 47 42 42 36 36 41 50 50 50 57 68 68 68 68 68 68 68 68 57 57 59 59 68 68 68 57 57 43 43 35 50 59 59 59 59 59 59 59 68 68 68 68 68 57 57 57 59 54 57 57 57 57 57 57 57 57 57 57 59 43 57 52 43 43 45 57 57 59 59 57 57 52 52 43 57 43 57 57 68 59 59 59 59 59 57 57 57 57 57 57 68 68 68 68 68 68 57 62 52 62 52 62 62 52 52 52 52 62 62 62 62 62 62 62 62 62 62 43 52 62 62 62 62 68 68 68 68 68 68 62 62 52 52 52 62 62 68 68 68 68 68 62 62 62 62 52 62 62 62 68 68 68 68 68 59 59 57 57 57 57 57 68 57 57 57 59 57 57 57 68 68 68 68 68 68 57 59 57 43 43 47 43 52 52 57 57 57 57 59 68 68 68 68 68 68 68 68 68 68 59 59 57 57 52 59 59 68 68 68 68 68 68 68 68 68 68 59 59 52 43 43 43 27 23 23 32 41 29 41 43 43 43 35 43 43 50 43 43 43 43 43 44 48 57 57 57 57 59 59 54 54 54 54 54 54 57 57 48 48 44 46 44 42 42 42 42 48 48 57 57 68 57 48 44 27 18 10 8 8 8 16 28 37 46 46 57 59 59 47 43 43 43 43 59 57 57 54 48 48 48 48 48 57 47 47 43 43 43 43 43 50 50 50 50 50 48 48 48 50 50 47 30 30 25 25 19 22 35 39 39 39 37 41 41 37 37 37 37 39 39 39 43 44 48 57 50 53 50 48 41 40 40 34 34 28 28 20 31 34 41 44 47 47 59 59 48 48 48 41 41 41 59 44 44 44 37 37 44 39 39 41 42 42 46 59 48 48 48 59 47 46 41 41 41 41 37 37 44 39 39 41 42 42 47 47 41 41 39 39 31 31 32 37 37 39 43 40 37 37 37 37 39 39 39 48 48 48 48 47 42 40 40 43 43 43 59 39 43 36 32 32 30 30 32 37 39 39 37 30 35 35 41 39 41 41 41 41 41 37 37 41 41 41 39 34 28 23 20 22 19 28 34 34 32 30 30 32 27 21 13 11 18 21 25 37 48 30 30 28 25 25 34 34 39 28 28 14 14 14 23 23 3 0 3 23 23 28 23 23 24 31 37 37 37 37 37 33 33 30 32 32 31 31 27 21 14 14 14 21 25 30 28 33 18 21 13 21 18 28 27 30 27 25 22 24 19 25 25 25 20 12 13 9 9 9 9 10 27 20 18 18 15 19 15 23 34 29 24 28 19 18 17 18 18 24 19 14 11 11 13 8 8 8 8 16 14 31 30 37 35 28	Open. Hide. 8 8 8 8 12 12 8 8 8 8 19 23 33 33 33 39 47 47 57 53 53 57 57 57 57 57 57 48 57 48 48 44 43 36 36 43 43 43 46 42 34 41 41 48 42 68 68 68 68 54 50 50 50 50 50 51 68 68 68 48 44 36 20 25 36 36 36 48 59 57 57 50 50 50 50 50 50 50 50 50 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 59 59 59 59 59 57 57 53 53 53 53 53 53 53 53 47 37 37 32 30 22 22 17 17 10 8 8 8 13 12 20 37 41 37 39 44 44 47 47 50 59 59 59 59 59 59 59 57 57 57 57 57 57 48 48 48 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 51 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 62 62 62 68 68 68 62 62 62 62 62 62 62 68 68 68 68 68 68 68 68 68 62 62 62 62 62 68 68 68 68 68 62 62 62 62 43 43 33 33 39 39 43 44 62 62 62 62 62 62 62 62 62 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 68 62 44 43 35 43 43 52 62 62 62 62 62 62 68 62 68 62 62 52 52 52 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 57 57 57 57 57 68 68 68 68 68 68 68 57 57 59 57 57 59 59 59 59 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 57 57 59 57 59 59 52 52 52 59 57 57 57 57 54 54 57 57 57 57 57 57 57 57 59 59 59 59 59 57 57 57 57 57 57 68 68 68 68 68 57 57 54 54 54 59 59 59 59 57 57 54 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 59 59 59 59 43 44 43 44 44 57 57 57 57 59 59 68 68 59 57 54 54 54 57 54 54 54 54 54 59 59 59 59 59 59 48 48 48 48 48 48 48 48 48 48 59 59 59 57 57 57 57 50 48 48 59 47 36 36 39 39 39 41 37 31 39 37 32 24 17 15 14 14 16 32 36 37 39 41 41 47 37 37 28 28 34 34 39 37 36 31 28 35 33 34 34 34 28 25 25 25 23 25 32 37 37 37 46 59 37 37 30 30 30 37 37 39 39 31 27 26 17 17 19 20 22 24 28 33 28 28 22 22 17 22 19 15 11 11 12 14 16 20 22 20 25 25 28 28 23 23 18 22 15 9 9

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no197_a06.g1 MSMg01no197_a06.g1 CHROMAT_FILE:
MSMg01no197_a06.g1 PHD_FILE: MSMg01no197_a06.g1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 20:16:45 2005
         (615 letters)



>mm_chr6_67971292_67972305
          Length = 1014

 Score = 1127 bits (583), Expect = 0.0
 Identities = 607/615 (98%), Gaps = 1/615 (0%)
 Strand = Plus / Minus

                                                                       
Query: 1   agagccccaaagaaggtataaagtatatagcactaacactacagagctcgagaacatcag 60
           |||||||||||||||||||||||| ||||||||||||||||||||| | |||||||||||
Sbjct: 651 agagccccaaagaaggtataaagtttatagcactaacactacagagat-gagaacatcag 593

                                                                       
Query: 61  tagaaagggaacccaagtcaagagtgtctttctagacatcaaagtggattagcagtcaag 120
           ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 592 tagaaagggaatccaagtcaagagtgtctttctagacatcaaagtggattagcagtcaag 533

                                                                       
Query: 121 tatcagaaccaatagcaacacccaggaaagacaattgtgggcaattgtgcttcagaaata 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 532 tatcagaaccaatagcaacacccaggaaagacaattgtgggcaattgtgcttcagaaata 473

                                                                       
Query: 181 ggaagatgtagatctactccagatccatctgcaaagcacaagtgcagcagtcactgtggc 240
           |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 472 ggaagatgtagatctactccagatccatctgcaaagcacaagtgcaacagtcactgtggc 413

                                                                       
Query: 241 ttcccaccatgcccctttgcatctccttgaatagtcacgtacctgtgacacctaggacta 300
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 412 ttcccaccatgcccctttgcatctccttgaatagtcacgtacctgtgacacctaggacta 353

                                                                       
Query: 301 aatcttattcttctcaccaaagtaatacaaaatgtatcaaaattctaagcatacagtgga 360
           ||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||
Sbjct: 352 aatcttattcttctcaccaaagtaacacaaaatgtatcaaaattctaagcatagagtgga 293

                                                                       
Query: 361 atcttttgaatttcccagaggaaaaatttccatttgggtatattcatgaaagttacatga 420
           ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 292 atcttttgaatttcccagaggaaaaatttccatttgggtatatccatgaaagttacatga 233

                                                                       
Query: 421 ggtgagtttacagctccatagaagaaacaacatctttccatcttctggctattataaata 480
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 232 ggtgagtttacagctccatagaagaaacaacatctttccatcttctggctattataaata 173

                                                                       
Query: 481 atactgctataaacatagtgaaacatgtgtccttcttacatgttagagcatcttctgggt 540
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 172 atactgctataaacatagtgaaacatgtgtccttcttacatgttagagcatcttctgggt 113

                                                                       
Query: 541 atatgcccaggagtggtatagctgggacctcaggtcacagtgtggatacttctgtccttc 600
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 112 atatgcccaggagtggtatagctgggacctcaggtcacagtgtggatacttctgtccttc 53

                          
Query: 601 ttagaagggagatca 615
           |||||||||||||||
Sbjct: 52  ttagaagggagatca 38


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 28
Number of extensions: 2
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 615
Length of database: 1014
Length adjustment: 10
Effective length of query: 605
Effective length of database: 1004
Effective search space:   607420
Effective search space used:   607420
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information