MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-172G21
Chromosome	7 (Build37)
Map Location	23,275,503 - 23,276,022
singlet/doublet	singlet
Overlap gene	none
Upstream gene	LOC100043596, LOC667358, LOC100043016, LOC100043602, LOC100043604, EG667378, LOC100043607, LOC100043019, LOC100043025, EG667404, EG435940, LOC100043026, EG545929, LOC667421, LOC100043614, LOC667431, LOC100043029, EG620736, EG667444, LOC100043033, LOC100043037, EG667464, EG667469, EG667472, EG667094, LOC100043625, LOC100043626, LOC100043043, LOC100043048, LOC100043632, EG667485, V1rd14, LOC100043051, LOC100043058
Downstream gene	EG435947, EG667504, EG667512, LOC100043061, LOC100043638, LOC667527, EG667530, LOC667536, EG667543, LOC100043645, EG667551, LOC100043650, LOC100043067, LOC100043069, LOC670857, LOC620758, EG667570, LOC100043658, LOC100043079, LOC100043083, EG667586, EG667599, LOC100043086, LOC100043665, LOC667616, LOC100043667, LOC667623, LOC100043088, EG628664, Nlrp4e, LOC434261, Nlrp5, LOC100043095
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100043596 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043596
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC667358 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667358
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 30 Proteins pseudo : _no_value

name	LOC100043016 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043016
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 30 Proteins

name	LOC100043602 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043602
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 5 ESTs, 43 Proteins pseudo : _no_value

name	LOC100043604 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043604
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 EST, 34 Proteins

name	EG667378 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667378 MGI:3646559
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 31 Proteins

name	LOC100043607 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043607
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC100043019 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043019
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC100043025 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043025
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	EG667404 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667404 MGI:3648167
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 33 Proteins

name	EG435940 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:435940 MGI:3644396
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 30 Proteins

name	LOC100043026 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043026
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 20 Proteins pseudo : _no_value

name	EG545929 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545929 MGI:3649014
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667421 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667421
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 2 Proteins pseudo : _no_value

name	LOC100043614 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043614
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC667431 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667431
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 30 Proteins pseudo : _no_value

name	LOC100043029 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043029
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 30 Proteins

name	EG620736 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:620736 MGI:3644439
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 5 ESTs, 100 Proteins

name	EG667444 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667444 MGI:3644494
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 34 Proteins

name	LOC100043033 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043033
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC100043037 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043037
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	EG667464 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667464 MGI:3644264
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 Proteins

name	EG667469 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667469 MGI:3644289
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 31 Proteins

name	EG667472 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667472 MGI:3647206
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 30 Proteins

name	EG667094 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667094 MGI:3644807
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 29 Proteins

name	LOC100043625 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043625
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs, 71 Proteins

name	LOC100043626 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043626
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC100043043 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043043
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC100043048 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043048
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC100043632 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043632
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs

name	EG667485 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667485 MGI:3645692
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 30 Proteins

name	V1rd14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:81011 MGI:3033483
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043051 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043051
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC100043058 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043058
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	EG435947 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:435947 MGI:3644394
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 34 Proteins

name	EG667504 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667504 MGI:3643438
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 31 Proteins

name	EG667512 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667512 MGI:3646576
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 30 Proteins

name	LOC100043061 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043061
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 33 Proteins

name	LOC100043638 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043638
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 4 ESTs, 87 Proteins pseudo : _no_value

name	LOC667527 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667527
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 2 Proteins pseudo : _no_value

name	EG667530 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667530 MGI:3646821
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC667536 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667536
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 30 Proteins pseudo : _no_value

name	EG667543 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667543 MGI:3642968
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 30 Proteins

name	LOC100043645 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043645
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 5 ESTs, 103 Proteins

name	EG667551 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667551 MGI:3646139
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 34 Proteins

name	LOC100043650 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043650
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 42 ESTs

name	LOC100043067 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043067
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC100043069 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043069
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC670857 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:670857
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 30 Proteins

name	LOC620758 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:620758
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 34 Proteins

name	EG667570 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667570 MGI:3646358
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 33 Proteins pseudo : _no_value

name	LOC100043658 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043658
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC100043079 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043079
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC100043083 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043083
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	EG667586 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667586 MGI:3644349
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 33 Proteins

name	EG667599 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667599 MGI:3647550
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 30 Proteins

name	LOC100043086 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043086
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 20 Proteins pseudo : _no_value

name	LOC100043665 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043665
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 4 ESTs, 55 Proteins

name	LOC667616 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667616
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 2 Proteins pseudo : _no_value

name	LOC100043667 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043667
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC667623 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667623
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 30 Proteins pseudo : _no_value

name	LOC100043088 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043088
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 30 Proteins

name	EG628664 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628664 MGI:3647238
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 5 ESTs, 78 Proteins

name	Nlrp4e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:446099 MGI:3056600
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC434261 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:434261
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 24 mRNAs, 515 ESTs, 34 Proteins pseudo : _no_value

name	Nlrp5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23968 MGI:1345193
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100043095 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043095
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 Proteins

name	LOC100043596 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256612 GeneID:100043596
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to pheromone receptor V3R8 transcript_id : XM_001480600.1

name	LOC100043016 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256379 GeneID:100043016
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 30 Proteins product : similar to pheromone receptor V3R8 transcript_id : XM_001479329.1

name	LOC100043604 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256615 GeneID:100043604
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 1 Protein product : similar to pheromone receptor V3R8, transcript variant 2 transcript_id : XM_001480609.1

name	LOC100043604 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256617 GeneID:100043604
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 33 Proteins product : similar to pheromone receptor V3R8, transcript variant 1 transcript_id : XM_001480605.1

name	EG667378 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256383 GeneID:667378 MGI:3646559
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 31 Proteins product : predicted gene, EG667378 transcript_id : XM_001487807.1

name	LOC100043019 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256386 GeneID:100043019
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to V1rd21 protein transcript_id : XM_001479356.1

name	LOC100043025 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256388 GeneID:100043025
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to pheromone receptor V3R8 transcript_id : XM_001479365.1

name	EG667404 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379966 GeneID:667404 MGI:3648167
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 33 Proteins product : predicted gene, EG667404 transcript_id : XM_990380.1

name	EG435940 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:63565486 GeneID:435940 MGI:3644396
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 30 Proteins product : predicted gene, EG435940 transcript_id : XM_487990.2

name	EG545929 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85702263 GeneID:545929 MGI:3649014
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG545929 transcript_id : NM_001034904.1

name	LOC100043614 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256620 GeneID:100043614
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to pheromone receptor V3R8 transcript_id : XM_001480628.1

name	LOC100043029 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256394 GeneID:100043029
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 30 Proteins product : similar to pheromone receptor V3R8 transcript_id : XM_001479378.1

name	EG620736 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256622 GeneID:620736 MGI:3644439
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 5 ESTs, 100 Proteins product : predicted gene, EG620736, transcript variant 2 transcript_id : XM_896550.3

name	EG667444 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379972 GeneID:667444 MGI:3644494
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 33 Proteins product : predicted gene, EG667444, transcript variant 1 transcript_id : XM_990594.1

name	LOC100043033 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256396 GeneID:100043033
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to pheromone receptor V3R8 transcript_id : XM_001479381.1

name	LOC100043037 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256398 GeneID:100043037
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to V1rd21 protein transcript_id : XM_001479387.1

name	EG667464 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256401 GeneID:667464 MGI:3644264
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 Proteins product : predicted gene, EG667464 transcript_id : XM_990676.2

name	EG667469 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379978 GeneID:667469 MGI:3644289
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 31 Proteins product : predicted gene, EG667469 transcript_id : XM_990703.1

name	EG667472 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379980 GeneID:667472 MGI:3647206
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 30 Proteins product : predicted gene, EG667472 transcript_id : XM_990722.1

name	EG667094 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256404 GeneID:667094 MGI:3644807
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 29 Proteins product : predicted gene, EG667094 transcript_id : XM_988272.2

name	LOC100043625 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256623 GeneID:100043625
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs, 71 Proteins product : hypothetical protein LOC100043625 transcript_id : XM_001480641.1

name	LOC100043043 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256410 GeneID:100043043
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to pheromone receptor V3R8 transcript_id : XM_001479398.1

name	LOC100043632 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256625 GeneID:100043632
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs product : hypothetical protein LOC100043632 transcript_id : XM_001480653.1

name	EG667485 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379986 GeneID:667485 MGI:3645692
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 30 Proteins product : predicted gene, EG667485 transcript_id : XM_990829.1

name	V1rd14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13507695 GeneID:81011 MGI:3033483
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, D14 transcript_id : NM_030736.1

name	LOC100043051 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256412 GeneID:100043051
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to pheromone receptor V3R8 transcript_id : XM_001479410.1

name	LOC100043058 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256414 GeneID:100043058
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to LOC434138 protein transcript_id : XM_001479420.1

name	EG435947 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51762802 GeneID:435947 MGI:3644394
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 34 Proteins product : predicted gene, EG435947 transcript_id : XM_487997.1

name	EG667504 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379990 GeneID:667504 MGI:3643438
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 31 Proteins product : predicted gene, EG667504 transcript_id : XM_990941.1

name	EG667512 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379992 GeneID:667512 MGI:3646576
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 30 Proteins product : predicted gene, EG667512 transcript_id : XM_990975.1

name	LOC100043061 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256416 GeneID:100043061
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 33 Proteins product : similar to pheromone receptor V3R8 transcript_id : XM_001479431.1

name	EG667530 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256629 GeneID:667530 MGI:3646821
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG667530 transcript_id : XM_991086.2

name	EG667543 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256418 GeneID:667543 MGI:3642968
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 30 Proteins product : predicted gene, EG667543 transcript_id : XM_991143.2

name	LOC100043645 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256631 GeneID:100043645
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 5 ESTs, 103 Proteins product : hypothetical protein LOC100043645 transcript_id : XM_001480664.1

name	EG667551 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380001 GeneID:667551 MGI:3646139
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 33 Proteins product : predicted gene, EG667551, transcript variant 2 transcript_id : XM_991175.1

name	EG667551 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256633 GeneID:667551 MGI:3646139
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG667551, transcript variant 1 transcript_id : XM_001487808.1

name	LOC100043650 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256635 GeneID:100043650
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 42 ESTs product : similar to gag protein transcript_id : XM_001480672.1

name	LOC100043067 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256420 GeneID:100043067
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to pheromone receptor V3R8 transcript_id : XM_001479437.1

name	LOC670857 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256637 GeneID:670857
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 30 Proteins product : similar to pheromone receptor V3R8 transcript_id : XM_001480674.1

name	LOC620758 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256424 GeneID:620758
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 34 Proteins product : similar to pheromone receptor V3R8 transcript_id : XM_885146.3

name	LOC100043079 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256428 GeneID:100043079
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to V1rd21 protein transcript_id : XM_001479456.1

name	LOC100043083 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256430 GeneID:100043083
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to pheromone receptor V3R8 transcript_id : XM_001479459.1

name	EG667586 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380012 GeneID:667586 MGI:3644349
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 33 Proteins product : predicted gene, EG667586 transcript_id : XM_991349.1

name	EG667599 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380014 GeneID:667599 MGI:3647550
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 30 Proteins product : predicted gene, EG667599 transcript_id : XM_991394.1

name	LOC100043665 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256639 GeneID:100043665
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 55 Proteins product : hypothetical protein LOC100043665, transcript variant 1 transcript_id : XM_001480685.1

name	LOC100043665 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256641 GeneID:100043665
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs, 55 Proteins product : hypothetical protein LOC100043665, transcript variant 2 transcript_id : XM_001480688.1

name	LOC100043667 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256644 GeneID:100043667
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to pheromone receptor V3R8 transcript_id : XM_001480693.1

name	LOC100043088 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256432 GeneID:100043088
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 30 Proteins product : similar to pheromone receptor V3R8 transcript_id : XM_001479466.1

name	EG628664 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256646 GeneID:628664 MGI:3647238
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 5 ESTs, 78 Proteins product : predicted gene, EG628664, transcript variant 2 transcript_id : XM_902140.3

name	Nlrp4e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51921378 GeneID:446099 MGI:3056600
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NLR family, pyrin domain containing 4E transcript_id : NM_001004194.1

name	Nlrp5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85362738 GeneID:23968 MGI:1345193
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NLR family, pyrin domain containing 5 transcript_id : NM_011860.2

name	Nlrp5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85362739 GeneID:23968 MGI:1345193
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NLR family, pyrin domain containing 5 transcript_id : NM_001039143.1

name	LOC100043095 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256436 GeneID:100043095
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 Proteins product : similar to vomeronasal receptor V1RD12 transcript_id : XM_001479476.1

name	LOC100043596 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256613 GeneID:100043596
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_001480650.1

name	LOC100043016 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256380 GeneID:100043016
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_001479379.1

name	LOC100043604 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256616 GeneID:100043604
definition	codon_start : 1 product : similar to pheromone receptor V3R8 isoform 2 protein_id : XP_001480659.1

name	LOC100043604 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256618 GeneID:100043604
definition	codon_start : 1 product : similar to pheromone receptor V3R8 isoform 1 protein_id : XP_001480655.1

name	EG667378 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256384 GeneID:667378 MGI:3646559
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001487857.1

name	LOC100043019 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256387 GeneID:100043019
definition	codon_start : 1 product : similar to V1rd21 protein protein_id : XP_001479406.1

name	LOC100043025 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256389 GeneID:100043025
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_001479415.1

name	EG667404 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94379967 GeneID:667404 MGI:3648167
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_995474.1

name	EG435940 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63565487 GeneID:435940 MGI:3644396
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_487990.2

name	EG545929 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702264 CCDS:CCDS20923.1 GeneID:545929 MGI:3649014
definition	codon_start : 1 product : similar to serine/threonine kinase protein_id : NP_001030076.1

name	LOC100043614 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256621 GeneID:100043614
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_001480678.1

name	LOC100043029 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256395 GeneID:100043029
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_001479428.1

name	EG620736 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82904067 GeneID:620736 MGI:3644439
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_901643.1

name	EG667444 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94379973 GeneID:667444 MGI:3644494
definition	codon_start : 1 product : similar to pheromone receptor V3R8 isoform 1 protein_id : XP_995688.1

name	LOC100043033 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256397 GeneID:100043033
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_001479431.1

name	LOC100043037 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256399 GeneID:100043037
definition	codon_start : 1 product : similar to V1rd21 protein protein_id : XP_001479437.1

name	EG667464 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256402 GeneID:667464 MGI:3644264
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_995770.2

name	EG667469 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94379979 GeneID:667469 MGI:3644289
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_995797.1

name	EG667472 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94379981 GeneID:667472 MGI:3647206
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_995816.1

name	EG667094 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256405 GeneID:667094 MGI:3644807
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_993366.2

name	LOC100043625 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256624 GeneID:100043625
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480691.1

name	LOC100043043 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256411 GeneID:100043043
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_001479448.1

name	LOC100043632 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256626 GeneID:100043632
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480703.1

name	EG667485 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94379987 GeneID:667485 MGI:3645692
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_995923.1

name	V1rd14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13507696 CCDS:CCDS20925.1 GeneID:81011 MGI:3033483
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0016503 - pheromone receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA] codon_start : 1 note : pheromone receptor V3R8 product : vomeronasal 1 receptor, D14 protein_id : NP_109661.1

name	LOC100043051 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256413 GeneID:100043051
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_001479460.1

name	LOC100043058 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256415 GeneID:100043058
definition	codon_start : 1 product : similar to LOC434138 protein protein_id : XP_001479470.1

name	EG435947 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51762803 GeneID:435947 MGI:3644394
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_487997.1

name	EG667504 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94379991 GeneID:667504 MGI:3643438
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_996035.1

name	EG667512 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94379993 GeneID:667512 MGI:3646576
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_996069.1

name	LOC100043061 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256417 GeneID:100043061
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_001479481.1

name	EG667530 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256630 GeneID:667530 MGI:3646821
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_996180.2

name	EG667543 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256419 GeneID:667543 MGI:3642968
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_996237.2

name	LOC100043645 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256632 GeneID:100043645
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480714.1

name	EG667551 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256634 GeneID:667551 MGI:3646139
definition	codon_start : 1 product : similar to pheromone receptor V3R8 isoform 1 protein_id : XP_001487858.1

name	EG667551 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94380002 GeneID:667551 MGI:3646139
definition	codon_start : 1 product : similar to pheromone receptor V3R8 isoform 2 protein_id : XP_996269.1

name	LOC100043650 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256636 GeneID:100043650
definition	codon_start : 1 product : similar to gag protein protein_id : XP_001480722.1

name	LOC100043067 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256421 GeneID:100043067
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_001479487.1

name	LOC670857 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256638 GeneID:670857
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_001480724.1

name	LOC620758 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256425 GeneID:620758
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_890239.3

name	LOC100043079 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256429 GeneID:100043079
definition	codon_start : 1 product : similar to V1rd21 protein protein_id : XP_001479506.1

name	LOC100043083 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256431 GeneID:100043083
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_001479509.1

name	EG667586 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94380013 GeneID:667586 MGI:3644349
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_996443.1

name	EG667599 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94380015 GeneID:667599 MGI:3647550
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_996488.1

name	LOC100043665 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256640 GeneID:100043665
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001480735.1

name	LOC100043665 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256642 GeneID:100043665
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001480738.1

name	LOC100043667 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256645 GeneID:100043667
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_001480743.1

name	LOC100043088 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256433 GeneID:100043088
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_001479516.1

name	EG628664 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82904693 GeneID:628664 MGI:3647238
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_907233.1

name	Nlrp4e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51921379 CCDS:CCDS20928.1 GeneID:446099 MGI:3056600
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : NALP, epsilon; NLR family, pyrin domain containing 4 product : NACHT, leucine rich repeat and PYD containing 4E protein_id : NP_001004194.1

name	Nlrp5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7106379 CCDS:CCDS20930.1 GeneID:23968 MGI:1345193
definition	GO_component : GO:0005829 - cytosol [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0009887 - organ morphogenesis [Evidence IMP]; GO:0002217 - physiological defense response [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; ooplasm; NACHT, leucine rich repeat and PYD containing 5; maternal effect product : NACHT, leucine rich repeat and PYD containing 5 isoform a protein_id : NP_035990.1

name	Nlrp5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85362740 CCDS:CCDS20929.1 GeneID:23968 MGI:1345193
definition	GO_component : GO:0005829 - cytosol [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0009887 - organ morphogenesis [Evidence IMP]; GO:0002217 - physiological defense response [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; ooplasm; NACHT, leucine rich repeat and PYD containing 5; maternal effect product : NACHT, leucine rich repeat and PYD containing 5 isoform b protein_id : NP_001034232.1

name	LOC100043095 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256437 GeneID:100043095
definition	codon_start : 1 product : similar to vomeronasal receptor V1RD12 protein_id : XP_001479526.1

name	LOC667358 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667358
definition	number : 1 pseudo : _no_value

name	LOC100043607 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043607
definition	number : 1 pseudo : _no_value

name	LOC100043026 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043026
definition	number : 2 pseudo : _no_value

name	LOC100043026 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043026
definition	number : 1 pseudo : _no_value

name	LOC667431 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667431
definition	number : 1 pseudo : _no_value

name	LOC100043626 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043626
definition	number : 1 pseudo : _no_value

name	LOC100043048 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043048
definition	number : 2 pseudo : _no_value

name	LOC100043048 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043048
definition	number : 1 pseudo : _no_value

name	LOC667536 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667536
definition	number : 1 pseudo : _no_value

name	LOC100043069 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043069
definition	number : 2 pseudo : _no_value

name	LOC100043069 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043069
definition	number : 1 pseudo : _no_value

name	LOC100043658 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043658
definition	number : 1 pseudo : _no_value

name	LOC100043086 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043086
definition	number : 2 pseudo : _no_value

name	LOC100043086 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043086
definition	number : 1 pseudo : _no_value

name	LOC667623 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667623
definition	number : 1 pseudo : _no_value

name	LOC100043602 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256614 GeneID:100043602
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 5 ESTs, 43 Proteins product : hypothetical protein LOC100043602 pseudo : _no_value transcript_id : XR_034771.1

name	LOC667421 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256619 GeneID:667421
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 2 Proteins product : similar to NALP-epsilon pseudo : _no_value transcript_id : XR_035707.1

name	LOC100043638 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256627 GeneID:100043638
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 4 ESTs, 87 Proteins product : hypothetical protein LOC100043638 pseudo : _no_value transcript_id : XR_034793.1

name	LOC667527 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256628 GeneID:667527
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 2 Proteins product : similar to NALP-epsilon pseudo : _no_value transcript_id : XR_035708.1

name	EG667570 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149256427 GeneID:667570 MGI:3646358
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 33 Proteins product : predicted gene, EG667570 pseudo : _no_value transcript_id : XR_002045.2

name	LOC667616 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256643 GeneID:667616
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 2 Proteins product : similar to NALP-epsilon pseudo : _no_value transcript_id : XR_034805.1

name	LOC434261 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256647 GeneID:434261
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 24 mRNAs, 515 ESTs, 34 Proteins product : similar to Keratin 8 pseudo : _no_value transcript_id : XR_034809.1

clone name	MSMg01-507D05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-062K15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-047J17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-514D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-113J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-415F15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-184O14
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-141O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-115K13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-218A20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-117G22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-179C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-227F21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-106H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126A15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165I14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165I16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210P10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-175J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080K24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210K07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-252B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-074G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083P18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-310K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002L15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329N23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-347K08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-199I22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-320I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086O02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-272B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094O23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172G21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022H17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-204L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007F06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-292G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070D12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-214J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099G07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182M22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184C19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054O11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-270H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272K12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-237H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-107O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242N12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-090M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162E12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239K19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263A03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240H09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-349P20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045O07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-277K17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-066J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-227A02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-083J24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160E22
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-172G21.b	B6Ng01-172G21.g
ACC	GA001045	GA001046
length	947	1,176
definition	B6Ng01-172G21.b	B6Ng01-172G21.g
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattcaagtacaaggttgaataggtagggagaaagtgggcagccttgtc tagtccctgatttagtgggattgcttccagcttctgaccatttactttga tgttggccactggtttgctgtagattgcttttatcatgtttaggtatggg ccttgaattcctgattgttgtaagaatttgtcaaatgttttctcctcatc tgaggagctgatcatgtggttttcatctttgtgtttgtttatataatgga ttacgttgatggatttccgtatattaaaccatctctgcatccctggaatg aaacatatttggtcagtagggatgattgttttaatgtgttcttagattcg gttagcgagaattttattgagaatttttgcatcaatattcataagggaaa ttggtctgaagttctctatctttgcatctttctgtggtttaggtatcaga gtaattgtggcttcatagaatgaattgggtagagtaccttttgcttctat tttgtggagtagtttgtgcataattggaattagatcatctttgaaggtct gatagaactctgcactaaacccatctatttctgggctttttttttttttt tttggttgggagactattaatgactgcttctatttctttaggggatatgg gactatttagatcattaacttgatcttgatttaatttagtacctggtatc tgtctagaaatttgccaatttcatccatgttttccagtttcattgagtat agccttttgtagaaggatctcatgatgttttctgatttcttcaggatctg ttgttatctgtcccttttcatttttgattttgttaataggatgatgtccc tgtgcccacttgtgagtctggctaaagggtttatctatcttgttgatttc tcaagaaccagctccctgtttgggttgattctttgaatagtcttctt	gaattcaaagaaaatgaaggcacagaatacccaaacttatggagcacaat gaaagcaatgagtgctaagaggaaagttcatagcaccaagtaccttcata aagacatcacagagatcctgtactagcaaattaatagcacacctgacagc tctagaaccaataaaagcaaacacaaccagaaagtctaaatggcaataat caagccataaattagaaacaaaaggaacaacacaaagaatcagcaaaact aagagctgcttcttttagataatcaacaacatcaacaaacccttggccaa ctaagtaaaaggcacagataatatacaaattaacaaaatcataaagtaaa agggatgtgcaacaacacaaactggggaaataaaaaacaaaaataattgt atcttaattccaaagtctctactccacaaaactggaaaatctagataaag ttgataattttctagagagatacaatgtaccaaagttaaatcaagttcag gtaaactatttgaacagaacaataaccccaaaggaaagagaatcagtgat taatagattcccaaacaatcaaacaaataaatctcagggccagataattt tagtacaaaatagaggtctaccagactttcaaagaaatgcttataataat attcctcaaactattccaaaaaatcgatgcagaagaaacactatgtaatt tattttatgacactgcaattatccatatagataaaccacacaaagactca aaaaaaggagagagatcttcagaccaattttacttatgaatttcaaagca aaaatattcaatacaattattgaaaactgaatccaagaaaacatcaaaaa taccattcactaaaaccaagtagccttcatccaagggctacagagatggg ttcaatatacaaaaacccatcaatgcaatctatatatcatctcattaaat gcaaaatgggaaaaatcttcaacaaagttcagcacctcttcatgttaaag tcttggagtgatcagggattaaaaggtacatactaaacataaagcaaagt catgtacaatgagcaaaaacacatcaggttaaatggagagaacctgagcc atctactaaatcatgacaagatggcagtctctcttatctctcgagtatag acaattttaagttttgagaccttaca
quality values	Open. Hide. 58 36 34 24 58 28 52 31 47 62 62 62 54 47 62 62 62 62 49 62 62 62 54 62 44 44 62 62 62 62 62 62 62 56 51 35 20 38 38 43 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 54 54 62 62 59 62 62 62 62 62 59 59 62 62 62 62 62 62 59 49 62 62 62 62 62 62 62 59 62 59 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 54 54 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 59 62 62 62 62 62 62 54 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 46 62 62 62 62 62 62 62 62 56 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 52 52 62 62 62 62 62 62 62 62 54 45 62 58 58 58 58 58 54 58 58 58 58 58 54 58 58 42 54 52 54 58 58 58 54 54 52 58 44 43 58 54 58 52 52 52 43 54 49 52 44 43 41 43 48 58 52 58 54 58 58 58 54 58 52 52 47 37 52 52 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 49 58 35 58 58 58 54 42 26 49 34 48 50 42 58 40 44 46 58 53 50 48 41 41 44 37 46 50 50 48 58 58 50 53 58 53 42 36 58 58 37 41 30 50 39 51 58 58 49 31 47 52 39 39 40 37 37 39 47 39 32 51 49 35 46 46 51 58 51 52 42 50 49 51 50 34 19 58 29 33 58 40 58 38 52 52 32 39 52 51 39 58 58 21 22 10 16 13 25 9 14 14 20 32 49 36 28 23 54 51 35 32 51 40 42 24 54 32 45 32 45 40 25 25 39 51 37 54 54 22 31 41 40 39 41 42 42 31 15 27 38 40 53 23 41 37 37 30 33 35 44 23 53 54 54 36 25 35 23 54 30 6 21 35 32 45 40 37 28 33 42 41 29 31 8 47 53 26 32 32 32 52 15 51 34 31 25 31 26 24 12 47 32 29 35 32 53 18 53 53 25 32 34 29 45 32 34 11 15 32 30 25 51 51 31 31 28 25 51 51 45 35 21 24 25 41 45 8 27 18 30 13 8 15 19 24 15 32 23 30 45 24 43 22 32 28 19 8 31 24 26 28 41 31 14 16 29 26 26 31 27 29 20 30 27 34 31 31 6 6 5 14 11 24 41 6 36 37 46 31 32 24 22 31 30 11 8 9 25 15 11 9 11 36 37 36 11 10 21 7 7 20 22 20 28 31 30 11 20 41 20 48 6 12 10 19 23 37 23 36 20 23 14 30 37 24 31 31 11 38 15 8 20 42 21 33 6 5 7 9 8 13 29 12	Open. Hide. 62 38 62 47 62 47 42 62 62 62 62 62 62 56 44 44 38 24 50 35 38 56 62 59 59 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 59 54 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 54 59 62 62 62 62 62 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 54 49 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 48 62 62 62 62 62 59 62 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 47 62 62 62 62 62 62 62 62 62 62 62 62 56 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 36 47 62 62 62 62 62 62 62 62 62 62 62 62 47 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 54 51 54 58 52 54 58 58 54 54 52 43 54 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 52 58 58 58 54 48 54 54 46 54 54 58 58 49 54 58 52 54 53 52 58 52 54 42 54 54 49 52 52 52 52 54 46 52 47 58 58 58 58 58 51 58 53 58 48 47 58 51 58 58 58 46 41 46 48 47 49 58 51 58 51 51 52 48 48 52 53 51 45 37 51 49 58 49 52 51 49 50 50 58 53 58 58 50 58 53 58 50 50 41 58 51 39 33 33 52 58 50 50 50 48 58 58 53 54 51 50 50 50 50 51 58 58 43 51 52 51 40 58 50 51 51 50 38 39 40 52 58 39 58 54 51 42 39 58 39 43 51 58 33 38 58 42 51 47 53 49 32 54 49 41 54 53 54 38 46 46 44 47 52 32 39 44 34 39 42 49 35 50 33 21 49 54 49 49 44 42 41 50 54 49 54 50 40 31 54 54 32 54 51 51 44 46 33 42 51 52 54 42 49 42 42 54 53 45 40 54 54 52 52 39 46 49 37 47 49 39 38 42 51 37 33 38 45 45 52 47 30 52 52 45 52 53 40 32 34 40 40 40 40 31 40 34 47 32 53 51 52 38 23 36 31 21 46 49 46 47 51 36 32 51 45 31 42 30 30 31 32 28 32 31 31 35 32 32 37 12 29 14 33 34 51 51 31 35 31 33 38 32 31 42 31 22 13 46 46 26 23 51 31 30 32 28 41 46 46 31 28 32 38 38 36 26 29 28 28 36 30 26 31 38 31 43 31 31 25 46 46 31 31 36 42 28 27 31 29 32 11 27 31 44 41 36 30 36 24 31 32 29 46 48 46 25 29 27 30 25 19 32 32 32 27 31 26 21 46 31 32 20 16 24 33 38 37 36 26 17 16 27 32 31 31 32 25 31 14 12 23 43 19 18 32 20 20 18 25 26 18 26 26 20 43 11 27 22 21 19 30 32 32 37 28 38 32 44 43 28 21 29 28 18 17 32 33 33 22 19 26 26 18 14 17 32 12 7 16 4 11 22 32 28 23 32 24 33 34 24 18 19 22 47 20 19 32 18 28 39 39 21 9 12 47 8 33 39 48 34 23 9 18 10 18 20 14 18 24 21 39 28 26 18 16 27 27 21 23 13 15 11 5 13 7 11 20 13 15 28 10 19 21 40 16 8 9 17 17 22 22 7 15 9 17 21 21 24 18 17 18 34 19 6 10 19 11 32 29 28 10 11 27 19 28 12 28 16 25 6 12 34 10 20 10 28 13 40 27 28 18 11 25 25 12 4 13 5 12 7 4 9 23 8 15 4 11 15 3 3 11 17 17 29 16 10 9 3 4 13 10 16 5 8 16 11 11 27 15 4 15 17 4 4 8 4 3 10 4 4 24 9 12 5 6 6 19 7 8 5 12 23 18 12 17 24 8 10 5 5 2 1 1 1 4 7 14 3 4 2 2 2 3 3 6 5 6 5 7 2 5 7 7 16 10 6 21 6 4 5 4 4 5 6 7 20 9 19 9 8 14 17 17 15 12 16 10 13 28 16 6 4 7 11 5 9 3 2 2 2 2 2

Alignment Information

BAC End 1

BAC End 2

seq1: chr7_23275503_23276022
seq2: B6Ng01-172G21.b_462_983 (reverse)

seq1  AAGAAGAACTATTCAAAGAATCAA-CCAAACGAAGAGCTGGTTCCTTGAG  49
      |||||| ||||||||||||||||| ||||||   ||||||||| ||||||
seq2  AAGAAG-ACTATTCAAAGAATCAACCCAAACAGGGAGCTGGTT-CTTGAG  48

seq1  AAAATGAACAAGATAGATAAACCC-TTAGCCAGACTCACTAAAAAGGGCA  98
       |||| |||||||||||||||||| ||||||||||||||  ||  |||||
seq2  -AAATCAACAAGATAGATAAACCCTTTAGCCAGACTCAC--AAGTGGGCA  95

seq1  CAGGGACAGCATCCTAATTAACAAAATCAGAAATGAAAAGGGAGACATAA  148
      |||||||| |||||| ||||||||||||| ||||||||||||| | ||||
seq2  CAGGGACATCATCCT-ATTAACAAAATCAAAAATGAAAAGGGACAGATAA  144

seq1  CAACAGATCCTGAAGAAATC-CAAAACACCATCAGATCCTTCTACAAAAG  197
      ||||||||||||||||||||  |||||| ||| |||||||||||||||||
seq2  CAACAGATCCTGAAGAAATCAGAAAACATCATGAGATCCTTCTACAAAAG  194

seq1  GCTATACTCAACAAAACTGGAAAACCTGGATGAAATGGACAAATTTCTAG  247
      |||||||||||  |||||||||||| |||||||||| | |||||||||||
seq2  GCTATACTCAATGAAACTGGAAAACATGGATGAAATTGGCAAATTTCTAG  244

seq1  ACAGATACCAGGTACCAAAGTTAAATCAGGATCAGGTTAATGATCTAAAC  297
      ||||||||||||||| ||| |||||||| ||||| |||||||||||||| 
seq2  ACAGATACCAGGTACTAAA-TTAAATCAAGATCAAGTTAATGATCTAAAT  293

seq1  AGTCCCATATCCCCTAAAGAAATAGAAGCAGTCATTAATAGTCTCCTAAC  347
      |||||||||||||||||||||||||||||||||||||||||||||| |||
seq2  AGTCCCATATCCCCTAAAGAAATAGAAGCAGTCATTAATAGTCTCCCAAC  343

seq1  C------AAAAAAAAAAAGCCCAGGACCAGATAGATTTAGTTCGGAGTTC  391
      |      ||||||||||||||||| |  |||| | |||||| | ||||||
seq2  CAAAAAAAAAAAAAAAAAGCCCAGAAATAGATGGGTTTAGTGCAGAGTTC  393

seq1  TATCAGACCTTCAAAAAAGATCTAATTCCAGCACTGCACAAACTATTCCA  441
      ||||||||||||||| | ||||||||||||    ||||||||||| ||||
seq2  TATCAGACCTTCAAAGATGATCTAATTCCAATTATGCACAAACTACTCCA  443

seq1  CAAAATAGAAGCAGAATGTAATCTACCTAACTCATTCTATGAAGCCACAA  491
      ||||||||||||| || ||| |||||| || |||||||||||||||||||
seq2  CAAAATAGAAGCAAAAGGTACTCTACCCAATTCATTCTATGAAGCCACAA  493

seq1  TTACTCTGATACCTAAACCACAGAAAGAT  520
      |||||||||||||||||||||||||||||
seq2  TTACTCTGATACCTAAACCACAGAAAGAT  522

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information