MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-267C03
Chromosome	6 (Build37)
Map Location	71,803,499 - 71,803,648
singlet/doublet	singlet
Overlap gene	Immt
Upstream gene	Eif2ak3, 1700011F03Rik, LOC232077, LOC619547, Thnsl2, Fabp1, Smyd1, Krcc1, Gm1070, Cd8b1, LOC100042853, Cd8a, Rmnd5a, LOC100042863, Rnf103, Vps24, Jmjd1a, Ppia-ps6_731.1, LOC668029, LOC668034, Reep1, Mrpl35
Downstream gene	Ptcd3, Rpo1-4, LOC668057, St3gal5, Atoh8, Sftpb, Usp39, 0610030E20Rik, Tmem150, 2500002L14Rik, Vamp5, Vamp8, Ggcx, Mat2a, Sh2d6, Capg, Rbed1, Retsat, Tgoln1, LOC100038890, Tcf3, Kcmf1
Link	Open Mouse BAC browser

Click to get alignment info.

name	Eif2ak3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13666 MGI:1341830
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700011F03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74221 MGI:1921471
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC232077 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:232077
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 53 Proteins

name	LOC619547 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:619547
definition	note : ribosomal protein L34 pseudogene pseudo : _no_value

name	Thnsl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232078 MGI:3041254
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Fabp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14080 MGI:95479
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Smyd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12180 MGI:104790
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krcc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57896 MGI:1889377
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm1070 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381785 MGI:2685916
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd8b1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12526 MGI:88347
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042853 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042853
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins pseudo : _no_value

name	Cd8a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12525 MGI:88346
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rmnd5a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68477 MGI:1915727
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042863 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042863
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	Rnf103 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22644 MGI:109483
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vps24 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66700 MGI:1913950
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Jmjd1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104263 MGI:98847
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Ppia-ps6_731.1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:606532
definition	note : peptidylprolyl isomerase A pseudogene 6_731.1 pseudo : _no_value

name	LOC668029 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668029
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	LOC668034 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668034
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 7 Proteins pseudo : _no_value

name	Reep1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52250 MGI:1098827
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrpl35 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66223 MGI:1913473
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Immt (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76614 MGI:1923864
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ptcd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69956 MGI:1917206
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpo1-4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20019 MGI:1096397
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668057 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668057
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	St3gal5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20454 MGI:1339963
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Atoh8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71093 MGI:1918343
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sftpb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20388 MGI:109516
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Usp39 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:28035 MGI:107622
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	0610030E20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68364 MGI:1915614
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 73 ESTs, 2 Proteins

name	Tmem150 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232086 MGI:2385244
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2500002L14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66510 MGI:1913760
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vamp5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53620 MGI:1858622
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Vamp8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22320 MGI:1336882
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ggcx (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56316 MGI:1927655
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mat2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232087 MGI:2443731
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sh2d6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71130 MGI:1918380
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 2 Proteins

name	Capg (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12332 MGI:1098259
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Rbed1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232089 MGI:2445168
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Retsat (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67442 MGI:1914692
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tgoln1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22134 MGI:105080
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100038890 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038890
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tcf3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21415 MGI:1202876
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Kcmf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74287 MGI:1921537
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eif2ak3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124001563 GeneID:13666 MGI:1341830
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 2 alpha kinase 3 transcript_id : NM_010121.2

name	1700011F03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802938 GeneID:74221 MGI:1921471
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700011F03 gene transcript_id : NM_028825.2

name	LOC232077 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255209 GeneID:232077
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 53 Proteins product : similar to hCG33270 transcript_id : XM_144880.5

name	Thnsl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76677924 GeneID:232078 MGI:3041254
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : threonine synthase-like 2 (bacterial) transcript_id : NM_001033929.1

name	Thnsl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76677921 GeneID:232078 MGI:3041254
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : threonine synthase-like 2 (bacterial) transcript_id : NM_178413.4

name	Fabp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802687 GeneID:14080 MGI:95479
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fatty acid binding protein 1, liver transcript_id : NM_017399.2

name	Smyd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10257424 GeneID:12180 MGI:104790
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SET and MYND domain containing 1 transcript_id : NM_009762.1

name	Krcc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47271541 GeneID:57896 MGI:1889377
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lysine-rich coiled-coil 1 transcript_id : NM_145568.3

name	Gm1070 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142360133 GeneID:381785 MGI:2685916
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 1070, (NCBI) transcript_id : NM_001033462.2

name	Cd8b1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129874 GeneID:12526 MGI:88347
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD8 antigen, beta chain 1 transcript_id : NM_009858.2

name	Cd8a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126722839 GeneID:12525 MGI:88346
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD8 antigen, alpha chain transcript_id : NM_001081110.2

name	Rmnd5a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31044428 GeneID:68477 MGI:1915727
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : required for meiotic nuclear division 5 homolog A (S. cerevisiae) transcript_id : NM_024288.1

name	LOC100042863 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255212 GeneID:100042863
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : similar to retinitis pigmentosa GTPase regulator interacting protein 1 transcript_id : XM_001478945.1

name	Rnf103 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678630 GeneID:22644 MGI:109483
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger protein 103 transcript_id : NM_009543.1

name	Vps24 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368166 GeneID:66700 MGI:1913950
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vacuolar protein sorting 24 (yeast) transcript_id : NM_025783.3

name	Jmjd1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84662716 GeneID:104263 MGI:98847
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : jumonji domain containing 1A transcript_id : NM_173001.1

name	Jmjd1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84662720 GeneID:104263 MGI:98847
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : jumonji domain containing 1A transcript_id : NM_001038695.1

name	Reep1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802230 GeneID:52250 MGI:1098827
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : receptor accessory protein 1 transcript_id : NM_178608.3

name	Mrpl35 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372564 GeneID:66223 MGI:1913473
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein L35 transcript_id : NM_025430.2

name	Immt (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70608130 GeneID:76614 MGI:1923864
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : inner membrane protein, mitochondrial transcript_id : NM_029673.2

name	Ptcd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:91982770 GeneID:69956 MGI:1917206
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Pentatricopeptide repeat domain 3 transcript_id : NM_027275.3

name	Rpo1-4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328145 GeneID:20019 MGI:1096397
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA polymerase 1-4 transcript_id : NM_009088.2

name	St3gal5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:78126168 GeneID:20454 MGI:1339963
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ST3 beta-galactoside alpha-2,3-sialyltransferase 5 transcript_id : NM_011375.2

name	St3gal5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:78126156 GeneID:20454 MGI:1339963
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ST3 beta-galactoside alpha-2,3-sialyltransferase 5 transcript_id : NM_001035228.1

name	Atoh8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130066 GeneID:71093 MGI:1918343
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : atonal homolog 8 (Drosophila) transcript_id : NM_153778.3

name	Sftpb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22296600 GeneID:20388 MGI:109516
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : surfactant associated protein B transcript_id : NM_147779.1

name	Usp39 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378515 GeneID:28035 MGI:107622
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin specific peptidase 39 transcript_id : NM_138592.2

name	0610030E20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94377469 GeneID:68364 MGI:1915614
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 73 ESTs, 2 Proteins product : RIKEN cDNA 0610030E20 gene, transcript variant 1 transcript_id : XM_132614.6

name	Tmem150 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802658 GeneID:232086 MGI:2385244
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 150 transcript_id : NM_144916.2

name	2500002L14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47059205 GeneID:66510 MGI:1913760
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2500002L14 gene transcript_id : NM_025607.3

name	Vamp5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124001561 GeneID:53620 MGI:1858622
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vesicle-associated membrane protein 5 transcript_id : NM_001080742.1

name	Vamp5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124001552 GeneID:53620 MGI:1858622
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vesicle-associated membrane protein 5 transcript_id : NM_016872.3

name	Vamp8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980628 GeneID:22320 MGI:1336882
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vesicle-associated membrane protein 8 transcript_id : NM_016794.2

name	Ggcx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374008 GeneID:56316 MGI:1927655
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gamma-glutamyl carboxylase transcript_id : NM_019802.2

name	Mat2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802196 GeneID:232087 MGI:2443731
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : methionine adenosyltransferase II, alpha transcript_id : NM_145569.3

name	Sh2d6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94377474 GeneID:71130 MGI:1918380
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 2 Proteins product : SH2 domain containing 6, transcript variant 1 transcript_id : XM_355785.4

name	Capg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354781 GeneID:12332 MGI:1098259
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : capping protein (actin filament), gelsolin-like transcript_id : NM_007599.3

name	Capg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802783 GeneID:12332 MGI:1098259
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : capping protein (actin filament), gelsolin-like transcript_id : NM_001042534.2

name	Rbed1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386721 GeneID:232089 MGI:2445168
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA binding motif and ELMO domain 1 transcript_id : NM_144917.3

name	Retsat (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87044905 GeneID:67442 MGI:1914692
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : retinol saturase (all trans retinol 13,14 reductase) transcript_id : NM_026159.4

name	Tgoln1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87044904 GeneID:22134 MGI:105080
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : trans-golgi network protein transcript_id : NM_009443.3

name	LOC100038890 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255101 GeneID:100038890
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100038890 transcript_id : XM_001471628.1

name	Tcf3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87044902 GeneID:21415 MGI:1202876
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transcription factor 3 transcript_id : NM_009332.2

name	Tcf3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119703757 GeneID:21415 MGI:1202876
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transcription factor 3 transcript_id : NM_001079822.1

name	Kcmf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126517504 GeneID:74287 MGI:1921537
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium channel modulatory factor 1 transcript_id : NM_019715.2

name	Eif2ak3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124001564 CCDS:CCDS20223.1 GeneID:13666 MGI:1341830
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005783 - endoplasmic reticulum [Evidence IEA] [Evidence IDA]; GO:0005789 - endoplasmic reticulum membrane [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IDA] [Evidence IEA] [Evidence IMP]; GO:0004674 - protein serine/threonine kinase activity [Evidence IDA] [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0008632 - apoptotic program [Evidence IMP]; GO:0030282 - bone mineralization [Evidence IMP]; GO:0019722 - calcium-mediated signaling [Evidence IMP]; GO:0006919 - caspase activation [Evidence IMP]; GO:0002063 - chondrocyte development [Evidence IMP]; GO:0006118 - electron transport [Evidence IEA]; GO:0007029 - endoplasmic reticulum organization and biogenesis [Evidence IMP]; GO:0030073 - insulin secretion [Evidence IMP]; GO:0048009 - insulin-like growth factor receptor signaling pathway [Evidence IMP]; GO:0031642 - negative regulation of myelination [Evidence IMP]; GO:0016478 - negative regulation of translation [Evidence IGI] [Evidence IDA] [Evidence IMP]; GO:0031016 - pancreas development [Evidence IMP]; GO:0032092 - positive regulation of protein binding [Evidence IMP]; GO:0046777 - protein amino acid autophosphorylation [Evidence IMP] [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IMP] [Evidence IEA] [Evidence IDA]; GO:0006412 - protein biosynthesis [Evidence IDA]; GO:0006417 - regulation of protein biosynthesis [Evidence IEA]; GO:0006445 - regulation of translation [Evidence IEA]; GO:0006986 - response to unfolded protein [Evidence IEA]; GO:0001501 - skeletal development [Evidence IMP]; GO:0030968 - unfolded protein response [Evidence IMP] [Evidence IDA]; GO:0006926 - virus-infected cell apoptosis [Evidence IMP] codon_start : 1 product : eukaryotic translation initiation factor 2 alpha kinase 3 protein_id : NP_034251.2

name	1700011F03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037359 CCDS:CCDS20224.1 GeneID:74221 MGI:1921471
definition	codon_start : 1 product : hypothetical protein LOC74221 protein_id : NP_083101.1

name	LOC232077 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:83029183 GeneID:232077
definition	codon_start : 1 product : similar to hCG33270 protein_id : XP_144880.3

name	Thnsl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:76677925 CCDS:CCDS20225.1 GeneID:232078 MGI:3041254
definition	GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0004795 - threonine synthase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA]; GO:0009088 - threonine biosynthesis [Evidence IEA] codon_start : 1 product : threonine synthase-like 2 protein_id : NP_001029101.1

name	Thnsl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:76677922 CCDS:CCDS20225.1 GeneID:232078 MGI:3041254
definition	GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0004795 - threonine synthase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA]; GO:0009088 - threonine biosynthesis [Evidence IEA] codon_start : 1 product : threonine synthase-like 2 protein_id : NP_848500.3

name	Fabp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8393343 CCDS:CCDS20226.1 GeneID:14080 MGI:95479
definition	GO_function : GO:0005488 - binding [Evidence IEA]; GO:0003682 - chromatin binding [Evidence IDA]; GO:0005504 - fatty acid binding [Evidence ISS]; GO:0008289 - lipid binding [Evidence IEA]; GO:0008430 - selenium binding [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : fatty acid binding protein liver product : fatty acid binding protein 1, liver protein_id : NP_059095.1

name	Smyd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10257425 CCDS:CCDS20227.1 GeneID:12180 MGI:104790
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA]; GO:0016469 - proton-transporting two-sector ATPase complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046933 - hydrogen-transporting ATP synthase activity, rotational mechanism [Evidence IEA]; GO:0046961 - hydrogen-transporting ATPase activity, rotational mechanism [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003714 - transcription corepressor activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0015986 - ATP synthesis coupled proton transport [Evidence IEA]; GO:0006338 - chromatin remodeling [Evidence IPI]; GO:0007507 - heart development [Evidence IMP]; GO:0016481 - negative regulation of transcription [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : CD8beta opposite strand product : SET and MYND domain containing 1 protein_id : NP_033892.1

name	Krcc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704142 CCDS:CCDS20228.1 GeneID:57896 MGI:1889377
definition	codon_start : 1 product : lysine-rich coiled-coil 1 protein_id : NP_663543.1

name	Gm1070 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701979 GeneID:381785 MGI:2685916
definition	codon_start : 1 product : hypothetical protein LOC381785 protein_id : NP_001028634.1

name	Cd8b1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753358 GeneID:12526 MGI:88347
definition	GO_component : GO:0009986 - cell surface [Evidence IDA]; GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0042101 - T cell receptor complex [Evidence ISS] GO_function : GO:0015026 - coreceptor activity [Evidence ISS]; GO:0042288 - MHC class I protein binding [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS] [Evidence IPI] GO_process : GO:0006955 - immune response [Evidence IEA] [Evidence ISS]; GO:0042110 - T cell activation [Evidence ISS]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence ISS] codon_start : 1 product : CD8 antigen, beta chain 1 protein_id : NP_033988.1

name	Cd8a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487437 GeneID:12525 MGI:88346
definition	GO_component : GO:0009986 - cell surface [Evidence IDA]; GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0042101 - T cell receptor complex [Evidence ISS] GO_function : GO:0015026 - coreceptor activity [Evidence ISS]; GO:0042288 - MHC class I protein binding [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0007166 - cell surface receptor linked signal transduction [Evidence IDA]; GO:0006968 - cellular defense response [Evidence IMP]; GO:0045065 - cytotoxic T cell differentiation [Evidence IMP]; GO:0006955 - immune response [Evidence ISS] [Evidence IEA]; GO:0050850 - positive regulation of calcium-mediated signaling [Evidence IDA]; GO:0042110 - T cell activation [Evidence ISS]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence ISS] codon_start : 1 note : Lyt-2.1 lymphocyte differentiation antigen (AA at 100) product : CD8 antigen, alpha chain protein_id : NP_001074579.1

name	Rmnd5a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31044429 CCDS:CCDS20231.1 GeneID:68477 MGI:1915727
definition	codon_start : 1 exception : mismatches in translation product : required for meiotic nuclear division 5 homolog A protein_id : NP_077250.1

name	LOC100042863 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255213 GeneID:100042863
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478995.1

name	Rnf103 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678631 GeneID:22644 MGI:109483
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : zinc finger protein 103 product : ring finger protein 103 protein_id : NP_033569.1

name	Vps24 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31541959 CCDS:CCDS20232.1 GeneID:66700 MGI:1913950
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : neuroendocrine differentiation factor protein_id : NP_080059.2

name	Jmjd1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84662717 CCDS:CCDS20233.1 GeneID:104263 MGI:98847
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016702 - oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; testis specific gene A product : jumonji domain containing 1A isoform 1 protein_id : NP_766589.1

name	Jmjd1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84662721 GeneID:104263 MGI:98847
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016702 - oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform 2 is encoded by transcript variant 2; testis specific gene A product : jumonji domain containing 1A isoform 2 protein_id : NP_001033784.1

name	Reep1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30519931 GeneID:52250 MGI:1098827
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : receptor expression enhancing protein 1 protein_id : NP_848723.1

name	Mrpl35 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384830 CCDS:CCDS20234.1 GeneID:66223 MGI:1913473
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 product : mitochondrial ribosomal protein L35 protein_id : NP_079706.1

name	Immt (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70608131 GeneID:76614 MGI:1923864
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence ISS]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : inner membrane protein, mitochondrial protein_id : NP_083949.2

name	Ptcd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33469980 CCDS:CCDS20235.1 GeneID:69956 MGI:1917206
definition	codon_start : 1 product : Pentatricopeptide repeat domain 3 protein_id : NP_081551.2

name	Rpo1-4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328146 CCDS:CCDS20236.1 GeneID:20019 MGI:1096397
definition	GO_component : GO:0005736 - DNA-directed RNA polymerase I complex [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003899 - DNA-directed RNA polymerase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : RNA polymerase 1-4 (194 kDa subunit) product : RNA polymerase 1-4 protein_id : NP_033114.2

name	St3gal5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:78126157 CCDS:CCDS20237.1 GeneID:20454 MGI:1339963
definition	EC_number : 2.4.99.9 GO_component : GO:0000139 - Golgi membrane [Evidence ISS]; GO:0030173 - integral to Golgi membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0047291 - lactosylceramide alpha-2,3-sialyltransferase activity [Evidence IEA] [Evidence ISS]; GO:0008373 - sialyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0001574 - ganglioside biosynthesis [Evidence ISS]; GO:0006486 - protein amino acid glycosylation [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; ST3Gal V; mST3Gal V; GM3 synthase; GM3-specific sialytransferase; sialyltransferase 9 (CMP-NeuAc:lactosylceramide alpha-2,3-sialyltransferase) product : ST3 beta-galactoside alpha-2,3-sialyltransferase 5 isoform a protein_id : NP_001030305.1

name	St3gal5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:78126169 GeneID:20454 MGI:1339963
definition	EC_number : 2.4.99.9 GO_component : GO:0000139 - Golgi membrane [Evidence ISS]; GO:0030173 - integral to Golgi membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0047291 - lactosylceramide alpha-2,3-sialyltransferase activity [Evidence IEA] [Evidence ISS]; GO:0008373 - sialyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0001574 - ganglioside biosynthesis [Evidence ISS]; GO:0006486 - protein amino acid glycosylation [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; ST3Gal V; mST3Gal V; GM3 synthase; GM3-specific sialytransferase; sialyltransferase 9 (CMP-NeuAc:lactosylceramide alpha-2,3-sialyltransferase) product : ST3 beta-galactoside alpha-2,3-sialyltransferase 5 isoform b protein_id : NP_035505.2

name	Atoh8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24418872 GeneID:71093 MGI:1918343
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA] codon_start : 1 note : basic helix-loop-helix transcription factor 6 product : okadin protein_id : NP_722473.1

name	Sftpb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22296601 GeneID:20388 MGI:109516
definition	GO_component : GO:0005764 - lysosome [Evidence IEA] GO_process : GO:0006629 - lipid metabolism [Evidence IEA]; GO:0050828 - regulation of liquid surface tension [Evidence IEA]; GO:0007585 - respiratory gaseous exchange [Evidence IEA]; GO:0006665 - sphingolipid metabolism [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : surfactant associated protein B protein_id : NP_680088.1

name	Usp39 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20070404 CCDS:CCDS20238.1 GeneID:28035 MGI:107622
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 note : SnRNP assembly defective 1 homolog product : ubiquitin specific protease 39 protein_id : NP_613058.1

name	0610030E20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38084531 GeneID:68364 MGI:1915614
definition	codon_start : 1 product : hypothetical protein LOC68364 isoform 1 protein_id : XP_132614.2

name	Tmem150 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450311 CCDS:CCDS20239.1 GeneID:232086 MGI:2385244
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS] [Evidence IEA] codon_start : 1 note : fasting-inducible integral membrane protein TM6P1 product : transmembrane protein 150 protein_id : NP_659165.1

name	2500002L14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47059206 CCDS:CCDS20240.1 GeneID:66510 MGI:1913760
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC66510 protein_id : NP_079883.3

name	Vamp5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124001562 GeneID:53620 MGI:1858622
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007519 - striated muscle development [Evidence IDA]; GO:0016192 - vesicle-mediated transport [Evidence IEA] codon_start : 1 product : vesicle-associated membrane protein 5 protein_id : NP_001074211.1

name	Vamp5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8394526 GeneID:53620 MGI:1858622
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007519 - striated muscle development [Evidence IDA]; GO:0016192 - vesicle-mediated transport [Evidence IEA] codon_start : 1 product : vesicle-associated membrane protein 5 protein_id : NP_058568.1

name	Vamp8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980629 GeneID:22320 MGI:1336882
definition	GO_component : GO:0005769 - early endosome [Evidence TAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0016192 - vesicle-mediated transport [Evidence IEA] codon_start : 1 product : vesicle-associated membrane protein 8 protein_id : NP_058074.2

name	Ggcx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790009 CCDS:CCDS20242.1 GeneID:56316 MGI:1927655
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008488 - gamma-glutamyl carboxylase activity [Evidence IEA] [Evidence ISS]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0017187 - peptidyl-glutamic acid carboxylation [Evidence IEA] codon_start : 1 note : gamma-carboxylase; vitamin K-dependent carboxylase product : gamma-glutamyl carboxylase protein_id : NP_062776.1

name	Mat2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704144 GeneID:232087 MGI:2443731
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004478 - methionine adenosyltransferase activity [Evidence IDA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA] GO_process : GO:0006730 - one-carbon compound metabolism [Evidence IEA]; GO:0006556 - S-adenosylmethionine biosynthesis [Evidence IDA] codon_start : 1 product : methionine adenosyltransferase II, alpha protein_id : NP_663544.1

name	Sh2d6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83029226 GeneID:71130 MGI:1918380
definition	codon_start : 1 product : SH2 domain containing 6 isoform 1 protein_id : XP_355785.3

name	Capg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110227377 GeneID:12332 MGI:1098259
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA] GO_process : GO:0051016 - barbed-end actin filament capping [Evidence IEA]; GO:0030031 - cell projection biogenesis [Evidence IDA] codon_start : 1 product : gelsolin-like capping protein protein_id : NP_001035999.1

name	Capg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110227379 GeneID:12332 MGI:1098259
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA] GO_process : GO:0051016 - barbed-end actin filament capping [Evidence IEA]; GO:0030031 - cell projection biogenesis [Evidence IDA] codon_start : 1 product : gelsolin-like capping protein protein_id : NP_031625.2

name	Rbed1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450313 CCDS:CCDS20243.1 GeneID:232089 MGI:2445168
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA] GO_process : GO:0006909 - phagocytosis [Evidence IEA] codon_start : 1 product : RNA binding motif and ELMO domain 1 protein_id : NP_659166.1

name	Retsat (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:52627143 CCDS:CCDS20244.1 GeneID:67442 MGI:1914692
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005789 - endoplasmic reticulum membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005640 - nuclear outer membrane [Evidence IDA] GO_function : GO:0051786 - all-trans-retinol 13,14-reductase activity [Evidence IEA] [Evidence IDA]; GO:0050660 - FAD binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016705 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen [Evidence IEA] GO_process : GO:0016117 - carotenoid biosynthesis [Evidence IEA]; GO:0006118 - electron transport [Evidence IDA] [Evidence IEA]; GO:0042572 - retinol metabolism [Evidence IDA] codon_start : 1 product : all-trans-13,14-dihydroretinol saturase protein_id : NP_080435.3

name	LOC100038890 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255102 GeneID:100038890
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001471678.1

name	Tgoln1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678459 GeneID:22134 MGI:105080
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : trans-golgi network protein 1 product : trans-golgi network protein protein_id : NP_033469.1

name	Tcf3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:87044903 CCDS:CCDS20245.1 GeneID:21415 MGI:1202876
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0048319 - axial mesoderm morphogenesis [Evidence IMP]; GO:0008595 - determination of anterior/posterior axis, embryo [Evidence IMP]; GO:0046022 - positive regulation of transcription from RNA polymerase II promoter, mitotic [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; transcription factor 7-like 1 product : transcription factor 3 isoform 2 protein_id : NP_033358.2

name	Tcf3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119703758 GeneID:21415 MGI:1202876
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0048319 - axial mesoderm morphogenesis [Evidence IMP]; GO:0008595 - determination of anterior/posterior axis, embryo [Evidence IMP]; GO:0046022 - positive regulation of transcription from RNA polymerase II promoter, mitotic [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; transcription factor 7-like 1 product : transcription factor 3 isoform 1 protein_id : NP_001073290.1

name	Kcmf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126517505 GeneID:74287 MGI:1921537
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0004842 - ubiquitin-protein ligase activity [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016567 - protein ubiquitination [Evidence ISS] codon_start : 1 note : clone DEBT-91 product : potassium channel modulatory factor DEBT-91 protein_id : NP_062689.2

name	LOC100042853 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042853
definition	number : 1 pseudo : _no_value

name	LOC100042853 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042853
definition	number : 2 pseudo : _no_value

name	LOC100042853 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042853
definition	number : 3 pseudo : _no_value

name	LOC668029 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668029
definition	number : 2 pseudo : _no_value

name	LOC668029 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668029
definition	number : 1 pseudo : _no_value

name	LOC668057 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668057
definition	number : 1 pseudo : _no_value

name	(CDS detail)
type	STS
link
xref	UniSTS:272318
definition	standard_name : PMC262586P2

name	(CDS detail)
type	STS
link
xref	UniSTS:86985
definition	standard_name : RH91182

name	(CDS detail)
type	STS
link
xref	UniSTS:159520
definition	standard_name : AI427929

name	(CDS detail)
type	STS
link
xref	UniSTS:471074
definition	standard_name : Foxi3

name	(CDS detail)
type	STS
link
xref	UniSTS:207975
definition	standard_name : RH126677

name	(CDS detail)
type	STS
link
xref	UniSTS:130714
definition	standard_name : D6Mit17

name	(CDS detail)
type	STS
link
xref	UniSTS:21714
definition	standard_name : D7S2425

name	(CDS detail)
type	STS
link
xref	UniSTS:130793
definition	standard_name : D6Mit244

name	(CDS detail)
type	STS
link
xref	UniSTS:159519
definition	standard_name : C78565

name	(CDS detail)
type	STS
link
xref	UniSTS:163389
definition	standard_name : AA792894

name	(CDS detail)
type	STS
link
xref	UniSTS:235465
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:130703
definition	standard_name : D6Mit16

name	(CDS detail)
type	STS
link
xref	UniSTS:141300
definition	standard_name : Cd8b

name	(CDS detail)
type	STS
link
xref	UniSTS:130665
definition	standard_name : D6Mit124

name	(CDS detail)
type	STS
link
xref	UniSTS:270412
definition	standard_name : PMC122808P1

name	(CDS detail)
type	STS
link
xref	UniSTS:141298
definition	standard_name : Cd8a

name	(CDS detail)
type	STS
link
xref	UniSTS:125906
definition	standard_name : Y00157

name	(CDS detail)
type	STS
link
xref	UniSTS:159518
definition	standard_name : Y00157

name	(CDS detail)
type	STS
link
xref	UniSTS:185670
definition	standard_name : BB154331

name	(CDS detail)
type	STS
link
xref	UniSTS:212677
definition	standard_name : RH129483

name	(CDS detail)
type	STS
link
xref	UniSTS:207974
definition	standard_name : AU024348

name	(CDS detail)
type	STS
link
xref	UniSTS:235471
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:235466
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:235467
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:268851
definition	standard_name : MARC_24177-24178:1033563974:1

name	(CDS detail)
type	STS
link
xref	UniSTS:179393
definition	standard_name : AW146237

name	(CDS detail)
type	STS
link
xref	UniSTS:271309
definition	standard_name : PMC154372P1

name	(CDS detail)
type	STS
link
xref	UniSTS:214171
definition	standard_name : RH130887

name	(CDS detail)
type	STS
link
xref	UniSTS:207977
definition	standard_name : C79882

name	(CDS detail)
type	STS
link
xref	UniSTS:167475
definition	standard_name : RH126761

name	(CDS detail)
type	STS
link
xref	UniSTS:224291
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:162108
definition	standard_name : RH125286

name	(CDS detail)
type	STS
link
xref	UniSTS:125633
definition	standard_name : T25656

name	(CDS detail)
type	STS
link
xref	UniSTS:130686
definition	standard_name : D6Mit143

name	(CDS detail)
type	STS
link
xref	UniSTS:159515
definition	standard_name : C87808

name	(CDS detail)
type	STS
link
xref	UniSTS:179390
definition	standard_name : AW558420

name	(CDS detail)
type	STS
link
xref	UniSTS:161843
definition	standard_name : RH125021

name	(CDS detail)
type	STS
link
xref	UniSTS:235469
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:159517
definition	standard_name : AF000938

name	(CDS detail)
type	STS
link
xref	UniSTS:130872
definition	standard_name : D6Mit319

name	(CDS detail)
type	STS
link
xref	UniSTS:271220
definition	standard_name : PMC152312P1

name	(CDS detail)
type	STS
link
xref	UniSTS:209590
definition	standard_name : Siat9

name	(CDS detail)
type	STS
link
xref	UniSTS:271797
definition	standard_name : PMC196074P2

name	(CDS detail)
type	STS
link
xref	UniSTS:165469
definition	standard_name : AI562151

name	(CDS detail)
type	STS
link
xref	UniSTS:130792
definition	standard_name : D6Mit243

name	(CDS detail)
type	STS
link
xref	UniSTS:142650
definition	standard_name : D6Wsu157e

name	(CDS detail)
type	STS
link
xref	UniSTS:161619
definition	standard_name : RH124797

name	(CDS detail)
type	STS
link
xref	UniSTS:179395
definition	standard_name : AI894154

name	(CDS detail)
type	STS
link
xref	UniSTS:165471
definition	standard_name : AI461894

name	(CDS detail)
type	STS
link
xref	UniSTS:235470
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:162861
definition	standard_name : RH126149

name	(CDS detail)
type	STS
link
xref	UniSTS:494235
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:490526
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:116759
definition	standard_name : RH101850

name	(CDS detail)
type	STS
link
xref	UniSTS:144743
definition	standard_name : Vamp8

name	(CDS detail)
type	STS
link
xref	UniSTS:179394
definition	standard_name : AU041171

name	(CDS detail)
type	STS
link
xref	UniSTS:165470
definition	standard_name : AI449819

name	(CDS detail)
type	STS
link
xref	UniSTS:498461
definition	standard_name : Capg

name	(CDS detail)
type	STS
link
xref	UniSTS:185671
definition	standard_name : AI844780

name	(CDS detail)
type	STS
link
xref	UniSTS:207979
definition	standard_name : BE198920

name	(CDS detail)
type	STS
link
xref	UniSTS:207978
definition	standard_name : RH126786

name	(CDS detail)
type	STS
link
xref	UniSTS:167484
definition	standard_name : RH127112

name	(CDS detail)
type	STS
link
xref	UniSTS:159516
definition	standard_name : AU015504

name	(CDS detail)
type	STS
link
xref	UniSTS:207980
definition	standard_name : BE335351

name	(CDS detail)
type	STS
link
xref	UniSTS:163390
definition	standard_name : D50031

name	(CDS detail)
type	STS
link
xref	UniSTS:179392
definition	standard_name : AJ223069

name	(CDS detail)
type	STS
link
xref	UniSTS:161251
definition	standard_name : RH124429

name	LOC668034 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149255251 GeneID:668034
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 7 Proteins product : similar to Ribosomal protein L19 pseudo : _no_value transcript_id : XR_034118.1

clone name	MSMg01-489N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-192M11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-192M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-436A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-260B08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-504M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351O15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-383L24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-271C03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-183L15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-213J06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-373D03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-341O21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-539H06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-172B24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-407B10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-460D03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-495L14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-054L21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-337M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-076P19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-079C07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-380D04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-521G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-481E17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-420J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-426P21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-292D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-524M13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502M21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-489L24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-053B24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-389F12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-186D14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-264C01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-298G18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-183N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-144O07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-430N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-068E06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-387D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-317L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-533O20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-267C03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-455E01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-540H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-411M17
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-189A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462H24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-475D11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-169K05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-362F09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-309G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-469M16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-490N16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-154C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-501G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-511B06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-092G14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-262C12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052D05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-142F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-453M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-376N24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-346P11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-402C18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-475D11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-494E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449G06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-298G22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-316D24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-338C16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-455M04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-433E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-201A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-063N23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348D06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-047E23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-342H01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-147G16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309P14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-061K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-058E18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-061K13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-531C14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-423L18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429N16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-138L10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-339H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-171N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-180K09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429A06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-500K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-475N19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-089G16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-322D01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-072G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119M19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088F17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-303O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307K13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150J19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003J08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317E13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196M19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344I02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-152J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350G10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-218H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275O06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-218H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-346B02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-004N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-339J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-074G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188G03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-114N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028L16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173N23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-312J06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340P04
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-267C03.T7 (MSMg01no267_c03.b1)	MSMg01-267C03.TJ (MSMg01no267_c03.g1)
ACC	AG407937	AG407938
length	850	745
length of high quality (start - end)	175 (46 - 220)	610 (77 - 686)
definition	CHROMAT_FILE: MSMg01no267_c03.b1 PHD_FILE: MSMg01no267_c03.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 21:05:06 2005	CHROMAT_FILE: MSMg01no267_c03.g1 PHD_FILE: MSMg01no267_c03.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 21:05:06 2005
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	TCATXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXCGCGG AATTCCAGGAAACAGAAATGGATTATTTCAACCTTTAATGCTTATATACG TATGTATAGGAAAGAGGGTGTTCTGGTGTTGCTAGTTTTCAGCAAAACAA GTGTATTTCCTCTTACGTTTCAATACTGTGTGTGTGTGTGTGTGTGTGTG TGTGTGTGTGTGTGTGNNNNNNCNNTNNNNNNNTNCTTTTTTTTTTTATT NTTTTTTTTTTTTTTTTTCCCCCTCTTCCTCCCTCCTCTCTCTTTTTTTC CCCCCCCTTCCTTTTCTCTCTTCTTTTTTTTTTCTCCATTTNCCCCCCCC CCCCCCCCCNTTTTTTTTTTTTATTCCCCNNNCCCCCCCCCCCNNTTNTT TTTTTTTTTTTTTTTTNNTTTTCCCCCCCCCCCTTTTAAAAAAAAAAAAA AATANTCTTCGGTGTGTTGGTTTCTTTTTCTTTTCATATATCATTTACAC CTTTATATTTTCCATCTCCCCTTTTATCCATCCTCCCCCCACCTTTTACC CCCTACTTTTTATTATCATTTTTTTCCTTTTTTATTTTTCTATTTTCTTT ACTCTTTTTTCTCTTTTCTTATACTTTTTAACTCCTCCCCCTCCTACTCA TATTCATCCTCTTTTTTCCGCCCCTCACCCCTCCTCTTTTTTTTTTTCCT CAAAATATTATCTTTTCTATCCTTCTACCCACCTCTTCCTCACTCCTTCT TTATTTTTCTCCTCCCCTCATTTTCTTTTATCTTACTGTTATTTGTATAC GTCATATCCATAAATCTCTTAAACTTAATCTCCATTATACTTCAATTATT	CGATGAXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXXXXTCACCTGAGGAATACCGAATGGCA GAGAAGCACCTGAAAAAATGTTCAACATCCTTAATCATCAGGGAAATGCA AATCAAAACAACCCTGAGATTCCACCTCACACCAGTCAGAATGTCTAAGA TTAAAAATTCAGGTGACAGCAGATGCTGGCGAGGATGTGGAGAAAGAGGA ACACTCCTCCATTGTTGGTGGGATTGTAGGCTTGTACAACCACTCTGGAA ATCCGTCTGGCGGTTCCTCAGAAAATTGGACATAGTACTACCGGAGGATC CAGCAATACCTCTCCTGGGCATATATCCAGAAGATGCCCCAACTGGTAAG AAGGACACATGCTCCACTATGTTCATAGCAGCCTTATTTATAATAGCCAG AAGCTGGAAAGAACCCAGATGCCCCTCAACAGAGGAATGGATACAGAAAA TGTGGTACATCTACACAATGGAGTACTACTCAGCTATTAAAAAGAATGAA TTTATGAAATTCCTAGCCAAATGGATGGACCTGGAGGGTATCATCCTGAG TGAGGTAACACATTCACAAAGGAACTCACACGATATGTACTCACTGATAA GTGGATATTAGCCCAAAACCTAGGATACCCAAGATATAAGATACAATTTC CTAAACACATGAAACTCAAGAAAAATGAAGACTGAAGTGTGGACN
quality values	Open. Hide. 8 8 8 8 8 9 13 28 37 34 29 28 28 22 22 30 32 30 27 27 29 30 31 37 41 30 28 28 28 30 36 48 48 48 48 48 48 48 57 57 29 28 20 26 26 37 34 48 57 42 47 47 47 68 42 50 41 47 50 51 43 43 50 50 50 50 50 50 50 50 50 47 50 50 51 68 48 48 46 46 46 48 68 68 68 51 51 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 59 59 68 68 68 59 59 59 57 57 57 68 68 57 59 59 59 59 59 59 57 57 57 57 57 57 57 57 59 59 59 59 59 59 59 59 47 43 41 23 23 3 0 0 0 0 0 0 3 0 0 3 0 0 0 0 0 0 0 3 0 3 10 10 23 22 21 15 15 12 12 9 9 9 9 3 0 3 9 9 18 16 20 19 17 16 13 13 9 9 9 8 8 8 8 8 8 8 8 8 8 8 8 8 8 9 12 12 10 13 13 10 8 6 6 8 8 9 9 9 10 15 13 15 10 8 8 8 8 10 17 22 22 22 19 10 9 8 9 10 9 9 10 13 10 8 8 6 6 6 8 21 22 32 30 39 30 24 13 10 8 8 8 8 8 8 3 0 3 8 8 6 10 11 9 16 19 24 16 21 9 9 9 9 3 0 3 7 7 9 9 9 9 9 9 7 10 6 6 6 8 8 12 17 3 0 0 0 3 7 7 9 9 9 9 9 18 12 3 0 0 3 3 0 3 22 22 18 24 11 11 9 8 8 8 14 17 8 10 10 8 3 0 0 3 10 8 9 9 9 9 9 23 23 28 23 13 10 12 13 18 15 20 18 20 26 30 37 32 26 22 28 22 22 20 15 12 10 10 3 0 3 8 8 8 9 10 11 8 8 6 7 8 8 10 11 11 13 12 10 9 10 9 9 10 11 9 9 13 12 9 9 8 8 6 7 8 8 13 13 8 8 8 8 10 10 11 10 8 8 6 6 6 6 10 13 10 9 8 8 8 8 10 9 10 9 9 10 16 12 8 8 8 8 6 6 8 8 8 8 8 9 10 10 8 8 8 8 8 11 10 10 8 8 8 8 12 9 8 8 8 8 10 12 18 22 12 12 12 12 8 8 6 6 8 8 12 18 20 18 16 8 8 8 8 8 8 8 11 11 13 13 16 18 20 13 13 10 9 8 8 8 8 8 10 10 9 9 9 9 8 8 11 8 10 9 9 12 10 8 8 8 10 10 10 11 11 11 10 9 12 16 17 13 10 10 11 11 12 9 9 8 8 12 16 12 15 11 9 8 8 8 8 8 8 8 9 9 8 8 6 6 12 12 12 10 8 8 11 15 13 13 12 13 9 9 9 8 8 8 10 10 16 17 19 10 10 10 12 11 17 19 12 19 8 10 8 11 10 10 9 10 10 10 15 8 8 8 8 10 10 10 13 13 10 9 9 9 9 13 10 10 10 8 8 8 10 10 13 16 8 8 8 8 6 6 8 8 10 8 6 8 10 10 9 9 8 8 8 8 10 10 10 9 9 9 8 9 9 9 13 15 14 10 10 8 8 8 8 8 9 11 18 8 8 7 7 11 10 8 8 8 8 8 8 8 8 13 13 8 7 8 8 6 6 8 10 11 12 8 8 8 8 6 6 6 6 6 6 9 9 10 10 8 8 8 8 8 8 10 8 8 8 8 8 8 8 8 8 10 12 6 6 8 6 8 8 8 8 8 8 10 8 8 8 8 8 8 10 10 10 10 10 10 10 10	Open. Hide. 9 9 9 13 11 8 8 8 8 17 20 39 39 39 47 47 47 47 39 44 50 53 53 50 50 50 50 59 59 43 27 23 9 7 7 7 8 7 10 9 10 10 14 13 21 23 26 41 37 41 41 47 47 50 50 53 53 50 50 27 27 9 10 13 12 12 10 11 11 22 15 20 25 28 28 28 41 41 47 47 36 50 50 50 50 42 42 37 47 50 40 50 50 53 53 53 50 68 68 68 68 68 68 59 59 57 57 59 57 68 57 57 57 68 68 68 50 50 50 50 51 57 57 54 54 47 57 57 57 57 57 51 51 51 50 50 50 57 57 57 57 57 68 48 48 48 50 50 50 50 57 57 57 57 50 57 57 57 57 57 57 57 57 57 50 50 50 50 50 57 57 57 57 57 57 57 59 57 57 59 59 59 57 57 57 57 57 57 57 57 68 57 57 57 57 59 59 57 68 68 68 68 68 68 57 57 57 57 57 57 54 59 57 57 57 57 57 57 57 59 57 57 57 57 57 57 57 57 59 57 57 57 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 68 68 62 62 62 62 62 62 62 62 62 62 68 68 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 68 68 68 62 62 62 68 68 68 68 68 62 62 62 62 68 68 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 68 68 62 57 57 57 57 57 59 59 59 59 59 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 59 57 57 57 59 59 59 68 68 68 59 59 57 57 57 57 57 59 59 59 59 59 59 59 68 68 68 68 68 68 68 68 59 59 57 54 54 57 59 59 59 59 59 57 57 68 68 68 68 57 57 57 54 50 50 50 59 57 59 59 57 54 57 57 57 44 43 57 57 59 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 54 48 48 57 57 57 59 57 54 57 57 57 57 59 59 59 68 68 68 68 68 54 57 57 57 57 57 59 59 59 48 48 59 59 59 59 59 59 59 59 59 59 57 57 48 48 48 34 34 23 23 23 28 34 24 18 18 34 34 43 47 47 59 43 41 41 40 39 39 39 43 37 37 39 39 39 41 41 42 42 41 41 47 39 47 47 57 47 43 30 30 23 23 23 37 32 43 57 48 48 48 46 46 46 47 48 59 48 48 47 46 43 39 30 30 35 31 37 41 59 44 41 41 43 43 41 41 25 25 11 11 11 26 27 59 48 48 48 59 47 46 46 43 43 41 40 40 39 47 39 41 30 31 33 37 37 30 20 17 14 12 15 23 36 36 37 32 31 29 37 37 26 26 31 31 35 29 29 32 28 20 30 18 19 19 25 21 16 21 11 15 15 21 16 25 30 36 34 37 32 41 31 30 30 25 25 25 25 24 23 18 22 28 20 21 14 14 22 23 12 11 11 11 13 17 21 19 12 12 11 18 18 24 18 17 18 18 11 11 11 17 16 3 0

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no267_c03.b1 MSMg01no267_c03.b1 CHROMAT_FILE:
MSMg01no267_c03.b1 PHD_FILE: MSMg01no267_c03.b1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 21:05:06 2005
         (175 letters)



>mm_chr6_71803291_71803865
          Length = 575

 Score =  290 bits (150), Expect = 3e-83
 Identities = 150/150 (100%)
 Strand = Plus / Plus

                                                                       
Query: 9   tccaggaaacagaaatggattatttcaacctttaatgcttatatacgtatgtataggaaa 68
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 209 tccaggaaacagaaatggattatttcaacctttaatgcttatatacgtatgtataggaaa 268

                                                                       
Query: 69  gagggtgttctggtgttgctagttttcagcaaaacaagtgtatttcctcttacgtttcaa 128
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 269 gagggtgttctggtgttgctagttttcagcaaaacaagtgtatttcctcttacgtttcaa 328

                                         
Query: 129 tactgtgtgtgtgtgtgtgtgtgtgtgtgt 158
           ||||||||||||||||||||||||||||||
Sbjct: 329 tactgtgtgtgtgtgtgtgtgtgtgtgtgt 358


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 22
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 175
Length of database: 575
Length adjustment: 8
Effective length of query: 167
Effective length of database: 567
Effective search space:    94689
Effective search space used:    94689
X1: 7 (13.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 7 (14.4 bits)
S2: 7 (14.3 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information