MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-418D04
Chromosome	6 (Build37)
Map Location	135,673,292 - 135,843,392
singlet/doublet	doublet
Overlap gene	Grin2b
Upstream gene	Dusp16, Crebl2, Gpr19, Cdkn1b, 1190002F15Rik, Apold1, Ddx47, Gprc5a, Gprc5d, LOC100043668, Hebp1, 8430419L09Rik, Gsg1, Pbp2, LOC100043890, Emp1
Downstream gene	EG668137, LOC545887, E330021D16Rik, EG627022, LOC100043893, Atf7ip, 1100001H23Rik, LOC100043894, Gucy2c, Hist4h4, H2afj, Wbp11, BC049715, C030030A07Rik, Art4, Mgp
Link	Open Mouse BAC browser

Click to get alignment info.

name	Dusp16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70686 MGI:1917936
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Crebl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232430 MGI:1889385
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpr19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14760 MGI:892973
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdkn1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12576 MGI:104565
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1190002F15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381822 MGI:1915081
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 27 ESTs

name	Apold1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381823 MGI:2685921
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 20 ESTs, 2 Proteins

name	Ddx47 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67755 MGI:1915005
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gprc5a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232431 MGI:1891250
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gprc5d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93746 MGI:1935037
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043668 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043668
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Hebp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15199 MGI:1333880
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	8430419L09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74525 MGI:1921775
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gsg1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14840 MGI:1194499
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Pbp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76400 MGI:1923650
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043890 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043890
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 538 ESTs, 9 Proteins

name	Emp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13730 MGI:107941
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Grin2b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14812 MGI:95821
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG668137 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668137 MGI:3644226
definition	note : predicted gene, EG668137 pseudo : _no_value

name	LOC545887 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545887
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 143 ESTs, 58 Proteins pseudo : _no_value

name	E330021D16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243676 MGI:2141773
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA pseudo : _no_value

name	EG627022 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627022 MGI:3643418
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 27 ESTs, 10 Proteins

name	LOC100043893 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043893
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 279 ESTs, 6 Proteins

name	Atf7ip (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54343 MGI:1858965
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1100001H23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66857 MGI:1914107
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043894 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043894
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Gucy2c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14917 MGI:106903
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist4h4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320332 MGI:2448443
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	H2afj (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232440 MGI:3606192
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wbp11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:60321 MGI:1891823
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC049715 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320135 MGI:3605234
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C030030A07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:654818 MGI:2443451
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Art4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109978 MGI:1202710
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mgp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17313 MGI:96976
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dusp16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114205413 GeneID:70686 MGI:1917936
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dual specificity phosphatase 16 transcript_id : NM_001048054.1

name	Dusp16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114205411 GeneID:70686 MGI:1917936
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dual specificity phosphatase 16 transcript_id : NM_130447.2

name	Crebl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367492 GeneID:232430 MGI:1889385
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cAMP responsive element binding protein-like 2 transcript_id : NM_177687.3

name	Gpr19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680070 GeneID:14760 MGI:892973
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 19 transcript_id : NM_008157.1

name	Cdkn1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144227221 GeneID:12576 MGI:104565
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin-dependent kinase inhibitor 1B transcript_id : NM_009875.3

name	1190002F15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255451 GeneID:381822 MGI:1915081
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 27 ESTs product : RIKEN cDNA 1190002F15 gene transcript_id : XM_001481164.1

name	Apold1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94378168 GeneID:381823 MGI:2685921
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 20 ESTs, 2 Proteins product : apolipoprotein L domain containing 1 transcript_id : XM_355823.3

name	Ddx47 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383958 GeneID:67755 MGI:1915005
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DEAD (Asp-Glu-Ala-Asp) box polypeptide 47 transcript_id : NM_026360.2

name	Gprc5a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803155 GeneID:232431 MGI:1891250
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor, family C, group 5, member A transcript_id : NM_181444.4

name	Gprc5d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716416 GeneID:93746 MGI:1935037
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor, family C, group 5, member D transcript_id : NM_053118.1

name	Hebp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124001579 GeneID:15199 MGI:1333880
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : heme binding protein 1 transcript_id : NM_013546.2

name	8430419L09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803243 GeneID:74525 MGI:1921775
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 8430419L09 gene transcript_id : NM_028982.3

name	Gsg1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:123317842 GeneID:14840 MGI:1194499
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : germ cell-specific gene 1 transcript_id : NM_001080553.1

name	Gsg1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:123317848 GeneID:14840 MGI:1194499
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : germ cell-specific gene 1 transcript_id : NM_010352.2

name	Gsg1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:123317840 GeneID:14840 MGI:1194499
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : germ cell-specific gene 1 transcript_id : NM_001080552.1

name	Pbp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:128485804 GeneID:76400 MGI:1923650
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatidylethanolamine binding protein 2 transcript_id : NM_029595.3

name	LOC100043890 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255455 GeneID:100043890
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 538 ESTs, 8 Proteins product : similar to tctex-1 protein, transcript variant 1 transcript_id : XM_001481167.1

name	LOC100043890 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255453 GeneID:100043890
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 64 ESTs, 1 Protein product : similar to tctex-1 protein, transcript variant 2 transcript_id : XM_001481168.1

name	Emp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892886 GeneID:13730 MGI:107941
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : epithelial membrane protein 1 transcript_id : NM_010128.4

name	Grin2b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117168298 GeneID:14812 MGI:95821
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutamate receptor, ionotropic, NMDA2B (epsilon 2) transcript_id : NM_008171.3

name	EG627022 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255379 GeneID:627022 MGI:3643418
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 27 ESTs, 10 Proteins product : predicted gene, EG627022 transcript_id : XM_891654.3

name	LOC100043893 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255458 GeneID:100043893
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 279 ESTs, 6 Proteins product : similar to ribosomal protein L36a transcript_id : XM_001481171.1

name	Atf7ip (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328231 GeneID:54343 MGI:1858965
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : activating transcription factor 7 interacting protein transcript_id : NM_019426.2

name	1100001H23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13385273 GeneID:66857 MGI:1914107
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1100001H23 gene transcript_id : NM_025806.1

name	Gucy2c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801773 GeneID:14917 MGI:106903
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : guanylate cyclase 2c transcript_id : NM_145067.2

name	Hist4h4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:28316745 GeneID:320332 MGI:2448443
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 4, H4 transcript_id : NM_175652.1

name	H2afj (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364094 GeneID:232440 MGI:3606192
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : H2A histone family, member J transcript_id : NM_177688.3

name	Wbp11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982142 GeneID:60321 MGI:1891823
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WW domain binding protein 11 transcript_id : NM_021714.3

name	BC049715 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119392078 GeneID:320135 MGI:3605234
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC049715 transcript_id : NM_178776.3

name	C030030A07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112363104 GeneID:654818 MGI:2443451
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C030030A07 gene transcript_id : NM_001039558.2

name	Art4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374158 GeneID:109978 MGI:1202710
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ADP-ribosyltransferase 4 transcript_id : NM_026639.2

name	Mgp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:123701577 GeneID:17313 MGI:96976
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : matrix Gla protein transcript_id : NM_008597.3

name	Dusp16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114205414 GeneID:70686 MGI:1917936
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0017017 - MAP kinase phosphatase activity [Evidence IEA]; GO:0016791 - phosphoric monoester hydrolase activity [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0000188 - inactivation of MAPK activity [Evidence IDA]; GO:0006470 - protein amino acid dephosphorylation [Evidence IEA] codon_start : 1 note : isoform B1 is encoded by transcript variant B1; map kinase phosphatase-M; MAP kinase phosphatase-7 product : dual specificity phosphatase 16 isoform B1 protein_id : NP_001041519.1

name	Dusp16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114205412 GeneID:70686 MGI:1917936
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0017017 - MAP kinase phosphatase activity [Evidence IEA]; GO:0016791 - phosphoric monoester hydrolase activity [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0000188 - inactivation of MAPK activity [Evidence IDA]; GO:0006470 - protein amino acid dephosphorylation [Evidence IEA] codon_start : 1 note : isoform A1 is encoded by transcript variant A1; map kinase phosphatase-M; MAP kinase phosphatase-7 product : dual specificity phosphatase 16 isoform A1 protein_id : NP_569714.2

name	Crebl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244124 CCDS:CCDS20640.1 GeneID:232430 MGI:1889385
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : cAMP responsive element binding protein-like 2 protein_id : NP_808355.1

name	Gpr19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680071 CCDS:CCDS20641.1 GeneID:14760 MGI:892973
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation product : G protein-coupled receptor 19 protein_id : NP_032183.1

name	Cdkn1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542372 CCDS:CCDS20642.1 GeneID:12576 MGI:104565
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0004861 - cyclin-dependent protein kinase inhibitor activity [Evidence IDA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004860 - protein kinase inhibitor activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0007050 - cell cycle arrest [Evidence IDA]; GO:0048839 - inner ear development [Evidence IMP]; GO:0051271 - negative regulation of cell motility [Evidence IDA]; GO:0008285 - negative regulation of cell proliferation [Evidence IMP]; GO:0045736 - negative regulation of cyclin-dependent protein kinase activity [Evidence IDA]; GO:0050680 - negative regulation of epithelial cell proliferation [Evidence IMP]; GO:0008284 - positive regulation of cell proliferation [Evidence IMP]; GO:0031116 - positive regulation of microtubule polymerization [Evidence IGI]; GO:0007605 - sensory perception of sound [Evidence IMP] codon_start : 1 product : cyclin-dependent kinase inhibitor 1B (P27) protein_id : NP_034005.2

name	1190002F15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255452 GeneID:381822 MGI:1915081
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481214.1

name	Apold1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38085372 GeneID:381823 MGI:2685921
definition	codon_start : 1 product : similar to vascular early response gene protein protein_id : XP_355823.1

name	Ddx47 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229058 CCDS:CCDS20643.1 GeneID:67755 MGI:1915005
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008026 - ATP-dependent helicase activity [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 product : DEAD (Asp-Glu-Ala-Asp) box polypeptide 47 protein_id : NP_080636.2

name	Gprc5a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31126968 CCDS:CCDS20644.1 GeneID:232431 MGI:1891250
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0008067 - metabotropic glutamate, GABA-B-like receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation product : retinoic acid induced 3 protein_id : NP_852109.1

name	Gprc5d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716417 GeneID:93746 MGI:1935037
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0008067 - metabotropic glutamate, GABA-B-like receptor activity [Evidence ISS] [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0004872 - receptor activity [Evidence IEA]; GO:0005118 - sevenless binding [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA] [Evidence ISS]; GO:0042633 - hair cycle [Evidence NAS]; GO:0031424 - keratinization [Evidence NAS]; GO:0007165 - signal transduction [Evidence IEA]; GO:0007601 - visual perception [Evidence IEA] codon_start : 1 product : G protein-coupled receptor, family C, group 5, member D protein_id : NP_444348.1

name	Hebp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124001580 CCDS:CCDS20645.1 GeneID:15199 MGI:1333880
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005829 - cytosol [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0020037 - heme binding [Evidence IDA] GO_process : GO:0042168 - heme metabolism [Evidence IC] codon_start : 1 note : p22 HBP; heme-binding protein; heme-binding protein 1 product : heme binding protein 1 protein_id : NP_038574.2

name	8430419L09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560063 GeneID:74525 MGI:1921775
definition	codon_start : 1 product : hypothetical protein LOC74525 protein_id : NP_083258.2

name	Gsg1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:123317841 GeneID:14840 MGI:1194499
definition	codon_start : 1 note : isoform a is encoded by transcript variant 1 product : germ cell-specific gene 1 isoform a protein_id : NP_001074021.1

name	Gsg1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:123317843 GeneID:14840 MGI:1194499
definition	codon_start : 1 note : isoform b is encoded by transcript variant 2 product : germ cell-specific gene 1 isoform b protein_id : NP_001074022.1

name	Gsg1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:123317849 GeneID:14840 MGI:1194499
definition	codon_start : 1 note : isoform b is encoded by transcript variant 3 product : germ cell-specific gene 1 isoform b protein_id : NP_034482.2

name	Pbp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:128485805 CCDS:CCDS20646.1 GeneID:76400 MGI:1923650
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0008289 - lipid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] codon_start : 1 product : phosphatidylethanolamine binding protein-2 protein_id : NP_083871.3

name	LOC100043890 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255454 GeneID:100043890
definition	codon_start : 1 product : similar to tctex-1 protein isoform 2 protein_id : XP_001481218.1

name	LOC100043890 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255456 GeneID:100043890
definition	codon_start : 1 product : similar to tctex-1 protein isoform 1 protein_id : XP_001481217.1

name	Emp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753748 CCDS:CCDS20647.1 GeneID:13730 MGI:107941
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : epithelial membrane protein 1 protein_id : NP_034258.1

name	Grin2b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117168299 CCDS:CCDS20648.1 GeneID:14812 MGI:95821
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA]; GO:0045211 - postsynaptic membrane [Evidence IDA]; GO:0042734 - presynaptic membrane [Evidence IEP]; GO:0008021 - synaptic vesicle [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005234 - glutamate-gated ion channel activity [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0004970 - ionotropic glutamate receptor activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0007611 - learning and/or memory [Evidence TAS]; GO:0048168 - regulation of neuronal synaptic plasticity [Evidence TAS]; GO:0007268 - synaptic transmission [Evidence TAS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : GluRepsilon2; N-methyl D-aspartate receptor 2B product : glutamate receptor, ionotropic, NMDA2B (epsilon 2) precursor protein_id : NP_032197.3

name	EG627022 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94378174 GeneID:627022 MGI:3643418
definition	codon_start : 1 product : similar to Coenzyme Q2 homolog, prenyltransferase (yeast) protein_id : XP_896747.2

name	LOC100043893 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255459 GeneID:100043893
definition	codon_start : 1 product : similar to ribosomal protein L36a protein_id : XP_001481221.1

name	Atf7ip (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328232 CCDS:CCDS20651.1 GeneID:54343 MGI:1858965
definition	GO_component : GO:0005634 - nucleus [Evidence ISS]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0016887 - ATPase activity [Evidence IDA]; GO:0005515 - protein binding [Evidence ISS]; GO:0003714 - transcription corepressor activity [Evidence IDA] GO_process : GO:0006306 - DNA methylation [Evidence ISS]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0045893 - positive regulation of transcription, DNA-dependent [Evidence ISS]; GO:0045898 - regulation of transcriptional preinitiation complex formation [Evidence ISS] codon_start : 1 note : ATFa-associated Modulator product : activating transcription factor 7 interacting protein protein_id : NP_062299.2

name	1100001H23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385274 CCDS:CCDS20652.1 GeneID:66857 MGI:1914107
definition	codon_start : 1 product : hypothetical protein LOC66857 protein_id : NP_080082.1

name	Gucy2c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71894985 CCDS:CCDS20653.1 GeneID:14917 MGI:106903
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004383 - guanylate cyclase activity [Evidence IMP]; GO:0016829 - lyase activity [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA] GO_process : GO:0006182 - cGMP biosynthesis [Evidence IMP] [Evidence IDA]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0009636 - response to toxin [Evidence IMP] codon_start : 1 exception : mismatches in translation note : guanylyl cyclase C; heat stable enterotoxin receptor product : guanylate cyclase 2c protein_id : NP_659504.1

name	Hist4h4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28316746 GeneID:320332 MGI:2448443
definition	codon_start : 1 product : histone 4, H4 protein_id : NP_783583.1

name	H2afj (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244126 CCDS:CCDS20654.1 GeneID:232440 MGI:3606192
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : H2A histone family, member J protein_id : NP_808356.1

name	Wbp11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982143 CCDS:CCDS20655.1 GeneID:60321 MGI:1891823
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016607 - nuclear speck [Evidence IDA]; GO:0005730 - nucleolus [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008599 - protein phosphatase type 1 regulator activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA]; GO:0008380 - RNA splicing [Evidence IDA]; GO:0006364 - rRNA processing [Evidence IEA] codon_start : 1 exception : mismatches in translation note : Npw38-binding protein product : WW domain binding protein 11 protein_id : NP_068360.3

name	C030030A07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112363105 CCDS:CCDS20656.1 GeneID:654818 MGI:2443451
definition	codon_start : 1 product : hypothetical protein LOC654818 protein_id : NP_001034647.2

name	BC049715 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119392079 GeneID:320135 MGI:3605234
definition	codon_start : 1 product : hypothetical protein LOC320135 protein_id : NP_848891.2

name	Art4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386130 CCDS:CCDS20658.1 GeneID:109978 MGI:1202710
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0003956 - NAD(P)+-protein-arginine ADP-ribosyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : mono(ADP-ribosyl)transferase product : ADP-ribosyltransferase 4 protein_id : NP_080915.1

name	Mgp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678876 CCDS:CCDS20659.1 GeneID:17313 MGI:96976
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005125 - cytokine activity [Evidence IEA] GO_process : GO:0051216 - cartilage development [Evidence IEA]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0001503 - ossification [Evidence IEA]; GO:0030500 - regulation of bone mineralization [Evidence IEA] codon_start : 1 note : matrix gamma-carboxyglutamate (gla) protein product : matrix Gla protein protein_id : NP_032623.1

name	LOC100043668 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043668
definition	number : 2 pseudo : _no_value

name	LOC100043668 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043668
definition	number : 1 pseudo : _no_value

name	LOC100043894 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043894
definition	number : 1 pseudo : _no_value

name	(CDS detail)
type	STS
link
xref	UniSTS:163153
definition	standard_name : RH126445

name	(CDS detail)
type	STS
link
xref	UniSTS:159594
definition	standard_name : 39.MMHAP35FLE6.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:159593
definition	standard_name : AI046348

name	(CDS detail)
type	STS
link
xref	UniSTS:235820
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:235565
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:143243
definition	standard_name : Gpr19

name	(CDS detail)
type	STS
link
xref	UniSTS:495943
definition	standard_name : Gpr19

name	(CDS detail)
type	STS
link
xref	UniSTS:220765
definition	standard_name : RH138678

name	(CDS detail)
type	STS
link
xref	UniSTS:468000
definition	standard_name : Cdkn1b

name	(CDS detail)
type	STS
link
xref	UniSTS:164681
definition	standard_name : Cdkn1b

name	(CDS detail)
type	STS
link
xref	UniSTS:270519
definition	standard_name : PMC126040P1

name	(CDS detail)
type	STS
link
xref	UniSTS:273586
definition	standard_name : PMC87223P1

name	(CDS detail)
type	STS
link
xref	UniSTS:273587
definition	standard_name : PMC87223P2

name	(CDS detail)
type	STS
link
xref	UniSTS:273588
definition	standard_name : PMC87223P3

name	(CDS detail)
type	STS
link
xref	UniSTS:272582
definition	standard_name : PMC307617P3

name	(CDS detail)
type	STS
link
xref	UniSTS:273082
definition	standard_name : PMC317217P1

name	(CDS detail)
type	STS
link
xref	UniSTS:161524
definition	standard_name : RH124702

name	(CDS detail)
type	STS
link
xref	UniSTS:270954
definition	standard_name : PMC140666P1

name	(CDS detail)
type	STS
link
xref	UniSTS:164346
definition	standard_name : AI843786

name	(CDS detail)
type	STS
link
xref	UniSTS:161191
definition	standard_name : RH124369

name	(CDS detail)
type	STS
link
xref	UniSTS:248711
definition	standard_name : BF414255

name	(CDS detail)
type	STS
link
xref	UniSTS:179505
definition	standard_name : AI120476

name	(CDS detail)
type	STS
link
xref	UniSTS:151482
definition	standard_name : D12S1235E

name	(CDS detail)
type	STS
link
xref	UniSTS:235566
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:162851
definition	standard_name : RH126139

name	(CDS detail)
type	STS
link
xref	UniSTS:248750
definition	standard_name : BF414790

name	(CDS detail)
type	STS
link
xref	UniSTS:113807
definition	standard_name : D4Got142

name	(CDS detail)
type	STS
link
xref	UniSTS:163401
definition	standard_name : D87325

name	(CDS detail)
type	STS
link
xref	UniSTS:165494
definition	standard_name : AI326308

name	(CDS detail)
type	STS
link
xref	UniSTS:489250
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:130740
definition	standard_name : D6Mit197

name	(CDS detail)
type	STS
link
xref	UniSTS:465385
definition	standard_name : Emp1

name	(CDS detail)
type	STS
link
xref	UniSTS:163402
definition	standard_name : U25633

name	(CDS detail)
type	STS
link
xref	UniSTS:159578
definition	standard_name : U25633

name	(CDS detail)
type	STS
link
xref	UniSTS:159580
definition	standard_name : MHAa82b3.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:131551
definition	standard_name : D8Mit338

name	(CDS detail)
type	STS
link
xref	UniSTS:35375
definition	standard_name : RH65679

name	(CDS detail)
type	STS
link
xref	UniSTS:179480
definition	standard_name : AW490526

name	(CDS detail)
type	STS
link
xref	UniSTS:143262
definition	standard_name : Grin2b

name	(CDS detail)
type	STS
link
xref	UniSTS:130852
definition	standard_name : D6Mit301

name	(CDS detail)
type	STS
link
xref	UniSTS:119997
definition	standard_name : RH94750

name	(CDS detail)
type	STS
link
xref	UniSTS:130807
definition	standard_name : D6Mit258

name	(CDS detail)
type	STS
link
xref	UniSTS:498328
definition	standard_name : Tubb3

name	(CDS detail)
type	STS
link
xref	UniSTS:208042
definition	standard_name : RH127208

name	(CDS detail)
type	STS
link
xref	UniSTS:130894
definition	standard_name : D6Mit339

name	(CDS detail)
type	STS
link
xref	UniSTS:130895
definition	standard_name : D6Mit339.2

name	(CDS detail)
type	STS
link
xref	UniSTS:208043
definition	standard_name : BB199614

name	(CDS detail)
type	STS
link
xref	UniSTS:211892
definition	standard_name : RH128584

name	(CDS detail)
type	STS
link
xref	UniSTS:179481
definition	standard_name : AI893437

name	(CDS detail)
type	STS
link
xref	UniSTS:489545
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:142645
definition	standard_name : RH125848

name	(CDS detail)
type	STS
link
xref	UniSTS:161685
definition	standard_name : RH124863

name	LOC545887 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149255457 GeneID:545887
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 143 ESTs, 58 Proteins product : similar to tubulin beta-3 pseudo : _no_value transcript_id : XR_035030.1

name	E330021D16Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149255123 GeneID:243676 MGI:2141773
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA E330021D16 gene pseudo : _no_value transcript_id : XR_035141.1

clone name	MSMg01-523G13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-278P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-508L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-078G06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-398B07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-098P24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-100P15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-231N12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-147H24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-393I21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418A04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-380C01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-049C19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-293C04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-272P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-421D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-440F17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-471J07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348J20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-462A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-442E03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-346E19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-490E03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-272H18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-517K19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-405P19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-416O04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-445M01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-096P22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372D17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-495A17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-418D04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-267H01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-124B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-362O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-514H01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-179A16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-267B20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-521L21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-312H02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-375M01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-165F06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-427P17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-397F04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-133M24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-302J22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-207P07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-490L22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-405O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-397O11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-461A01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-486K22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-094H01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-501D02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-345O11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-447H02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-495N16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-089K24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-078D05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-537J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-217A11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-192N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-133O24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-498F01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-130H15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-078D03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472C04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-167C04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-167D12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-167C12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-147J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-161H05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-459F03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-368E09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-068H18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449O08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-513N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-357G20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449B15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-132E05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-299L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-169F24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-426B11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-102D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-425I09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-450K18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-545B06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-501G09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-050F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068M17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-191M23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131H13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035M09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-180M14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-220E13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193H16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-038I22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-096A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273O06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-273O07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056B04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131I13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-170I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114J19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-128D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102I16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161P14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185H13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030E01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-337H09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-220P14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261F17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-337I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023J02
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-418D04.T7 (MSMg01no418_d04.b1)	MSMg01-418D04.TJ (MSMg01no418_d04.g1)
ACC	AG513594	AG513595
length	753	749
length of high quality (start - end)	607 (49 - 655)	552 (77 - 628)
definition	CHROMAT_FILE: MSMg01no418_d04.b1 PHD_FILE: MSMg01no418_d04.b1.phd.1 CHEM: term DYE: big TIME: Wed May 18 18:37:20 2005	CHROMAT_FILE: MSMg01no418_d04.g1 PHD_FILE: MSMg01no418_d04.g1.phd.1 CHEM: term DYE: big TIME: Wed May 18 18:37:20 2005
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(135,842,790 - 135,843,392)	(135,673,292 - 135,673,843)
sequence	NATCAATXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXCG CGGAATTCCATGTTATGCGATCATATTCACCCCCATTCCCCCCAGTAGCC CCTCCAAGAACTACCTCATACCCCCACCTCTGCAACTTTGCATCTACCTC TTTCAGCCATGGAGTACAATTTGTGCTGCACAGAAATTGACCGCAAAGCC TCTAATTTCTAGAGCAATTCCTGATGCTAATGATCTTTTCCATGAATTCC ATGGAGACAGACCATGATGTTAAAAAAAAAAATTAAGCAATTGCAGGCAG GCCACAGGAGTCAGAAACCAGAAGACTCACCCAGGGAGAGAGAGAAAGTC GGTACTAGTGGTTTGAGCACTGGTGGAAGAAAGCAGTCTCCATCCTTCCA GAAAGCTCTGAAGAGTCCTTAGGACTGAAACAAAGACAAAAGACTGACAC ATTGATTCACAGACTTTAGCTCACACATTCCCACGTATAGTCATATATTT TTGAGTTGTATGTGCTAAAACAACCAGTAACTACTTTATCAGTGTCTAAC ATCCTCCTGGCAGAGAAAACTCAGGACAAGAAGCCAAAGCTACAAGACGC TGAATCCAGACCATACATACACCCATTGGTGAGATGCTAAATGAAGTTGG CTAAGTCTCAGGTGGAAATGGTCGCTATGGTCATACGCAGCCACAGTGGC AGAGGTGGCCAGGGTATTTGAAAGAGTTCAGAATAATGCCTGACACTTAA CTC	CGATGAXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXXXXTTCTGGATCAAGTCATTAAAATTC TGACGTGTTCTCACTTGAGATGTGCATGTCAGAGGTAATGTGTTTAATAA CCTCAGTGCCATAAAGCCTCAGAAAGGGCAAGAAAAGAAAGTCATCAAGC CAAGGGGAGAAGCAGAACAAATAGCCCCTGACCCCGGGTCTGGGCCACCT GGTTACAAAGGTGGCAACTTCCAGCACTCAGTGCAATCCTATTGGATCAC AAATCCTATTGAGACTCACAATGCTGAGTGGTTAGTGAGCTTATCTTGTA ACAAGGGTCCAAATAACTCAAACTGTCTAACTCTTGAAACAAAGACCTGT CAATCCCAGCATAGATCATACTGTGCTCACTCAGGACAGTGACATGTCCC GACATCAGCTCTACTCACCTCCCATTTGATCAACATTCTTCGAAGTCTAA TCTTCTGACATTTATTTTGTGCACAACCATCACTGCAGAGACACATTAAT AACCATGAAGTAGCCAAAGAAGAAGGACTTCAGAGAATGAAGCATGACTT GGAGAAATACACATTTCCACTGGAAATAAGCCTGTGGAAATGCACACACA TGCTGTGAGTGTACTACTGAGGCTCTGTGTGGAGAAAAAGAGAAACGTGG AGTTTGTGGGGCAAGAACTCATCCTTACTTATTCCTGTAGATTTCAATN
quality values	Open. Hide. 0 3 7 10 8 8 8 9 10 12 16 30 30 41 41 39 34 31 32 32 30 28 28 41 37 37 43 43 28 22 21 19 17 9 11 10 12 9 11 18 16 28 30 29 29 31 31 31 35 59 59 59 36 33 33 33 37 37 37 22 22 10 8 8 8 8 8 8 12 19 22 37 37 37 33 31 31 36 36 36 50 57 57 53 53 53 53 57 57 59 57 53 53 50 50 53 68 68 68 68 68 68 51 47 47 47 50 50 68 68 68 68 68 68 51 51 51 51 51 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 51 51 51 50 50 50 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 50 51 50 68 68 68 68 68 68 68 68 68 68 59 59 59 68 68 68 68 68 68 68 68 68 59 59 59 59 68 68 68 68 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 68 62 62 62 62 62 62 62 62 62 62 62 62 68 68 68 68 68 68 62 62 62 62 62 68 68 68 68 68 68 68 68 62 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 62 44 43 35 26 27 27 31 43 43 62 62 62 62 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 62 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 57 57 59 59 68 68 68 68 68 68 68 57 57 57 57 57 59 68 68 68 68 68 68 59 59 59 68 59 59 57 57 57 57 57 59 59 59 59 57 57 57 57 57 57 59 59 59 57 57 52 52 52 57 59 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 54 52 52 52 52 57 57 59 59 59 57 47 47 43 44 54 57 57 57 57 57 59 57 57 57 57 48 57 59 59 59 59 59 59 48 59 59 57 57 57 59 59 68 68 59 57 47 47 44 57 46 54 48 57 48 54 54 54 54 54 54 57 48 42 42 41 42 43 43 43 47 47 59 59 48 48 48 48 50 50 47 37 34 32 32 36 39 43 43 48 48 59 48 48 46 46 46 41 41 41 39 32 31 39 30 30 14 14 14 30 26 32 30 22 24 19 22 19 27 23 25 22 24 25 27 30 26 27 27 34 41 43 47 37 37 37 37 30 30 30 34 32 47 37 37 31 34 37 41 41 41 41 34 31 28 35 28 30 28 28 22 29 23 23 23 34 34 37 30 27 22 19 21 16 15 15 13 18 18 32 31 37 37 37 32 23 22 16 19 18 22 30 30 37 21 23 11 11 11 18 16 16 11 14 13 23 20 25 13 13 10 10 8 9 12 15 14 28 23 28 26 18 15 19 19 24 21 21 11 11 11 12 12 11 11 11 11 17 18 22 18 22 22 30 25 17 21 11 11 11 17 19 16 14 12 15 15 17 28 32 25 31 21 16 11 11 11 16 16 25 18 20 9 8 8 9 8 8 10 11 10 10 10 16 16 10 10 10 20 19 19 12 13 11 11 11	Open. Hide. 9 9 14 14 6 6 8 8 8 19 21 30 27 28 37 36 36 41 37 37 47 47 50 50 50 42 41 47 24 21 7 7 7 8 7 8 11 11 9 9 10 9 10 12 18 15 22 32 44 36 36 33 33 33 33 42 30 21 13 9 10 10 10 11 12 12 23 22 35 35 28 33 33 33 33 36 59 57 57 57 42 42 43 53 50 50 50 57 59 59 59 59 59 57 57 57 54 54 68 68 68 68 68 68 68 68 68 68 59 54 54 54 54 54 54 59 59 47 50 47 50 47 47 57 57 57 68 68 68 68 68 68 68 68 68 68 50 50 50 51 51 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 57 57 57 57 57 59 59 57 57 57 59 57 52 57 57 57 57 59 59 57 57 57 57 57 57 57 57 59 59 59 57 57 57 52 52 52 52 52 52 57 57 52 52 52 57 57 57 57 57 57 68 57 59 52 52 52 57 57 57 57 68 68 68 57 57 57 57 52 57 57 57 57 57 57 57 57 57 57 57 57 57 59 59 59 59 57 54 54 57 57 57 59 57 57 57 57 57 54 54 57 57 59 68 68 68 68 59 59 59 59 59 57 57 57 57 57 68 59 59 59 59 57 59 59 68 68 59 59 54 57 57 57 57 68 68 68 57 57 57 57 57 57 57 57 57 59 59 59 57 57 57 57 57 50 59 59 59 47 37 34 21 19 11 11 11 12 12 28 19 34 34 59 59 59 59 53 53 57 57 57 57 57 57 57 57 59 59 59 59 59 59 57 57 57 68 68 68 59 59 54 54 54 57 57 59 59 68 68 68 68 68 68 68 68 68 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 54 57 57 57 57 57 54 54 57 57 57 57 57 57 57 68 68 68 57 57 54 57 57 68 68 68 68 68 68 68 68 68 68 68 57 57 57 52 52 57 57 57 68 68 68 57 57 57 54 54 57 57 57 57 57 59 59 59 59 59 59 59 68 59 59 50 59 59 57 57 50 43 43 57 57 57 57 57 57 57 57 68 68 59 57 57 57 57 57 68 68 59 59 68 59 59 59 59 59 54 54 54 54 57 57 57 57 57 59 59 59 57 57 54 54 54 54 48 48 54 54 54 59 59 43 43 43 43 43 36 36 36 43 43 47 43 43 43 47 47 39 33 30 41 37 43 43 48 48 48 43 41 46 40 39 41 41 41 37 32 41 41 47 47 41 36 34 28 27 16 18 18 24 31 32 32 41 37 31 31 23 22 30 29 26 23 12 11 11 21 23 25 25 30 24 22 17 24 24 28 28 37 32 36 39 39 26 26 20 20 12 19 15 18 18 17 28 30 28 28 30 27 27 15 17 17 26 20 28 39 39 30 20 20 11 11 11 14 20 13 13 13 13 21 28 22 28 20 18 18 19 19 23 29 28 23 23 21 21 12 10 10 19 18 21 28 28 23 19 19 16 13 13 16 19 15 19 15 28 15 26 26 10 10 9 10 9 12 12 9 9 8 15 9 9 9 9 13 12 12 10 10 12 12 16 14 23 11 11 10 15 13 15 10 12 10 8 8 8 12 15 12 12 13 10 10 10 13 13 13 14 13 11 11 12 11 13 13 23 21 18 16 11 12 11 11 11 13 10 11 12 9 9 3 0

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no418_d04.b1 MSMg01no418_d04.b1 CHROMAT_FILE:
MSMg01no418_d04.b1 PHD_FILE: MSMg01no418_d04.b1.phd.1 CHEM: term DYE:
big TIME: Wed May 18 18:37:20 2005
         (607 letters)



>mm_chr6_135842586_135843592
          Length = 1007

 Score = 1143 bits (591), Expect = 0.0
 Identities = 600/603 (99%)
 Strand = Plus / Minus

                                                                       
Query: 5   gaattccatgttatgcgatcatattcacccccattccccccagtagcccctccaagaact 64
           ||||||||||  ||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 807 gaattccatgcaatgtgatcatattcacccccattccccccagtagcccctccaagaact 748

                                                                       
Query: 65  acctcatacccccacctctgcaactttgcatctacctctttcagccatggagtacaattt 124
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 747 acctcatacccccacctctgcaactttgcatctacctctttcagccatggagtacaattt 688

                                                                       
Query: 125 gtgctgcacagaaattgaccgcaaagcctctaatttctagagcaattcctgatgctaatg 184
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 687 gtgctgcacagaaattgaccgcaaagcctctaatttctagagcaattcctgatgctaatg 628

                                                                       
Query: 185 atcttttccatgaattccatggagacagaccatgatgttaaaaaaaaaaattaagcaatt 244
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 627 atcttttccatgaattccatggagacagaccatgatgttaaaaaaaaaaattaagcaatt 568

                                                                       
Query: 245 gcaggcaggccacaggagtcagaaaccagaagactcacccagggagagagagaaagtcgg 304
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 567 gcaggcaggccacaggagtcagaaaccagaagactcacccagggagagagagaaagtcgg 508

                                                                       
Query: 305 tactagtggtttgagcactggtggaagaaagcagtctccatccttccagaaagctctgaa 364
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 507 tactagtggtttgagcactggtggaagaaagcagtctccatccttccagaaagctctgaa 448

                                                                       
Query: 365 gagtccttaggactgaaacaaagacaaaagactgacacattgattcacagactttagctc 424
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 447 gagtccttaggactgaaacaaagacaaaagactgacacattgattcacagactttagctc 388

                                                                       
Query: 425 acacattcccacgtatagtcatatatttttgagttgtatgtgctaaaacaaccagtaact 484
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 387 acacattcccacgtatagtcatatatttttgagttgtatgtgctaaaacaaccagtaact 328

                                                                       
Query: 485 actttatcagtgtctaacatcctcctggcagagaaaactcaggacaagaagccaaagcta 544
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 327 actttatcagtgtctaacatcctcctggcagagaaaactcaggacaagaagccaaagcta 268

                                                                       
Query: 545 caagacgctgaatccagaccatacatacacccattggtgagatgctaaatgaagttggct 604
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 267 caagacgctgaatccagaccatacatacacccattggtgagatgctaaatgaagttggct 208

              
Query: 605 aag 607
           |||
Sbjct: 207 aag 205


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 30
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 607
Length of database: 1007
Length adjustment: 10
Effective length of query: 597
Effective length of database: 997
Effective search space:   595209
Effective search space used:   595209
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

Query= MSMg01no418_d04.g1 MSMg01no418_d04.g1 CHROMAT_FILE:
MSMg01no418_d04.g1 PHD_FILE: MSMg01no418_d04.g1.phd.1 CHEM: term DYE:
big TIME: Wed May 18 18:37:20 2005
         (552 letters)



>mm_chr6_135673092_135674043
          Length = 952

 Score = 1060 bits (548), Expect = 0.0
 Identities = 551/552 (99%)
 Strand = Plus / Plus

                                                                       
Query: 1   ttctggatcaagtcattaaaattctgacgtgttctcacttgagatgtgcatgtcagaggt 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 201 ttctggatcaagtcattaaaattctgacgtgttctcacttgagatgtgcatgtcagaggt 260

                                                                       
Query: 61  aatgtgtttaataacctcagtgccataaagcctcagaaagggcaagaaaagaaagtcatc 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 261 aatgtgtttaataacctcagtgccataaagcctcagaaagggcaagaaaagaaagtcatc 320

                                                                       
Query: 121 aagccaaggggagaagcagaacaaatagcccctgaccccgggtctgggccacctggttac 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 321 aagccaaggggagaagcagaacaaatagcccctgaccccgggtctgggccacctggttac 380

                                                                       
Query: 181 aaaggtggcaacttccagcactcagtgcaatcctattggatcacaaatcctattgagact 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 381 aaaggtggcaacttccagcactcagtgcaatcctattggatcacaaatcctattgagact 440

                                                                       
Query: 241 cacaatgctgagtggttagtgagcttatcttgtaacaagggtccaaataactcaaactgt 300
           ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 441 cacaaagctgagtggttagtgagcttatcttgtaacaagggtccaaataactcaaactgt 500

                                                                       
Query: 301 ctaactcttgaaacaaagacctgtcaatcccagcatagatcatactgtgctcactcagga 360
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 501 ctaactcttgaaacaaagacctgtcaatcccagcatagatcatactgtgctcactcagga 560

                                                                       
Query: 361 cagtgacatgtcccgacatcagctctactcacctcccatttgatcaacattcttcgaagt 420
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 561 cagtgacatgtcccgacatcagctctactcacctcccatttgatcaacattcttcgaagt 620

                                                                       
Query: 421 ctaatcttctgacatttattttgtgcacaaccatcactgcagagacacattaataaccat 480
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 621 ctaatcttctgacatttattttgtgcacaaccatcactgcagagacacattaataaccat 680

                                                                       
Query: 481 gaagtagccaaagaagaaggacttcagagaatgaagcatgacttggagaaatacacattt 540
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 681 gaagtagccaaagaagaaggacttcagagaatgaagcatgacttggagaaatacacattt 740

                       
Query: 541 ccactggaaata 552
           ||||||||||||
Sbjct: 741 ccactggaaata 752


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 26
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 552
Length of database: 952
Length adjustment: 10
Effective length of query: 542
Effective length of database: 942
Effective search space:   510564
Effective search space used:   510564
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information