MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-131L08
Chromosome	7 (Build37)
Map Location	113,567,290 - 113,568,149
singlet/doublet	singlet
Overlap gene	EG209380
Upstream gene	EG244189, Cckbr, Prkcdbp, Smpd1, Apbb1, Hpxn, Trim3, Arfip2, Fxc1, Dnhd1, LOC100042811, LOC672646, 1500003O22Rik, Ilk, Taf10, Tpp1, Dchs1, Mrpl17, 9130208D14Rik, LOC626055, LOC100042856, LOC100042047, EG668108, EG668117, Gvin1, LOC672660, LOC100042097, LOC668128, LOC634394
Downstream gene	EG668139, Gm1966, LOC100042141, Olfr693, Olfr694, Olfr695, Olfr696-ps1, Olfr697, Olfr698, Olfr699, Olfr700, Olfr701, Olfr702, Olfr703, Olfr704, Olfr705, Olfr706, Olfr707, Olfr708, Olfr709-ps1, Olfr710, LOC384651, Olfr6, Olfr711, GA_x5J8B7W6B6J-1784824-1783474, Olfr2, Olfr713, Olfr714, Olfr17, Olfr715, Olfr716, Nlrp14, LOC100042278, 1700012H05Rik, Syt9
Link	Open Mouse BAC browser

Click to get alignment info.

name	EG244189 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244189 MGI:3643689
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 23 ESTs, 3 Proteins pseudo : _no_value

name	Cckbr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12426 MGI:99479
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prkcdbp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109042 MGI:1923422
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Smpd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20597 MGI:98325
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Apbb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11785 MGI:107765
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hpxn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15458 MGI:105112
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trim3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:55992 MGI:1860040
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arfip2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76932 MGI:1924182
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fxc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14356 MGI:1315196
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dnhd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77505 MGI:1924755
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 10 ESTs, 1 Protein

name	LOC100042811 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042811
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 73 ESTs, 2 Proteins

name	LOC672646 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:672646
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 2 Proteins

name	1500003O22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:101867 MGI:1914251
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ilk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16202 MGI:1195267
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Taf10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:24075 MGI:1346320
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tpp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12751 MGI:1336194
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dchs1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233651 MGI:2685011
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 104 ESTs, 17 Proteins

name	Mrpl17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27397 MGI:1351608
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9130208D14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77700 MGI:1924950
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 27 ESTs, 3 Proteins

name	LOC626055 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626055
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 8 Proteins pseudo : _no_value

name	LOC100042856 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042856
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 113 ESTs, 4 Proteins

name	LOC100042047 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042047
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	EG668108 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668108 MGI:3703149
definition	note : predicted gene, EG668108 pseudo : _no_value

name	EG668117 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668117 MGI:3644465
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 8 Proteins pseudo : _no_value

name	Gvin1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74558 MGI:1921808
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC672660 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:672660
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs

name	LOC100042097 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042097
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC668128 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668128
definition	note : very large inducible GTPase 1 pseudogene pseudo : _no_value

name	LOC634394 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:634394
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 ESTs, 3 Proteins pseudo : _no_value

name	EG209380 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209380 MGI:3647753
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG668139 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668139 MGI:3644223
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 48 ESTs, 3 Proteins

name	Gm1966 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434223 MGI:3584360
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 30 ESTs, 3 Proteins

name	LOC100042141 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042141
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Olfr693 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258445 MGI:3030527
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr694 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258444 MGI:3030528
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr695 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258591 MGI:3030529
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr696-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404416 MGI:3030530
definition	note : olfactory receptor 696, pseudogene 1 pseudo : _no_value

name	Olfr697 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258592 MGI:3030531
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr698 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258595 MGI:3030532
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr699 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258180 MGI:3030533
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr700 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258593 MGI:3030534
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr701 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66786 MGI:3030535
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr702 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258590 MGI:3030536
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr703 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258589 MGI:3030537
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr704 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257902 MGI:3030538
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr705 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259034 MGI:3030539
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr706 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258350 MGI:3030540
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr707 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:194433 MGI:3030541
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr708 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258173 MGI:3030542
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr709-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258146 MGI:3030543
definition	gene_synonym : MOR260-7 note : olfactory receptor 709, pseudogene 1 pseudo : _no_value

name	Olfr710 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258594 MGI:3030544
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC384651 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:384651
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	Olfr6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233670 MGI:104713
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr711 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259037 MGI:3030545
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W6B6J-1784824-1783474 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257721
definition	note : olfactory receptor GA_x5J8B7W6B6J-1784824-1783474 pseudo : _no_value

name	Olfr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18317 MGI:97432
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr713 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259036 MGI:3030547
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr714 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259035 MGI:3030548
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18314 MGI:109148
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr715 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258776 MGI:3030549
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr716 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258597 MGI:3030550
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nlrp14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76858 MGI:1924108
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042278 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042278
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	1700012H05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76572 MGI:1923822
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Syt9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:60510 MGI:1926373
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cckbr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349437 GeneID:12426 MGI:99479
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cholecystokinin B receptor transcript_id : NM_007627.3

name	Prkcdbp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22324937 GeneID:109042 MGI:1923422
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein kinase C, delta binding protein transcript_id : NM_028444.1

name	Smpd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755581 GeneID:20597 MGI:98325
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sphingomyelin phosphodiesterase 1, acid lysosomal transcript_id : NM_011421.1

name	Apbb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142363757 GeneID:11785 MGI:107765
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : amyloid beta (A4) precursor protein-binding, family B, member 1 transcript_id : NM_009685.2

name	Hpxn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23956085 GeneID:15458 MGI:105112
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hemopexin transcript_id : NM_017371.1

name	Trim3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83921616 GeneID:55992 MGI:1860040
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tripartite motif protein 3 transcript_id : NM_018880.2

name	Arfip2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803130 GeneID:76932 MGI:1924182
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ADP-ribosylation factor interacting protein 2 transcript_id : NM_029802.3

name	Fxc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982715 GeneID:14356 MGI:1315196
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fractured callus expressed transcript 1 transcript_id : NM_019502.2

name	Dnhd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257641 GeneID:77505 MGI:1924755
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 10 ESTs, 1 Protein product : dynein heavy chain domain 1 transcript_id : XM_908793.3

name	LOC100042811 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257683 GeneID:100042811
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 73 ESTs, 2 Proteins product : similar to mitochondrial ribosomal protein S36 transcript_id : XM_001478446.1

name	LOC672646 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257643 GeneID:672646
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 2 Proteins product : similar to dynein heavy chain domain 1 transcript_id : XM_001477292.1

name	1500003O22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20270197 GeneID:101867 MGI:1914251
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1500003O22 gene transcript_id : NM_025897.1

name	Ilk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754341 GeneID:16202 MGI:1195267
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : integrin linked kinase transcript_id : NM_010562.1

name	Taf10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46559395 GeneID:24075 MGI:1346320
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TAF10 RNA polymerase II, TATA box binding protein (TBP)-associated factor transcript_id : NM_020024.3

name	Tpp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368689 GeneID:12751 MGI:1336194
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tripeptidyl peptidase I transcript_id : NM_009906.3

name	Dchs1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257685 GeneID:233651 MGI:2685011
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 104 ESTs, 17 Proteins product : dachsous 1 (Drosophila) transcript_id : XM_194371.8

name	Mrpl17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84875533 GeneID:27397 MGI:1351608
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein L17 transcript_id : NM_025301.2

name	9130208D14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380911 GeneID:77700 MGI:1924950
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 27 ESTs, 3 Proteins product : RIKEN cDNA 9130208D14 gene transcript_id : XM_620545.3

name	LOC100042856 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257691 GeneID:100042856
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 113 ESTs, 4 Proteins product : similar to very large inducible GTPase-1, transcript variant 2 transcript_id : XM_001478507.1

name	LOC100042856 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257689 GeneID:100042856
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 105 ESTs, 4 Proteins product : similar to very large inducible GTPase-1, transcript variant 1 transcript_id : XM_001478498.1

name	Gvin1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115270967 GeneID:74558 MGI:1921808
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GTPase, very large interferon inducible 1 transcript_id : NM_001039160.2

name	Gvin1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115270957 GeneID:74558 MGI:1921808
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GTPase, very large interferon inducible 1 transcript_id : NM_029000.3

name	LOC672660 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257693 GeneID:672660
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs product : similar to very large inducible GTPase 1 transcript_id : XM_001478554.1

name	EG209380 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802592 GeneID:209380 MGI:3647753
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG209380 transcript_id : NM_001001318.2

name	Gm1966 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257695 GeneID:434223 MGI:3584360
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 30 ESTs, 3 Proteins product : gene model 1966, (NCBI) transcript_id : XM_001478597.1

name	Gm1966 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380896 GeneID:434223 MGI:3584360
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 30 ESTs, 3 Proteins product : gene model 1966, (NCBI), transcript variant 2 transcript_id : XM_485982.3

name	Gm1966 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380897 GeneID:434223 MGI:3584360
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 30 ESTs, 3 Proteins product : gene model 1966, (NCBI), transcript variant 1 transcript_id : XM_001000891.1

name	Olfr693 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33238889 GeneID:258445 MGI:3030527
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 693 transcript_id : NM_146453.1

name	Olfr694 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33238883 GeneID:258444 MGI:3030528
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 694 transcript_id : NM_146452.1

name	Olfr695 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129452 GeneID:258591 MGI:3030529
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 695 transcript_id : NM_146598.1

name	Olfr697 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129454 GeneID:258592 MGI:3030531
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 697 transcript_id : NM_146599.1

name	Olfr698 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129450 GeneID:258595 MGI:3030532
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 698 transcript_id : NM_146602.1

name	Olfr699 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801485 GeneID:258180 MGI:3030533
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 699 transcript_id : NM_001011862.1

name	Olfr700 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129448 GeneID:258593 MGI:3030534
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 700 transcript_id : NM_146600.1

name	Olfr701 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368940 GeneID:66786 MGI:3030535
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 701 transcript_id : NM_028910.2

name	Olfr702 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129458 GeneID:258590 MGI:3030536
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 702 transcript_id : NM_146597.1

name	Olfr703 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129456 GeneID:258589 MGI:3030537
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 703 transcript_id : NM_146596.1

name	Olfr704 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801285 GeneID:257902 MGI:3030538
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 704 transcript_id : NM_001011749.1

name	Olfr705 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128880 GeneID:259034 MGI:3030539
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 705 transcript_id : NM_147032.1

name	Olfr706 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129596 GeneID:258350 MGI:3030540
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 706 transcript_id : NM_146353.1

name	Olfr707 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116174767 GeneID:194433 MGI:3030541
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 707 transcript_id : NM_001005570.2

name	Olfr708 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58531211 GeneID:258173 MGI:3030542
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 708 transcript_id : NM_001011542.1

name	Olfr710 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128640 GeneID:258594 MGI:3030544
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 710 transcript_id : NM_146601.1

name	Olfr6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46047479 GeneID:233670 MGI:104713
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 6 transcript_id : NM_206897.1

name	Olfr711 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128878 GeneID:259037 MGI:3030545
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 711 transcript_id : NM_147035.1

name	Olfr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7242164 GeneID:18317 MGI:97432
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 2 transcript_id : NM_010983.1

name	Olfr713 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128876 GeneID:259036 MGI:3030547
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 713 transcript_id : NM_147034.1

name	Olfr714 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128882 GeneID:259035 MGI:3030548
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 714 transcript_id : NM_147033.1

name	Olfr17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10181105 GeneID:18314 MGI:109148
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 17 transcript_id : NM_020598.1

name	Olfr715 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129286 GeneID:258776 MGI:3030549
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 715 transcript_id : NM_146780.1

name	Olfr716 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129444 GeneID:258597 MGI:3030550
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 716 transcript_id : NM_146604.1

name	Nlrp14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50872154 GeneID:76858 MGI:1924108
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NLR family, pyrin domain containing 14 transcript_id : NM_001002894.1

name	1700012H05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369862 GeneID:76572 MGI:1923822
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700012H05 gene transcript_id : NM_029660.2

name	Syt9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802850 GeneID:60510 MGI:1926373
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synaptotagmin IX transcript_id : NM_021889.3

name	Cckbr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7106265 CCDS:CCDS21651.1 GeneID:12426 MGI:99479
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0046935 - phosphatidylinositol 3-kinase regulator activity [Evidence ISS]; GO:0004435 - phosphoinositide phospholipase C activity [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0008283 - cell proliferation [Evidence ISS]; GO:0007586 - digestion [Evidence ISS]; GO:0007204 - elevation of cytosolic calcium ion concentration [Evidence ISS]; GO:0007631 - feeding behavior [Evidence ISS]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007202 - phospholipase C activation [Evidence ISS]; GO:0008284 - positive regulation of cell proliferation [Evidence ISS]; GO:0007600 - sensory perception [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : CCK2/gastrin receptor; CCK-B/gastrin receptor product : cholecystokinin B receptor protein_id : NP_031653.1

name	Prkcdbp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22324938 CCDS:CCDS21652.1 GeneID:109042 MGI:1923422
definition	GO_function : GO:0016301 - kinase activity [Evidence IEA] codon_start : 1 product : protein kinase C, delta binding protein protein_id : NP_082720.1

name	Smpd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755582 CCDS:CCDS21653.1 GeneID:20597 MGI:98325
definition	GO_component : GO:0005764 - lysosome [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016798 - hydrolase activity, acting on glycosyl bonds [Evidence IEA]; GO:0004767 - sphingomyelin phosphodiesterase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA]; GO:0006685 - sphingomyelin catabolism [Evidence IEA] codon_start : 1 note : acid sphingomyelinase product : sphingomyelin phosphodiesterase 1, acid lysosomal protein_id : NP_035551.1

name	Apbb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33468877 GeneID:11785 MGI:107765
definition	GO_component : GO:0030426 - growth cone [Evidence ISS]; GO:0030027 - lamellipodium [Evidence ISS]; GO:0005634 - nucleus [Evidence IDA] [Evidence ISS]; GO:0045202 - synapse [Evidence ISS] GO_function : GO:0001540 - beta-amyloid binding [Evidence ISS] [Evidence IDA]; GO:0035035 - histone acetyltransferase binding [Evidence ISS] [Evidence NAS]; GO:0005515 - protein binding [Evidence IPI]; GO:0008134 - transcription factor binding [Evidence ISS] [Evidence IDA] GO_process : GO:0030048 - actin filament-based movement [Evidence ISS] [Evidence NAS]; GO:0007411 - axon guidance [Evidence IGI]; GO:0007050 - cell cycle arrest [Evidence ISS] [Evidence IDA]; GO:0030198 - extracellular matrix organization and biogenesis [Evidence IGI]; GO:0030308 - negative regulation of cell growth [Evidence ISS] [Evidence IDA]; GO:0045749 - negative regulation of S phase of mitotic cell cycle [Evidence ISS] [Evidence IDA]; GO:0050760 - negative regulation of thymidylate synthase biosynthesis [Evidence ISS] [Evidence IDA]; GO:0001764 - neuron migration [Evidence IGI]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IGI]; GO:0050821 - protein stabilization [Evidence ISS] [Evidence NAS]; GO:0045449 - regulation of transcription [Evidence ISS] [Evidence IDA]; GO:0007165 - signal transduction [Evidence ISS]; GO:0008542 - visual learning [Evidence IMP] codon_start : 1 product : amyloid beta (A4) precursor protein-binding, family B, member 1 protein_id : NP_033815.1

name	Hpxn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956086 CCDS:CCDS21654.1 GeneID:15458 MGI:105112
definition	GO_function : GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hemopexin protein_id : NP_059067.1

name	Trim3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33468961 CCDS:CCDS21655.1 GeneID:55992 MGI:1860040
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : ring finger protein 22 product : tripartite motif protein 3 protein_id : NP_061368.1

name	Arfip2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981363 CCDS:CCDS21656.1 GeneID:76932 MGI:1924182
definition	codon_start : 1 exception : mismatches in translation note : Arfaptin 2; partner of RAC1 (arfaptin 2) product : ADP-ribosylation factor interacting protein 2 protein_id : NP_084078.2

name	Fxc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9507187 CCDS:CCDS21657.1 GeneID:14356 MGI:1315196
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0042719 - mitochondrial intermembrane space protein transporter complex [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045039 - protein import into mitochondrial inner membrane [Evidence IEA]; GO:0006605 - protein targeting [Evidence IEA]; GO:0006626 - protein targeting to mitochondrion [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : small zinc finger-like protein; Fracture Callus 1 product : fractured callus expressed transcript 1 protein_id : NP_062375.1

name	Dnhd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257642 GeneID:77505 MGI:1924755
definition	codon_start : 1 product : dynein heavy chain domain 1 protein_id : XP_913886.3

name	LOC100042811 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257684 GeneID:100042811
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478496.1

name	LOC672646 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257644 GeneID:672646
definition	codon_start : 1 product : similar to dynein heavy chain domain 1 protein_id : XP_001477342.1

name	1500003O22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20270198 CCDS:CCDS21658.1 GeneID:101867 MGI:1914251
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 product : hypothetical protein LOC101867 protein_id : NP_080173.1

name	Ilk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754342 CCDS:CCDS21659.1 GeneID:16202 MGI:1195267
definition	GO_component : GO:0005925 - focal adhesion [Evidence ISS] [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] [Evidence ISS]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence ISS] [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0045197 - establishment and/or maintenance of epithelial cell polarity [Evidence IMP]; GO:0007229 - integrin-mediated signaling pathway [Evidence ISS]; GO:0008284 - positive regulation of cell proliferation [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0001658 - ureteric bud branching [Evidence IDA] codon_start : 1 exception : mismatches in translation product : integrin linked kinase protein_id : NP_034692.1

name	Taf10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46518499 CCDS:CCDS21660.1 GeneID:24075 MGI:1346320
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005669 - transcription factor TFIID complex [Evidence TAS] [Evidence ISS] GO_function : GO:0003702 - RNA polymerase II transcription factor activity [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence TAS] GO_process : GO:0006915 - apoptosis [Evidence IMP]; GO:0000082 - G1/S transition of mitotic cell cycle [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006352 - transcription initiation [Evidence IEA] codon_start : 1 note : TATA box binding protein (TBP)-associated factor, RNA polymerase II, H, 30 kDa; TAF10 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 30 kDa product : TAF10 RNA polymerase II, TATA box binding protein (TBP)-associated factor protein_id : NP_064408.2

name	Tpp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753448 CCDS:CCDS21661.1 GeneID:12751 MGI:1336194
definition	GO_component : GO:0005764 - lysosome [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IDA] [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA]; GO:0004289 - subtilase activity [Evidence IEA]; GO:0019131 - tripeptidyl-peptidase I activity [Evidence IMP] [Evidence IEA] GO_process : GO:0007040 - lysosome organization and biogenesis [Evidence IMP]; GO:0006508 - proteolysis [Evidence IC] [Evidence IEA]; GO:0050885 - regulation of balance [Evidence IMP] codon_start : 1 note : tripeptidyl peptidase-I; ceroid-lipofuscinosis, neuronal 2 product : tripeptidyl-peptidase I protein_id : NP_034036.1

name	Dchs1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257686 GeneID:233651 MGI:2685011
definition	codon_start : 1 product : dachsous 1 protein_id : XP_194371.7

name	Mrpl17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384658 CCDS:CCDS21662.1 GeneID:27397 MGI:1351608
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005762 - mitochondrial large ribosomal subunit [Evidence ISS]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence ISS] [Evidence IEA] GO_process : GO:0000002 - mitochondrial genome maintenance [Evidence TAS]; GO:0006412 - protein biosynthesis [Evidence ISS] [Evidence IEA] codon_start : 1 note : ribosomal protein, mitochondrial, L26 product : mitochondrial ribosomal protein L17 protein_id : NP_079577.1

name	9130208D14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63561913 GeneID:77700 MGI:1924950
definition	codon_start : 1 product : hypothetical protein LOC77700 protein_id : XP_620545.1

name	LOC100042856 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257690 GeneID:100042856
definition	codon_start : 1 product : similar to very large inducible GTPase-1 isoform 1 protein_id : XP_001478548.1

name	LOC100042856 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257692 GeneID:100042856
definition	codon_start : 1 product : similar to very large inducible GTPase-1 isoform 2 protein_id : XP_001478557.1

name	Gvin1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115270968 CCDS:CCDS21663.1 GeneID:74558 MGI:1921808
definition	codon_start : 1 note : interferon inducible GTPase 1 product : very large inducible GTPase 1 protein_id : NP_001034249.2

name	Gvin1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115270958 CCDS:CCDS21663.1 GeneID:74558 MGI:1921808
definition	codon_start : 1 note : interferon inducible GTPase 1 product : very large inducible GTPase 1 protein_id : NP_083276.2

name	LOC672660 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257694 GeneID:672660
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478604.1

name	EG209380 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47604974 GeneID:209380 MGI:3647753
definition	codon_start : 1 product : hypothetical protein LOC209380 protein_id : NP_001001318.1

name	Gm1966 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257696 GeneID:434223 MGI:3584360
definition	codon_start : 1 product : hypothetical protein LOC434223 protein_id : XP_001478647.1

name	Gm1966 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94380898 GeneID:434223 MGI:3584360
definition	codon_start : 1 product : hypothetical protein LOC434223 isoform 1 protein_id : XP_001000891.1

name	Gm1966 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82907383 GeneID:434223 MGI:3584360
definition	codon_start : 1 product : hypothetical protein LOC434223 isoform 2 protein_id : XP_485982.2

name	Olfr693 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33238890 CCDS:CCDS21665.1 GeneID:258445 MGI:3030527
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-9055944-9054994; olfactory receptor MOR283-8 product : olfactory receptor 693 protein_id : NP_666664.1

name	Olfr694 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33238884 CCDS:CCDS21666.1 GeneID:258444 MGI:3030528
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-9067220-9066273; olfactory receptor MOR283-9 product : olfactory receptor 694 protein_id : NP_666663.1

name	Olfr695 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129453 CCDS:CCDS21667.1 GeneID:258591 MGI:3030529
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-9092181-9091234; olfactory receptor MOR283-6 product : olfactory receptor 695 protein_id : NP_666809.1

name	Olfr697 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129455 CCDS:CCDS21668.1 GeneID:258592 MGI:3030531
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-9119301-9118348; olfactory receptor MOR283-5 product : olfactory receptor 697 protein_id : NP_666810.1

name	Olfr698 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129451 CCDS:CCDS21669.1 GeneID:258595 MGI:3030532
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-9130754-9129519; olfactory receptor MOR283-3 product : olfactory receptor 698 protein_id : NP_666813.1

name	Olfr699 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801486 CCDS:CCDS21670.1 GeneID:258180 MGI:3030533
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-9168355-9167405; olfactory receptor MOR283-10P product : olfactory receptor 699 protein_id : NP_001011862.1

name	Olfr700 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129449 CCDS:CCDS21671.1 GeneID:258593 MGI:3030534
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-9184187-9183237; olfactory receptor MOR283-4 product : olfactory receptor 700 protein_id : NP_666811.1

name	Olfr701 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312710 CCDS:CCDS21672.1 GeneID:66786 MGI:3030535
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS] GO_function : GO:0004984 - olfactory receptor activity [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-9195805-9196755; olfactory receptor MOR283-1 product : olfactory receptor 701 protein_id : NP_083186.1

name	Olfr702 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129459 CCDS:CCDS21673.1 GeneID:258590 MGI:3030536
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-9202245-9201289; olfactory receptor MOR260-4; B7 olfactory receptor product : olfactory receptor 702 protein_id : NP_666808.1

name	Olfr703 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129457 CCDS:CCDS21674.1 GeneID:258589 MGI:3030537
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-9222217-9223176; olfactory receptor MOR283-7; T4 olfactory receptor product : olfactory receptor 703 protein_id : NP_666807.1

name	Olfr704 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801286 CCDS:CCDS21675.1 GeneID:257902 MGI:3030538
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-9247095-9248042; olfactory receptor MOR283-12P; T3 olfactory receptor product : olfactory receptor 704 protein_id : NP_001011749.1

name	Olfr705 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128881 CCDS:CCDS21676.1 GeneID:259034 MGI:3030539
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-9256348-9255398; olfactory receptor MOR283-2; T2 olfactory receptor product : olfactory receptor 705 protein_id : NP_667243.1

name	Olfr706 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129597 CCDS:CCDS21677.1 GeneID:258350 MGI:3030540
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-9271198-9270248; olfactory receptor MOR283-11; T1 olfactory receptor product : olfactory receptor 706 protein_id : NP_666465.1

name	Olfr707 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116174768 CCDS:CCDS21678.1 GeneID:194433 MGI:3030541
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-9276470-9275547; olfactory receptor MOR260-8P; B6 olfactory receptor; B4 olfactory receptor product : olfactory receptor 707 protein_id : NP_001005570.2

name	Olfr708 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58531212 CCDS:CCDS21679.1 GeneID:258173 MGI:3030542
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-9297671-9298594; olfactory receptor MOR260-6P; B5 olfactory receptor product : olfactory receptor 708 protein_id : NP_001011542.1

name	Olfr710 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128641 CCDS:CCDS21680.1 GeneID:258594 MGI:3030544
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-9325348-9324416; olfactory receptor MOR260-3; B3 olfactory receptor product : olfactory receptor 710 protein_id : NP_666812.1

name	Olfr6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46047480 CCDS:CCDS21681.1 GeneID:233670 MGI:104713
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-9337331-9336381; m50 olfactory receptor product : olfactory receptor 6 protein_id : NP_996780.1

name	Olfr711 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128879 CCDS:CCDS21682.1 GeneID:259037 MGI:3030545
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-9352783-9351839; olfactory receptor MOR103-4; m51 olfactory receptor product : olfactory receptor 711 protein_id : NP_667246.1

name	Olfr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7242165 CCDS:CCDS21683.1 GeneID:18317 MGI:97432
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-9381439-9380456; I7 olfactory receptor; odorant receptor B2 product : olfactory receptor 41 protein_id : NP_035113.1

name	Olfr713 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128877 CCDS:CCDS21684.1 GeneID:259036 MGI:3030547
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-9415724-9416677; olfactory receptor MOR263-1; P3 olfactory receptor product : olfactory receptor 713 protein_id : NP_667245.1

name	Olfr714 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128883 GeneID:259035 MGI:3030548
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-9453401-9454354; olfactory receptor MOR263-2; P4 olfactory receptor product : olfactory receptor 714 protein_id : NP_667244.1

name	Olfr17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10181106 GeneID:18314 MGI:109148
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA] GO_function : GO:0004984 - olfactory receptor activity [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-9470146-9471093; olfactory receptor MOR263-5; P2 olfactory receptor product : olfactory receptor 17 protein_id : NP_065623.1

name	Olfr715 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129287 CCDS:CCDS21686.1 GeneID:258776 MGI:3030549
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-9479517-9478573; olfactory receptor MOR260-1; B2 olfactory receptor product : olfactory receptor 715 protein_id : NP_666991.1

name	Olfr716 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129445 CCDS:CCDS21687.1 GeneID:258597 MGI:3030550
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-9497411-9498355; olfactory receptor MOR260-2; B1 olfactory receptor product : olfactory receptor 716 protein_id : NP_666815.1

name	Nlrp14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50872155 CCDS:CCDS21688.1 GeneID:76858 MGI:1924108
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : germ-cell specific leucine rich repeat NTPase; RNI-like protein; NACHT, leucine rich repeat and PYD containing 14 product : NACHT, leucine rich repeat and PYD containing 14-like protein_id : NP_001002894.1

name	1700012H05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:65301143 CCDS:CCDS21689.1 GeneID:76572 MGI:1923822
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 product : testes-specific heterogenous nuclear ribonucleoprotein G-T protein_id : NP_083936.1

name	Syt9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543799 GeneID:60510 MGI:1926373
definition	GO_component : GO:0045202 - synapse [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 note : synaptotagmin V; synaptotagmin 9 product : synaptotagmin IX protein_id : NP_068689.2

name	LOC100042047 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042047
definition	number : 1 pseudo : _no_value

name	LOC100042097 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042097
definition	number : 1 pseudo : _no_value

name	LOC100042141 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042141
definition	number : 1 pseudo : _no_value

name	LOC384651 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:384651
definition	number : 1 pseudo : _no_value

name	LOC384651 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:384651
definition	number : 2 pseudo : _no_value

name	LOC100042278 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042278
definition	number : 1 pseudo : _no_value

name	EG244189 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149257640 GeneID:244189 MGI:3643689
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 23 ESTs, 3 Proteins product : predicted gene, EG244189 pseudo : _no_value transcript_id : XR_035686.1

name	LOC626055 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149257645 GeneID:626055
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 8 Proteins product : similar to Ornithine decarboxylase (ODC) pseudo : _no_value transcript_id : XR_033197.1

name	EG668117 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94380912 GeneID:668117 MGI:3644465
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 8 Proteins product : predicted gene, EG668117 pseudo : _no_value transcript_id : XR_002142.1

name	LOC634394 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149257646 GeneID:634394
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 ESTs, 3 Proteins product : similar to very large inducible GTPase 1 pseudo : _no_value transcript_id : XR_033283.1

name	EG668139 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94380919 GeneID:668139 MGI:3644223
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 48 ESTs, 3 Proteins product : predicted gene, EG668139 transcript_id : XR_001627.1

clone name	MSMg01-417P05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-484G21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-461L18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-359M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-065H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-506J04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-357I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-081L18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-269E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-235J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-444E04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-466B07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-360A10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-444I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-179J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-487E07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-186D04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-361G10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-313A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-155D04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-155E04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-376F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-361G03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-084G14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-078K21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-407N05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-487E07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-078K21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-478C15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-390B02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-465G13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-465M19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-486B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-065P02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-408E16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-438D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-406K23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-368D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-538O19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-315F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-325N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-152A03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536E23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-526N19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-406K16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-121K14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-129P22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-357H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-204J24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-533O14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-324P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-434G09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-514K16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-306B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-341B16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340P24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-507M05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-532A20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-495M06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-047N05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471I07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-479P17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-405K15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-054P16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-422G07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-118C06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-087C16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331A08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102M23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261J15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-282G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187F13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117J07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-314D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-044F10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123D24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093O08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157N20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150P18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316F06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313B04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-021K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189O02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-115K01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246K15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317P11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-021K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194F20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-051I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160O14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-050H19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-055B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227F10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009A04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068K17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-257P21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029H21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-168M15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116I06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-098H24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-059D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103N03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047D04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-338J05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134M14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302J12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-136N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-002G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078G20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-114I14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-167L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327L11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-270E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-204C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094O11
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-131L08.b	B6Ng01-131L08.g
ACC	DH932696	DH932697
length	1,175	862
definition	DH932696\|Mus musculus domesticus DNA, BAC clone: B6Ng01-131L08, 5' end.	DH932697\|Mus musculus domesticus DNA, BAC clone: B6Ng01-131L08, 3' end.
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattctgcctgttgtgaattctaatgtaggcttctaagatgatagtttc tatgtcaatgacatagcattcagatggatggagttctttctttagggtct aggatctctaaagcagaagctgacagagggacctctttaattttgaatca taaaagttgggcaggttgggagggacctagagaggatcatgaatatcttg gggtccaaatacaaacttaacttattagttctaaaaaagagagaaagtat catttggtctggaagcaggggaaatatgtcctgctctatagtttcacagc tttgatgtatgttggatgaagagagaggtgaagtaaatctatggtaagtt catgctgaaggaagctgatctttacaagggatatgatagttaatcttagt tgtctacttgactagatctggtatcacctaaaatataagctatggagcac acatgttggactctgtggtcagattatttgaagattgaaggcccacccaa aacatggtcaccacaacatgataaaagaaagacagagggtttctgtctgt gcccgaagctgatcctctgtctcagggctccatactcaactagcaacagg tgagagagaactagtctcccaggagtgcagacaagcctgtgagtgcaagt agaactaccactgctactcagatggaccctcccggaaccctcgggacaca ggacctaaggagcagcttgggatagaagccttctgttttccatctgcacc cagagctaatactgtaccacacctctttatacccaaattcctctcagaga gaactggtctcccaggagtactaacacagaggcttgcacacaaatacctt caagagagagctgctctcccaggacagctgaaatacctgcaagctcagga aataccaccacttctgttaaaatttgtgacccaagaggaccttcccagag catatgacacaggaatcaagtaacatctgggacaggatccctctggttct gtctgcaccccagtgctgaccctgtactacaactcttcatacccaaattc tccagagaaactgtctcaggagtactggacccgagctgcagagggacagc ccaatcaagaacagcagatgactactcaaagatacggacagtgtaaggca aggcaaaacattagccacagaaatc	gaattctttagcttccatcctttttccttgttcaggtccaaagaggaaga atttcttggggaccctgagaagctcttctctccttgccactaagtccttt tggtggcttataaatcccctgcagggccagccctccagatgctcatctta ccaggtctccatctgagaggtttggtctgtgagccagggtctgttccatg tgactgagatgtctctccattatttcagtgatgtcttttaggaacacttc agccattggccagcattcctcagggatctccattgcttgtctcagctctg cttcttttttcctcactgcctcttcctctctgtgcttcccttctgactga aaggccctcaaagcctgcagtgcctgtcctgcctgcctctgcctgctctt tatcatctcccctggagtctcctgcagctctgcaacactatttggctgtg agaggtccagcagcttctctagagcctttttctcccatgtgtgttgtgtc tgtgacttcagcttctggaggtctcttttgtccaaatattgcaaggcctg ggcagaggtcacacccaggtcttcctgaagcttaggcagccagtagtcaa cagacagtcccacgtcattcagcatctcctggagatcatgtcttcttctg cttctggactgaggcttgtcatgaaaattctctgctgtgttcatgactgt gtgaagaacaggcacttagttaaaatcttactcttcgtaagcatttattt ctttggccaatagaatgagtgtctcaagtctttaagtctgaaggaactcc tcatccctacctttaattttgaactttgtattttcattagtatctttgtc acattactgtca
quality values	Open. Hide. 61 61 18 35 61 55 43 49 49 61 61 61 61 55 47 49 59 61 59 61 61 61 61 61 61 11 28 21 20 15 19 13 21 13 44 55 49 59 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 44 37 27 28 44 55 59 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 59 61 61 61 61 59 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 55 55 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 52 61 61 61 61 61 61 52 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 57 57 57 53 57 57 57 47 53 57 57 53 57 57 57 57 47 57 57 57 53 57 57 57 57 57 53 50 52 57 57 53 57 53 57 45 57 53 53 57 53 50 57 57 57 53 53 53 57 57 57 53 39 57 53 47 47 53 57 45 57 53 57 47 38 52 52 53 57 57 57 53 57 52 45 50 57 57 36 57 53 50 52 45 53 45 45 57 47 47 57 53 57 53 57 52 38 53 52 34 45 57 52 53 53 53 53 53 33 52 45 47 41 37 52 47 52 52 53 42 41 52 50 45 42 52 30 57 57 41 28 57 52 53 47 41 47 47 53 33 37 27 53 52 53 40 53 53 57 25 28 36 52 37 52 57 38 33 52 44 52 47 24 53 37 31 40 48 40 40 47 42 53 57 52 33 35 32 36 57 52 23 45 53 39 52 37 37 53 23 57 57 28 28 27 29 43 42 37 52 36 34 33 53 40 34 35 44 18 33 22 8 45 33 34 36 36 53 26 37 24 44 33 36 35 30 57 44 37 37 57 35 29 34 35 31 44 45 30 48 48 40 15 18 48 48 34 48 30 30 23 48 19 39 31 30 37 24 32 39 32 27 30 38 29 45 29 25 32 36 29 19 28 28 37 29 27 41 31 27 29 23 15 30 17 21 25 25 38 29 26 27 29 25 29 29 51 37 29 27 28 27 25 32 28 26 33 30 46 15 29 18 29 18 29 28 28 20 38 28 32 27 46 30 18 12 30 29 20 24 29 28 35 33 35 51 27 28 20 29 28 28 33 25 21 34 21 21 26 17 18 33 21 46 51 25 29 29 28 36 16 27 29 16 19 17 26 33 34 28 30 15 28 51 51 24 28 51 28 28 20 27 24 17 10 13 12 20 24 6 9 8 17 19 21 30 34 22 43 30 13 16 38 18 39 19 28 27 28 28 28 14 16 20 12 23 18 25 21 28 19 14 16 22 27 33 22 21 19 28 26 14 38 44 26 10 14 8 17 19 20 14 27 44 15 16 18 23 30 23 20 25 9 8 9 9 11 5 6 18 17 18 33 35 26 14 10 7 24 15 31 31 30 14 44 20 23 33 14 16 26 25 10 7 6 20 12 22 20 17 19 20 16 24 25 14 34 12 7 42 7 22 8 5 11 4 19 13 10 27 7 29 37 27 15 18 11 1 3 7 3 4 8 6 14 5 5 13 14 14 7 8 14 10 8 2 3 7 16 7 20 10 10 4 6 10 6 30 13 6 5 8 8 10 8 5 4 8 8 5 4 9 4 5 8 6 5 9 6 9 12 16 22 6 4 4 10 18 7 6 5 4 7 4 5 4 7 3 4 1 4 18 4 4 16 7 7 3 22 7 9 17 5 7 8 18 17 4 13 24 24 13 12 16 9 9 20 13 10 5 9 8 9 6 18 12 6 6 5	Open. Hide. 61 61 55 49 61 19 19 13 11 10 9 13 26 26 18 28 33 52 59 59 61 61 61 61 61 61 61 61 61 61 59 61 59 59 59 61 61 61 61 59 61 61 59 61 59 61 61 61 59 61 52 43 36 36 43 52 59 61 61 61 61 59 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 59 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 59 61 59 59 59 59 61 59 61 61 59 61 59 59 59 59 55 59 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 59 59 61 59 59 59 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 59 59 52 55 55 59 61 59 61 59 59 59 59 49 59 59 52 59 59 61 61 59 61 61 59 61 61 61 61 61 61 61 61 59 52 61 59 59 59 59 61 59 61 59 61 61 61 59 61 59 61 59 59 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 59 59 59 59 59 59 59 61 61 61 61 61 61 61 61 59 61 59 61 59 61 61 61 61 59 59 61 59 59 61 59 61 59 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 59 59 59 61 59 59 59 59 61 59 59 61 61 61 61 61 61 61 61 61 61 59 61 59 61 59 61 61 61 61 61 61 61 61 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 59 61 59 61 59 59 59 61 61 59 59 59 59 59 61 61 61 61 61 61 61 61 49 59 52 52 59 52 61 61 61 61 61 61 61 61 49 43 52 52 49 52 61 61 55 55 61 49 49 55 61 55 61 55 55 61 55 61 61 61 52 55 55 61 61 61 61 61 55 61 41 61 55 55 61 61 61 61 61 61 55 61 61 39 35 49 49 50 49 61 61 61 55 55 55 55 61 49 55 43 55 37 50 37 43 43 55 55 47 38 38 50 50 50 47 50 47 49 37 49 55 55 55 61 55 55 50 50 61 53 50 61 61 61 45 50 61 50 50 50 45 43 35 47 61 61 37 47 52 53 50 61 61 52 61 53 28 23 17 22 26 27 40 52 28 39 35 31 30 50 39 35 28 45 53 52 50 40 29 45 33 37 52 47 12 40 47 30 23 47 61 53 27 22 19 25 20 30 52 52 52 31 53 52 47 45 61 53 52 42 36 45 47 31 53 32 37 43 57 47 52 45 38 52 52 53 53 23 13 53 53 40 53 45 47 50 38 52 45 47 45 21 39 23 30 39 45 42 33 42 10 15 9 19 22 24 42 47 12 9 31 14 21 35 38 39 47 24 43 36 36 18 12 47 43 46 45 33 14 53 32 45 42 52 52 53 52 27 40 41 33 31 42 42 50 53 42 37 50 50 52 23 8 42 23 47 41 30 37 28 40 32 42 29 53 23 20 47 45 24 48 42 20 41 21 30 38 41 45 23 43 12 19 19 15 52 27 38 17 10 25 34 18 8 8 21 34 33 33 21 35 34 38 29 42 37 39 30 32 34 42 29 11 53 22 10 36 37 53 52 28 32 29 33 22 22 44 52 17 11 31 44 57 53 23 40 18 53 37 30 25 15 20 21 28 17 11 31 53 36 40 29 47 14 17 40 27 31 8 26 5 10 8

Alignment Information

BAC End 1

BAC End 2

seq1: chr7_113567290_113568149
seq2: B6Ng01-131L08.g_71_931

seq1  GAATTCTTTAGCTTCCATCCTTTTTCCTTGTTCAGGTCCAAAGAGGAAGA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTTTAGCTTCCATCCTTTTTCCTTGTTCAGGTCCAAAGAGGAAGA  50

seq1  ATTTCTTGGGGACCCTGAGAAGCTCTTCTCTCCTTGCCACTAAGTCCTTT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTCTTGGGGACCCTGAGAAGCTCTTCTCTCCTTGCCACTAAGTCCTTT  100

seq1  TGGTGGCTTATAAATCCCCTGCAGGGCCAGCCCTCCAGATGCTCATCTTA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGTGGCTTATAAATCCCCTGCAGGGCCAGCCCTCCAGATGCTCATCTTA  150

seq1  CCAGGTCTCCATCTGAGAGGTTTGGTCTGTGAGCCAGGGTCTGTTCCATG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGGTCTCCATCTGAGAGGTTTGGTCTGTGAGCCAGGGTCTGTTCCATG  200

seq1  TGACTGAGATGTCTCTCCATTATTTCAGTGATGTCTTTTAGGAACACTTC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGACTGAGATGTCTCTCCATTATTTCAGTGATGTCTTTTAGGAACACTTC  250

seq1  AGCCATTGGCCAGCATTCCTCAGGGATCTCCATTGCTTGTCTCAGCTCTG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCCATTGGCCAGCATTCCTCAGGGATCTCCATTGCTTGTCTCAGCTCTG  300

seq1  CTTCTTTTTTCCTCACTGCCTCTTCCTCTCTGTGCTTCCCTTCTGACTGA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCTTTTTTCCTCACTGCCTCTTCCTCTCTGTGCTTCCCTTCTGACTGA  350

seq1  AAGGCCCTCAAAGCCTGCAGTGCCTGTCCTGCCTGCCTCTGCCTGCTCTT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGCCCTCAAAGCCTGCAGTGCCTGTCCTGCCTGCCTCTGCCTGCTCTT  400

seq1  TATCATCTCCCCTGGAGTCTCCTGCAGCTCTGCAACACTATTTGGCTGTG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATCATCTCCCCTGGAGTCTCCTGCAGCTCTGCAACACTATTTGGCTGTG  450

seq1  AGAGGTCCAGCAGCTTCTCTAGAGCCTTTTTCTCCCATGTGTGTTGTGTC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGGTCCAGCAGCTTCTCTAGAGCCTTTTTCTCCCATGTGTGTTGTGTC  500

seq1  TGTGACTTCAGCTTCTGGAGGTCTCTTTTGTCCAAATATTGCAAGGCCTG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGACTTCAGCTTCTGGAGGTCTCTTTTGTCCAAATATTGCAAGGCCTG  550

seq1  GGCAGAGGTCACACCCAGGTCTTCCTGAAGCTTAGGCAGCCAGTAGTCAA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCAGAGGTCACACCCAGGTCTTCCTGAAGCTTAGGCAGCCAGTAGTCAA  600

seq1  CAGACAGTCCCACGTCATTCAGCATCTCCTGGAGATCATGTCTTCTTCTG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGACAGTCCCACGTCATTCAGCATCTCCTGGAGATCATGTCTTCTTCTG  650

seq1  CTTCTGGACTGAGGCTTGTCATGAAAATTCTCTGCTGTGTTCATGACTGT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCTGGACTGAGGCTTGTCATGAAAATTCTCTGCTGTGTTCATGACTGT  700

seq1  GTGAAGAACAGGCACTTAGTTAAAATCTTACTCTTCGTAAGCATTTATTT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGAAGAACAGGCACTTAGTTAAAATCTTACTCTTCGTAAGCATTTATTT  750

seq1  C-TTGGCCAATAGAATGAGTGTCTCAAGTCTTTAAGTCTGAAGGAACTCC  799
      | ||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTGGCCAATAGAATGAGTGTCTCAAGTCTTTAAGTCTGAAGGAACTCC  800

seq1  TCATCCCTACCTTTAATTTTGAACTTTGTATTTTCATTAGTATCTTTGTC  849
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATCCCTACCTTTAATTTTGAACTTTGTATTTTCATTAGTATCTTTGTC  850

seq1  ACATTACTGTC  860
      |||||||||||
seq2  ACATTACTGTC  861

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information