MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-056K16
Chromosome	7 (Build37)
Map Location	39,188,008 - 39,188,768
singlet/doublet	singlet
Overlap gene	1700010N08Rik, EG627975
Upstream gene	Zfp536, LOC100043453, EG627844, C80913, Ccne1, 1600014C10Rik, Plekhf1, Pop4, LOC668519, LOC100043464
Downstream gene	EG625594, EG627983, EG434171, LOC100043467
Link	Open Mouse BAC browser

Click to get alignment info.

name	Zfp536 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243937 MGI:1926102
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043453 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043453
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	EG627844 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627844 MGI:3643334
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	C80913 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19777 MGI:1342294
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccne1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12447 MGI:88316
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1600014C10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72244 MGI:1919494
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Plekhf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72287 MGI:1919537
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pop4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66161 MGI:1913411
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668519 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668519
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 5 Proteins pseudo : _no_value

name	LOC100043464 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043464
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	1700010N08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545951 MGI:1916590
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs

name	EG627975 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627975 MGI:3645331
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins

name	EG625594 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:625594 MGI:3644762
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 7 Proteins

name	EG627983 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627983 MGI:3647711
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	EG434171 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434171 MGI:3648692
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043467 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043467
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 7 Proteins

name	Zfp536 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801793 GeneID:243937 MGI:1926102
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 536 transcript_id : NM_172385.2

name	LOC100043453 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256560 GeneID:100043453
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100043453 transcript_id : XM_001480192.1

name	EG627844 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82905210 GeneID:627844 MGI:3643334
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG627844 transcript_id : XM_892546.1

name	C80913 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385360 GeneID:19777 MGI:1342294
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence C80913 transcript_id : NM_011274.4

name	Ccne1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110227585 GeneID:12447 MGI:88316
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin E1 transcript_id : NM_007633.2

name	1600014C10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31541829 GeneID:72244 MGI:1919494
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1600014C10 gene transcript_id : NM_028166.2

name	Plekhf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21313555 GeneID:72287 MGI:1919537
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pleckstrin homology domain containing, family F (with FYVE domain) member 1 transcript_id : NM_024413.1

name	Pop4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801298 GeneID:66161 MGI:1913411
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : processing of precursor 4, ribonuclease P/MRP family, (S. cerevisiae) transcript_id : NM_025390.3

name	1700010N08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256737 GeneID:545951 MGI:1916590
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : RIKEN cDNA 1700010N08 gene, transcript variant 2 transcript_id : XM_001481159.1

name	EG627975 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256564 GeneID:627975 MGI:3645331
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins product : predicted gene, EG627975 transcript_id : XM_892685.3

name	1700010N08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256735 GeneID:545951 MGI:1916590
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs product : RIKEN cDNA 1700010N08 gene, transcript variant 1 transcript_id : XM_001481158.1

name	EG625594 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380192 GeneID:625594 MGI:3644762
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 7 Proteins product : predicted gene, EG625594, transcript variant 1 transcript_id : XM_893307.2

name	EG434171 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802383 GeneID:434171 MGI:3648692
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG434171 transcript_id : NM_001013810.2

name	LOC100043467 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256566 GeneID:100043467
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 7 Proteins product : hypothetical protein LOC100043467 transcript_id : XM_001480228.1

name	Zfp536 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369509 CCDS:CCDS21156.1 GeneID:243937 MGI:1926102
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger protein 536 protein_id : NP_759017.1

name	LOC100043453 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256561 GeneID:100043453
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480242.1

name	EG627844 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82905211 GeneID:627844 MGI:3643334
definition	codon_start : 1 product : similar to major ampullate spidroin protein_id : XP_897639.1

name	C80913 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83649729 CCDS:CCDS21157.1 GeneID:19777 MGI:1342294
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : RPB5-mediating protein product : expressed sequence C80913 protein_id : NP_035404.3

name	Ccne1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110227586 GeneID:12447 MGI:88316
definition	GO_component : GO:0000307 - cyclin-dependent protein kinase holoenzyme complex [Evidence IPI]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0016538 - cyclin-dependent protein kinase regulator activity [Evidence IEA] [Evidence IDA]; GO:0016301 - kinase activity [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0006270 - DNA replication initiation [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IDA]; GO:0000074 - regulation of progression through cell cycle [Evidence IDA] codon_start : 1 product : cyclin E1 protein_id : NP_031659.2

name	1600014C10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312338 GeneID:72244 MGI:1919494
definition	codon_start : 1 exception : unclassified translation discrepancy product : hypothetical protein LOC72244 protein_id : NP_082442.1

name	Plekhf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313556 CCDS:CCDS21158.1 GeneID:72287 MGI:1919537
definition	GO_component : GO:0005764 - lysosome [Evidence IDA] GO_process : GO:0006917 - induction of apoptosis [Evidence IDA]; GO:0046902 - regulation of mitochondrial membrane permeability [Evidence ISS] codon_start : 1 exception : mismatches in translation product : pleckstrin homology domain containing, family F (with FYVE domain) member 1 protein_id : NP_077724.1

name	Pop4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384772 GeneID:66161 MGI:1913411
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0030681 - ribonuclease P complex (sensu Archaea) [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004540 - ribonuclease activity [Evidence IEA]; GO:0004526 - ribonuclease P activity [Evidence IEA] GO_process : GO:0008033 - tRNA processing [Evidence IEA] codon_start : 1 product : POP4 (processing of precursor , S. cerevisiae) homolog protein_id : NP_079666.1

name	EG627975 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256565 GeneID:627975 MGI:3645331
definition	codon_start : 1 product : hypothetical protein protein_id : XP_897778.3

name	1700010N08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256738 GeneID:545951 MGI:1916590
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001481209.1

name	1700010N08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256736 GeneID:545951 MGI:1916590
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001481208.1

name	EG625594 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82904987 GeneID:625594 MGI:3644762
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_898400.1

name	EG434171 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701500 GeneID:434171 MGI:3648692
definition	codon_start : 1 product : hypothetical protein LOC434171 protein_id : NP_001013832.1

name	LOC100043467 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256567 GeneID:100043467
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480278.1

name	LOC100043464 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043464
definition	number : 3 pseudo : _no_value

name	LOC100043464 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043464
definition	number : 2 pseudo : _no_value

name	LOC100043464 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043464
definition	number : 1 pseudo : _no_value

name	EG627983 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627983
definition	number : 2 pseudo : _no_value

name	EG627983 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627983
definition	number : 1 pseudo : _no_value

name	LOC668519 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256734 GeneID:668519
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 5 Proteins product : hypothetical LOC668519 pseudo : _no_value transcript_id : XR_035023.1

clone name	MSMg01-059P08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-476H05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-190D11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-329E18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-237G06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351N02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-393A08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-329O24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-530B08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-073M22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-322J15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-478O01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-340J05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-394I21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-322I15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-325K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429G12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-166B12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-155B21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-120P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-457H13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-117C16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-275B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-074D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-446C21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-535O11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-534L22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-115K17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-106F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-097G15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-519L12
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-206E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332A03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-018A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073E16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228K09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149B20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263N04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-200A07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056K16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027L24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-347N23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098N19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206C04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081J06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-337E22
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-056K16.b	B6Ng01-056K16.g
ACC	DH878756	DH878757
length	789	764
definition	DH878756\|Mus musculus domesticus DNA, BAC clone: B6Ng01-056K16, 5' end.	DH878757\|Mus musculus domesticus DNA, BAC clone: B6Ng01-056K16, 3' end.
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattctttacatattttagatgtaataagagaaatatagatatgtagat atattcctccctagtatattgggttggtaaagatcttttcccattctgta ggcttctcaacaaagaaatcctaatggccaagaagcacttaaagaaactt tcaatgtccttagtcatcagctgcaaatcaaaaccactctgactcaagtg acaacacatgctgtcgagggtgtagaacaaggggaacactcgttccttgc tggtgagagtggatactagtacaaacacttgagaaattaatttggtggtt tctcagaaaattgggaagagttctaacctcaagacccaactatactactc ctgggcatatacccaaaaatgctccactatatcacatgtacacttgttca cctatgctcatagcaacgttactcataatatccagacactgggaatgacc tagatgtccctcaaatgaagaatgaatagagaaaatgtggtacatttaaa aatgaaattctactcagctattaaaaacaaagacatcatgaaagttgcag gtaaatgtatagaactaggaacttccatcttgaatgaggtgacccagaga cagaaagatacacatggtatcacttctaagtaaatattagccacaaagta caggataatcatgctgaaatccacagaaccagagaaacttggaaataaga aggacccaagggaggatgtggagtctcactcaaaagtggaattaaaatag aattcagatgtggatggagggaggagatttgggtaggag	gaattcctaattgatctcattcaacttttgctccaatctaggcacagtcc ttctttgtcctggcttgtcttgctcccatacctatgatactatctcgtta ctctgtcccagagcagaaatgtttagaggcaagagagccatagacagctt aggcctcttgctttgcagtgtcctatgcagatctcactctctgtagagag acagggtctctctaatatatacagatggacctgggtctgcctatggagtg ctgctctcttaagtgagtgccagctccaccaggattgtctagattgtcta tattctatgattaaaaattaatggctgggcagtggtgtcacatgccttta agcccagggcttgggaggcaaaggcaggaggatttctgagttccaggtca gcctggtctccagagtgagttccaatacagtccaggctacacagagaaac cctgtcttgaaaaaacaaaagaaggaaggaaggaagaaaggaaggaagga aggaaggaaagaaagaaagaaagaaagaaagaaagaaagtttgcaacccc attggaagaacaatgtcaaacaaccagagcttccaggttctaaaccacca accaaggagtacacatggagggattcatggctcctactgcatattttagc agaggatggccttgtcaggcatcaatgggagaagaggccctttggtccca tgaaatctcagtgccccagtaaaggagaatgcaagggtataggagtgggt tgggtagttggggc
quality values	Open. Hide. 57 42 17 30 53 40 43 57 47 42 30 21 61 45 61 61 61 47 43 43 50 43 43 52 50 50 43 15 9 9 12 14 7 5 7 6 21 10 8 12 29 34 50 47 49 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 13 13 12 13 12 9 12 12 18 35 35 41 59 59 61 61 61 59 59 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 49 41 28 30 26 28 43 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 59 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 55 55 55 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 55 50 55 52 49 43 50 55 61 55 55 61 61 61 55 55 55 61 55 55 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 47 61 61 61 61 61 61 61 61 61 61 61 61 47 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 50 61 61 57 53 42 40 53 53 57 57 57 53 53 57 47 57 57 57 57 57 57 57 53 53 43 53 53 57 57 57 57 52 43 57 53 53 46 45 57 47 47 57 47 34 42 57 53 57 47 47 53 57 57 53 57 47 32 53 53 45 53 50 57 57 57 53 57 53 53 50 52 57 57 57 53 53 53 34 36 53 57 48 45 50 52 45 30 12 22 15 21 28 38 41 57 53 50 43 50 38 50 53 52 32 57 35 47 53 50 53 57 45 53 53 57 46 33 53 40 45 42 52 45 53 57 50 45 46 37 39 57 39 53 57 38 50 50 40 53 52 53 57 33 36 38 57 28 57 41 27 50 35 21 17 22 19 37 50 57 53 37 24 53 37 24 38 28 50 27 38 24 37 44 48 42 34 38 52 37 18 53 57 44 28 24 52 48 37 33 25 40 22 57 57 33 36 39 18 25 21 9 13 27 32 8 47 29 37 37 37 14 38 29 53 53 30 15 57 53 35 24 37 46 25 25 8 57 6 15 38 40 22 27 19 37 16 10	Open. Hide. 61 61 41 49 61 61 13 18 18 12 18 19 16 14 12 12 26 23 40 61 61 59 59 61 61 61 61 61 61 61 61 61 61 59 43 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 52 43 43 52 59 59 59 59 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 52 55 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 47 49 61 61 55 50 55 55 33 55 50 55 55 47 55 61 61 61 61 55 55 61 61 61 55 55 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 47 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 50 61 61 61 61 61 61 61 61 33 61 61 61 52 61 53 53 53 61 61 53 47 61 61 61 61 61 61 47 43 47 47 42 39 53 47 47 47 42 53 42 47 42 47 38 42 30 47 35 38 38 47 32 45 38 47 32 39 32 46 47 47 47 57 47 47 42 47 57 57 57 53 53 53 53 57 57 57 38 57 57 57 53 57 47 30 57 39 47 45 53 57 42 37 53 53 53 57 50 50 53 57 52 53 53 47 53 53 53 52 53 46 47 39 52 38 57 52 53 53 52 42 38 47 39 47 25 33 53 52 34 45 43 53 57 53 32 52 50 50 38 53 42 52 53 57 52 37 57 57 37 27 53 38 23 50 57 57 38 53 45 53 50 50 53 53 53 53 45 50 35 23 57 57 27 36 42 37 31 24 57 14 47 52 32 39 37 19 39 50 39 53 40 38 28 26 41 18 37 47 42 42 37 50 53 53 47 46 32 53 38 26 34 12 37 24 53 26 9 41 13 34 27 23 45 52 52 30 40 40 57 57 27 31 44 40 33 31 32 40 40 15 53 53 36 33 35 40 48 57 47 18 53 41 14 53 33 26 29 27 19 29 30 57 40 27 27 33 33 24 38 35 12 37 53 33 53 9 6 51 47 30 28 29 20 9 19 27 47 44 22 8

Alignment Information

BAC End 1

BAC End 2

seq1: chr7_39188008_39188768
seq2: B6Ng01-056K16.g_70_833

seq1  GAATTCCTAATTGATCTCATTCAACTTTTGCTCCAATCTAGGCACAGTCC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCTAATTGATCTCATTCAACTTTTGCTCCAATCTAGGCACAGTCC  50

seq1  TTCTTTGTCCTGGCTTGTCTTGCTCCCATACCTATGATACTATCTCGTTA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTTTGTCCTGGCTTGTCTTGCTCCCATACCTATGATACTATCTCGTTA  100

seq1  CTCTGTCCCAGAGCAGAAATGTTTAGAGGCAAGAGAGCCATAGACAGCTT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTGTCCCAGAGCAGAAATGTTTAGAGGCAAGAGAGCCATAGACAGCTT  150

seq1  AGGCCTCTTGCTTTGCAGTGTCCTATGCAGATCTCACTCTCTGTAGAGAG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGCCTCTTGCTTTGCAGTGTCCTATGCAGATCTCACTCTCTGTAGAGAG  200

seq1  ACAGGGTCTCTCTAATATATACAGATGGACCTGGGTCTGCCTATGGAGTG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGGGTCTCTCTAATATATACAGATGGACCTGGGTCTGCCTATGGAGTG  250

seq1  CTGCTCTCTTAAGTGAGTGCCAGCTCCACCAGGATTGTCTAGATTGTCTA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGCTCTCTTAAGTGAGTGCCAGCTCCACCAGGATTGTCTAGATTGTCTA  300

seq1  TATTCTATGATTAAAAATTAATGGCTGGGCAGTGGTGTCACATGCCTTTA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTCTATGATTAAAAATTAATGGCTGGGCAGTGGTGTCACATGCCTTTA  350

seq1  AGCCCAGGGCTTGGGAGGCAAAGGCAGGAGGATTTCTGAGTTCCAGGTCA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCCCAGGGCTTGGGAGGCAAAGGCAGGAGGATTTCTGAGTTCCAGGTCA  400

seq1  GCCTGGTCTCCAGAGTGAGTTCCAATACAGTCCAGGCTACACAGAGAAAC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCTGGTCTCCAGAGTGAGTTCCAATACAGTCCAGGCTACACAGAGAAAC  450

seq1  CCTGTCTTGAAAAAACAAAAGAAGGAAGGAAGGAAGAAAGGAAGGAAGGA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGTCTTGAAAAAACAAAAGAAGGAAGGAAGGAAGAAAGGAAGGAAGGA  500

seq1  AGGAAGGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGTTTGCAACCCC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGAAGGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGTTTGCAACCCC  550

seq1  ATTGGAAGAACAATGTCAAACAACCAGAGCTTCCAGGTTCTAAACCACCA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTGGAAGAACAATGTCAAACAACCAGAGCTTCCAGGTTCTAAACCACCA  600

seq1  ACCAAGGAGTACACATGGAGGGATTCATGGCTCCTACTGCATA-TTTAGC  649
      ||||||||||||||||||||||||||||||||||||||||||| ||||||
seq2  ACCAAGGAGTACACATGGAGGGATTCATGGCTCCTACTGCATATTTTAGC  650

seq1  AGAGGATGGCCTTGTCAGGCATCAATGGGAGAAGAGGCCC-TTGGTCCCA  698
      |||||||||||||||||||||||||||||||||||||||| |||||||||
seq2  AGAGGATGGCCTTGTCAGGCATCAATGGGAGAAGAGGCCCTTTGGTCCCA  700

seq1  TGAAATCTCAGTGCCCCAGTAAAGGAGAATGCAAGGGTATAGGAGTGGG-  747
      ||||||||||||||||||||||||||||||||||||||||||||||||| 
seq2  TGAAATCTCAGTGCCCCAGTAAAGGAGAATGCAAGGGTATAGGAGTGGGT  750

seq1  TGGGTAGTTGGGGC  761
      ||||||||||||||
seq2  TGGGTAGTTGGGGC  764

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information