MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-193B17
Chromosome	7 (Build37)
Map Location	53,805,137 - 53,970,906
singlet/doublet	doublet
Overlap gene	Sergef, Tph1, Saal1, Saa3
Upstream gene	Plekha4, Hsd17b14, Bcat2, Fgf21, Fut1, Izumo1, Rasip1, 5430432N15Rik, Fut2, Sec1, Gm484, Car11, Dbp, Sphk2, Rpl18, 4930403C10Rik, Spaca4, Sult2b1, EG545963, Lmtk3, Pscd2, Kcnj14, Grwd1, Grin2d, Kdelr1, Syngr4, Tmem143, Emp3, BC013491, LOC677321, Abcc6, Nomo1, Kcnj11, Abcc8, Ush1c, Otog, Myod1, Kcnc1
Downstream gene	Saa4, LOC100040106, Saa1, Saa2, Hps5, Gtf2h1, EG668838, EG384622, Ldha, Ldhc, Tsg101, Uevld, C86187, LOC384623, ENSMUSG00000056509, Spty2d1, LOC100040174, Tmem86a, Ptpn5, LOC100041710, Mrgpra6, EG668725, Gm660, Mrgpra1, LOC668846, LOC100040217, LOC668727, Mrgpra2, LOC638950, Mrgprc4-ps, LOC677457, EG668729, Mrgpra3, Mrgprc1-ps, LOC100040314
Link	Open Mouse BAC browser

Click to get alignment info.

name	Plekha4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69217 MGI:1916467
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hsd17b14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66065 MGI:1913315
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bcat2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12036 MGI:1276534
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fgf21 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56636 MGI:1861377
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fut1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14343 MGI:109375
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Izumo1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73456 MGI:1920706
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rasip1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69903 MGI:1917153
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5430432N15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74490 MGI:1921740
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 17 ESTs, 1 Protein

name	Fut2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14344 MGI:109374
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sec1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56546 MGI:1928893
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm484 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243967 MGI:2685330
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Car11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12348 MGI:1336193
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dbp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13170 MGI:94866
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sphk2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56632 MGI:1861380
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Rpl18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19899 MGI:98003
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930403C10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73813 MGI:1921063
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Spaca4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69363 MGI:1916613
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sult2b1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54200 MGI:1926342
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG545963 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545963 MGI:3648578
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lmtk3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381983 MGI:3039582
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pscd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19158 MGI:1334255
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kcnj14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:211480 MGI:2384820
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Grwd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:101612 MGI:2141989
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Grin2d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14814 MGI:95823
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kdelr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68137 MGI:1915387
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Syngr4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58867 MGI:1928903
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem143 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70209 MGI:1917459
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Emp3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13732 MGI:1098729
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC013491 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:211535 MGI:2446120
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC677321 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:677321
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 mRNAs, 179 ESTs, 5 Proteins pseudo : _no_value

name	Abcc6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27421 MGI:1351634
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nomo1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:211548 MGI:2385850
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kcnj11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16514 MGI:107501
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abcc8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20927 MGI:1352629
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ush1c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72088 MGI:1919338
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Otog (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18419 MGI:1202064
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2 Proteins

name	Myod1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17927 MGI:97275
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kcnc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16502 MGI:96667
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sergef (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27414 MGI:1351630
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tph1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21990 MGI:98796
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Saal1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78935 MGI:1926185
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 113 ESTs, 2 Proteins

name	Saa3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20210 MGI:98223
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Saa4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20211 MGI:98224
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040106 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040106
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	Saa1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20208 MGI:98221
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Saa2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20209 MGI:98222
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hps5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:246694 MGI:2180307
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Gtf2h1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14884 MGI:1277216
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG668838 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668838 MGI:3643262
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 82 ESTs, 52 Proteins

name	EG384622 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384622 MGI:3647739
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 11 Proteins

name	Ldha (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16828 MGI:96759
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ldhc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16833 MGI:96764
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tsg101 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22088 MGI:106581
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Uevld (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54122 MGI:1860490
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C86187 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:97402 MGI:2142361
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 153 ESTs

name	LOC384623 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:384623
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 ESTs, 4 Proteins pseudo : _no_value

name	ENSMUSG00000056509 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629141 MGI:3642801
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs

name	Spty2d1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:101685 MGI:2142062
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040174 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040174
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Tmem86a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67893 MGI:1915143
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ptpn5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19259 MGI:97807
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041710 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041710
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs

name	Mrgpra6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381886 MGI:3033107
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG668725 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668725 MGI:3644999
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm660 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269919 MGI:2685506
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 44 Proteins

name	Mrgpra1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233221 MGI:3033095
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668846 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668846
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 2 Proteins pseudo : _no_value

name	LOC100040217 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040217
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC668727 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668727
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 16 ESTs, 41 Proteins

name	Mrgpra2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235712 MGI:3033098
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC638950 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:638950
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 37 Proteins

name	Mrgprc4-ps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404257 MGI:3033197
definition	gene_synonym : MrgC4 note : MAS-related GPR, member C4, pseudogene pseudo : _no_value

name	LOC677457 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:677457
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 47 Proteins

name	EG668729 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668729 MGI:3644993
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins pseudo : _no_value

name	Mrgpra3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233222 MGI:2684085
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrgprc1-ps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269921 MGI:3033136
definition	gene_synonym : MrgC1 note : MAS-related GPR, member C1, pseudogene pseudo : _no_value

name	LOC100040314 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040314
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	Plekha4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22507324 GeneID:69217 MGI:1916467
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4 transcript_id : NM_148927.1

name	Hsd17b14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61098115 GeneID:66065 MGI:1913315
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hydroxysteroid (17-beta) dehydrogenase 14 transcript_id : NM_025330.2

name	Bcat2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365745 GeneID:12036 MGI:1276534
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : branched chain aminotransferase 2, mitochondrial transcript_id : NM_009737.2

name	Fgf21 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142379814 GeneID:56636 MGI:1861377
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fibroblast growth factor 21 transcript_id : NM_020013.3

name	Fut1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802983 GeneID:14343 MGI:109375
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fucosyltransferase 1 transcript_id : NM_008051.4

name	Izumo1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:65301150 GeneID:73456 MGI:1920706
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : izumo sperm-egg fusion 1 transcript_id : NM_001018013.1

name	Rasip1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61676214 GeneID:69903 MGI:1917153
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Ras interacting protein 1 transcript_id : NM_028544.1

name	5430432N15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257304 GeneID:74490 MGI:1921740
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 17 ESTs, 1 Protein product : RIKEN cDNA 5430432N15 gene transcript_id : XM_001476117.1

name	Fut2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144227196 GeneID:14344 MGI:109374
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fucosyltransferase 2 transcript_id : NM_018876.3

name	Sec1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9910229 GeneID:56546 MGI:1928893
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : secretory blood group 1 transcript_id : NM_019934.1

name	Gm484 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125490393 GeneID:243967 MGI:2685330
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 484, (NCBI) transcript_id : NM_001033356.2

name	Car11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801671 GeneID:12348 MGI:1336193
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : carbonic anhydrase 11 transcript_id : NM_009800.3

name	Dbp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:8393239 GeneID:13170 MGI:94866
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : D site albumin promoter binding protein transcript_id : NM_016974.1

name	Sphk2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130964 GeneID:56632 MGI:1861380
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sphingosine kinase 2 transcript_id : NM_203280.2

name	Sphk2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354966 GeneID:56632 MGI:1861380
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sphingosine kinase 2 transcript_id : NM_020011.4

name	Rpl18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83699423 GeneID:19899 MGI:98003
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein L18 transcript_id : NM_009077.2

name	4930403C10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345328 GeneID:73813 MGI:1921063
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930403C10 gene transcript_id : NM_001033170.2

name	Spaca4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802360 GeneID:69363 MGI:1916613
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sperm acrosome associated 4 transcript_id : NM_027055.2

name	Sult2b1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:8567407 GeneID:54200 MGI:1926342
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sulfotransferase family, cytosolic, 2B, member 1 transcript_id : NM_017465.1

name	EG545963 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85702114 GeneID:545963 MGI:3648578
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG545963 transcript_id : NM_001033792.1

name	Lmtk3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:53828724 GeneID:381983 MGI:3039582
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lemur tyrosine kinase 3 transcript_id : NM_001005511.1

name	Pscd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543517 GeneID:19158 MGI:1334255
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pleckstrin homology, Sec7 and coiled-coil domains 2 transcript_id : NM_011181.2

name	Kcnj14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892517 GeneID:211480 MGI:2384820
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium inwardly-rectifying channel, subfamily J, member 14 transcript_id : NM_145963.2

name	Grwd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23956277 GeneID:101612 MGI:2141989
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutamate-rich WD repeat containing 1 transcript_id : NM_153419.1

name	Grin2d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922605 GeneID:14814 MGI:95823
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutamate receptor, ionotropic, NMDA2D (epsilon 4) transcript_id : NM_008172.2

name	Kdelr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129902 GeneID:68137 MGI:1915387
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1 transcript_id : NM_133950.2

name	Syngr4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120587010 GeneID:58867 MGI:1928903
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synaptogyrin 4 transcript_id : NM_021482.2

name	Tmem143 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450160 GeneID:70209 MGI:1917459
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 143 transcript_id : NM_144801.1

name	Emp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753749 GeneID:13732 MGI:1098729
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : epithelial membrane protein 3 transcript_id : NM_010129.1

name	BC013491 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142371876 GeneID:211535 MGI:2446120
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC013491 transcript_id : NM_001033243.2

name	Abcc6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9055155 GeneID:27421 MGI:1351634
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP-binding cassette, sub-family C (CFTR/MRP), member 6 transcript_id : NM_018795.1

name	Nomo1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802551 GeneID:211548 MGI:2385850
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nodal modulator 1 transcript_id : NM_153057.3

name	Kcnj11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328178 GeneID:16514 MGI:107501
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium inwardly rectifying channel, subfamily J, member 11 transcript_id : NM_010602.2

name	Abcc8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130128 GeneID:20927 MGI:1352629
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP-binding cassette, sub-family C (CFTR/MRP), member 8 transcript_id : NM_011510.3

name	Ush1c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41281801 GeneID:72088 MGI:1919338
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Usher syndrome 1C homolog (human) transcript_id : NM_153677.1

name	Ush1c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12963768 GeneID:72088 MGI:1919338
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Usher syndrome 1C homolog (human) transcript_id : NM_023649.1

name	Otog (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257307 GeneID:18419 MGI:1202064
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2 Proteins product : otogelin transcript_id : XM_001476814.1

name	Myod1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6996931 GeneID:17927 MGI:97275
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myogenic differentiation 1 transcript_id : NM_010866.1

name	Kcnc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76677931 GeneID:16502 MGI:96667
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium voltage gated channel, Shaw-related subfamily, member 1 transcript_id : NM_008421.2

name	Sergef (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305092 GeneID:27414 MGI:1351630
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : secretion regulating guanine nucleotide exchange factor transcript_id : NM_013789.1

name	Tph1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49274628 GeneID:21990 MGI:98796
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tryptophan hydroxylase 1 transcript_id : NM_009414.2

name	Saal1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380480 GeneID:78935 MGI:1926185
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 113 ESTs, 2 Proteins product : serum amyloid A-like 1, transcript variant 1 transcript_id : XM_620495.3

name	Saa3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130197 GeneID:20210 MGI:98223
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serum amyloid A 3 transcript_id : NM_011315.3

name	Saa4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802298 GeneID:20211 MGI:98224
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serum amyloid A 4 transcript_id : NM_011316.3

name	Saa1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130531 GeneID:20208 MGI:98221
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serum amyloid A 1 transcript_id : NM_009117.3

name	Saa2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755393 GeneID:20209 MGI:98222
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serum amyloid A 2 transcript_id : NM_011314.1

name	Hps5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:52546697 GeneID:246694 MGI:2180307
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Hermansky-Pudlak syndrome 5 homolog (human) transcript_id : NM_001005248.1

name	Hps5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:52546701 GeneID:246694 MGI:2180307
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Hermansky-Pudlak syndrome 5 homolog (human) transcript_id : NM_001005247.1

name	Gtf2h1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388290 GeneID:14884 MGI:1277216
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : general transcription factor II H, polypeptide 1 transcript_id : NM_008186.3

name	EG668838 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380482 GeneID:668838 MGI:3643262
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 82 ESTs, 52 Proteins product : predicted gene, EG668838 transcript_id : XM_001004974.1

name	EG384622 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380435 GeneID:384622 MGI:3647739
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 11 Proteins product : predicted gene, EG384622 transcript_id : XM_357752.4

name	Ldha (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754523 GeneID:16828 MGI:96759
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lactate dehydrogenase A transcript_id : NM_010699.1

name	Ldhc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348349 GeneID:16833 MGI:96764
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lactate dehydrogenase C transcript_id : NM_013580.3

name	Tsg101 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375824 GeneID:22088 MGI:106581
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tumor susceptibility gene 101 transcript_id : NM_021884.3

name	Uevld (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:104294889 GeneID:54122 MGI:1860490
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UEV and lactate/malate dehyrogenase domains transcript_id : NM_001040695.1

name	C86187 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257310 GeneID:97402 MGI:2142361
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 153 ESTs product : expressed sequence C86187 transcript_id : XM_001477244.1

name	ENSMUSG00000056509 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257312 GeneID:629141 MGI:3642801
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs product : predicted gene, ENSMUSG00000056509 transcript_id : XM_001477255.1

name	Spty2d1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51592079 GeneID:101685 MGI:2142062
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SPT2, Suppressor of Ty, domain containing 1 (S. cerevisiae) transcript_id : NM_175318.3

name	LOC100040174 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257260 GeneID:100040174
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100040174 transcript_id : XM_001474210.1

name	Tmem86a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803294 GeneID:67893 MGI:1915143
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 86A transcript_id : NM_026436.2

name	Ptpn5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305424 GeneID:19259 MGI:97807
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein tyrosine phosphatase, non-receptor type 5 transcript_id : NM_013643.1

name	LOC100041710 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257314 GeneID:100041710
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs product : hypothetical protein LOC100041710 transcript_id : XM_001477303.1

name	Mrgpra6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124517721 GeneID:381886 MGI:3033107
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MAS-related GPR, member A6 transcript_id : NM_205821.2

name	EG668725 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257187 GeneID:668725 MGI:3644999
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG668725 transcript_id : XM_001471922.1

name	Gm660 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257316 GeneID:269919 MGI:2685506
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 44 Proteins product : gene model 660, (NCBI) transcript_id : XM_195647.6

name	Mrgpra1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23346520 GeneID:233221 MGI:3033095
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MAS-related GPR, member A1 transcript_id : NM_153095.1

name	LOC668727 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94380441 GeneID:668727
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 16 ESTs, 41 Proteins product : similar to Mrgpra2 protein transcript_id : XM_001003345.1

name	Mrgpra2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802843 GeneID:235712 MGI:3033098
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MAS-related GPR, member A2 transcript_id : NM_153101.2

name	LOC638950 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257262 GeneID:638950
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 37 Proteins product : similar to MRGA G protein-coupled receptor transcript_id : XM_001474357.1

name	LOC677457 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257264 GeneID:677457
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 47 Proteins product : similar to MAS-related GPR, member A4 transcript_id : XM_001474409.1

name	Mrgpra3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23346466 GeneID:233222 MGI:2684085
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MAS-related GPR, member A3 transcript_id : NM_153067.1

name	LOC100040314 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257266 GeneID:100040314
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to MAS-related GPR, member A4 transcript_id : XM_001474490.1

name	Hsd17b14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61098116 CCDS:CCDS21251.1 GeneID:66065 MGI:1913315
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : dehydrogenase/reductase (SDR family) member 10 protein_id : NP_079606.2

name	Bcat2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859514 CCDS:CCDS21252.1 GeneID:12036 MGI:1276534
definition	GO_component : GO:0005739 - mitochondrion [Evidence IEA] [Evidence IDA] GO_function : GO:0004084 - branched-chain-amino-acid transaminase activity [Evidence IDA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0008483 - transaminase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008652 - amino acid biosynthesis [Evidence IEA]; GO:0009082 - branched chain family amino acid biosynthesis [Evidence IEA]; GO:0009083 - branched chain family amino acid catabolism [Evidence IMP]; GO:0009081 - branched chain family amino acid metabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : branched chain aminotransferase 2, mitochondrial protein_id : NP_033867.1

name	Fgf21 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910218 CCDS:CCDS21253.1 GeneID:56636 MGI:1861377
definition	GO_function : GO:0008083 - growth factor activity [Evidence IEA] codon_start : 1 product : fibroblast growth factor 21 protein_id : NP_064397.1

name	Fut1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49355810 CCDS:CCDS21254.1 GeneID:14343 MGI:109375
definition	GO_component : GO:0005794 - Golgi apparatus [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008107 - galactoside 2-alpha-L-fucosyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA] codon_start : 1 note : H transferase; beta-galactoside alpha-1,2-fucosyltransferase product : fucosyltransferase 1 protein_id : NP_032077.2

name	Izumo1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:65301151 CCDS:CCDS21255.1 GeneID:73456 MGI:1920706
definition	GO_component : GO:0016021 - integral to membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IC]; GO:0007342 - fusion of sperm to egg plasma membrane [Evidence IDA] codon_start : 1 function : membrane fusion product : sperm-specific protein Izumo protein_id : NP_001018013.1

name	Rasip1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61676215 CCDS:CCDS21256.1 GeneID:69903 MGI:1917153
definition	GO_component : GO:0005794 - Golgi apparatus [Evidence ISS]; GO:0016020 - membrane [Evidence IEA]; GO:0016459 - myosin [Evidence IEA]; GO:0048471 - perinuclear region [Evidence ISS] GO_function : GO:0003774 - motor activity [Evidence IEA]; GO:0017016 - Ras GTPase binding [Evidence ISS] GO_process : GO:0008284 - positive regulation of cell proliferation [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : Ras interacting protein 1 protein_id : NP_082820.1

name	5430432N15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257305 GeneID:74490 MGI:1921740
definition	codon_start : 1 product : hypothetical protein LOC74490 protein_id : XP_001476167.1

name	Fut2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542827 CCDS:CCDS21258.1 GeneID:14344 MGI:109374
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0008417 - fucosyltransferase activity [Evidence IDA]; GO:0008107 - galactoside 2-alpha-L-fucosyltransferase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0006486 - protein amino acid glycosylation [Evidence IDA] codon_start : 1 note : GDP-L-fucose:beta-D-galactoside 2-alpha-1-fucosyltransferase product : fucosyltransferase 2 protein_id : NP_061364.2

name	Sec1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910230 GeneID:56546 MGI:1928893
definition	GO_function : GO:0008417 - fucosyltransferase activity [Evidence IDA] GO_process : GO:0006486 - protein amino acid glycosylation [Evidence IDA] codon_start : 1 exception : mismatches in translation note : GDP-L-fucose:beta-D-galactoside 2-alpha-L-fucosyltransferase 3; fucosyltransferase 10; GDP-L-fucose:beta-D-galactoside 2-alpha-L-fucosyltransferase FUT-III product : secretory blood group 1 protein_id : NP_064318.1

name	Gm484 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125490394 GeneID:243967 MGI:2685330
definition	codon_start : 1 product : hypothetical protein LOC243967 protein_id : NP_001028528.2

name	Car11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22208838 CCDS:CCDS21259.1 GeneID:12348 MGI:1336193
definition	GO_function : GO:0004089 - carbonate dehydratase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006730 - one-carbon compound metabolism [Evidence IEA] codon_start : 1 note : CA-RP XI product : carbonic anhydrase 11 protein_id : NP_033930.1

name	Dbp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8393240 CCDS:CCDS21260.1 GeneID:13170 MGI:94866
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046983 - protein dimerization activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0007623 - circadian rhythm [Evidence TAS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence TAS]; GO:0048511 - rhythmic process [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : D site albumin promoter binding protein protein_id : NP_058670.1

name	Sphk2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981070 CCDS:CCDS21261.1 GeneID:56632 MGI:1861380
definition	GO_component : GO:0005829 - cytosol [Evidence IEP]; GO:0005624 - membrane fraction [Evidence IEP] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0017050 - D-erythro-sphingosine kinase activity [Evidence IDA] [Evidence IMP]; GO:0004143 - diacylglycerol kinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0017016 - Ras GTPase binding [Evidence ISS]; GO:0008481 - sphinganine kinase activity [Evidence NAS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006916 - anti-apoptosis [Evidence NAS]; GO:0001568 - blood vessel development [Evidence IGI]; GO:0007420 - brain development [Evidence IGI]; GO:0008283 - cell proliferation [Evidence NAS]; GO:0008284 - positive regulation of cell proliferation [Evidence IGI]; GO:0007205 - protein kinase C activation [Evidence IEA]; GO:0006669 - sphinganine-1-phosphate biosynthesis [Evidence NAS]; GO:0006670 - sphingosine metabolism [Evidence IMP] codon_start : 1 product : sphingosine kinase 2 protein_id : NP_064395.2

name	Sphk2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:42544000 CCDS:CCDS21261.1 GeneID:56632 MGI:1861380
definition	GO_component : GO:0005829 - cytosol [Evidence IEP]; GO:0005624 - membrane fraction [Evidence IEP] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0017050 - D-erythro-sphingosine kinase activity [Evidence IDA] [Evidence IMP]; GO:0004143 - diacylglycerol kinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0017016 - Ras GTPase binding [Evidence ISS]; GO:0008481 - sphinganine kinase activity [Evidence NAS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006916 - anti-apoptosis [Evidence NAS]; GO:0001568 - blood vessel development [Evidence IGI]; GO:0007420 - brain development [Evidence IGI]; GO:0008283 - cell proliferation [Evidence NAS]; GO:0008284 - positive regulation of cell proliferation [Evidence IGI]; GO:0007205 - protein kinase C activation [Evidence IEA]; GO:0006669 - sphinganine-1-phosphate biosynthesis [Evidence NAS]; GO:0006670 - sphingosine metabolism [Evidence IMP] codon_start : 1 product : sphingosine kinase 2 protein_id : NP_975009.1

name	Rpl18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83699424 GeneID:19899 MGI:98003
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 product : ribosomal protein L18 protein_id : NP_033103.2

name	4930403C10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701676 GeneID:73813 MGI:1921063
definition	codon_start : 1 product : hypothetical protein LOC73813 protein_id : NP_001028342.1

name	Spaca4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312278 CCDS:CCDS21262.1 GeneID:69363 MGI:1916613
definition	codon_start : 1 exception : mismatches in translation product : sperm acrosomal membrane protein 14 protein_id : NP_081331.1

name	Sult2b1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8567408 CCDS:CCDS21263.1 GeneID:54200 MGI:1926342
definition	GO_function : GO:0004027 - alcohol sulfotransferase activity [Evidence IEA]; GO:0008146 - sulfotransferase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006629 - lipid metabolism [Evidence IEA]; GO:0008202 - steroid metabolism [Evidence IEA]; GO:0000103 - sulfate assimilation [Evidence IDA] codon_start : 1 exception : mismatches in translation note : hydroxysteroid sulfotransferase product : sulfotransferase family, cytosolic, 2B, member 1 protein_id : NP_059493.1

name	EG545963 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702115 GeneID:545963 MGI:3648578
definition	codon_start : 1 product : hypothetical protein LOC545963 protein_id : NP_001028964.1

name	Lmtk3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:53828725 GeneID:381983 MGI:3039582
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 exception : mismatches in translation product : lemur tyrosine kinase 3 protein_id : NP_001005511.1

name	Pscd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755186 GeneID:19158 MGI:1334255
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005622 - intracellular [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0005086 - ARF guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0032012 - regulation of ARF protein signal transduction [Evidence IEA]; GO:0030155 - regulation of cell adhesion [Evidence ISS] codon_start : 1 note : cytohesin 2 product : pleckstrin homology, Sec7 and coiled-coil domains 2 protein_id : NP_035311.1

name	Kcnj14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122399 CCDS:CCDS21265.1 GeneID:211480 MGI:2384820
definition	GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : potassium inwardly-rectifying channel J14 protein_id : NP_666075.1

name	Grwd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956278 CCDS:CCDS21266.1 GeneID:101612 MGI:2141989
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 note : glutamate rich WD repeat protein GRWD product : glutamate-rich WD repeat containing 1 protein_id : NP_700468.1

name	Grin2d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:144922606 CCDS:CCDS21267.1 GeneID:14814 MGI:95823
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0045211 - postsynaptic membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005234 - glutamate-gated ion channel activity [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0004970 - ionotropic glutamate receptor activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : GluRepsilon4 product : glutamate receptor, ionotropic, NMDA2D (epsilon 4) protein_id : NP_032198.2

name	Kdelr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527170 CCDS:CCDS21268.1 GeneID:68137 MGI:1915387
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0046923 - ER retention sequence binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006888 - ER to Golgi vesicle-mediated transport [Evidence IEA]; GO:0006621 - protein retention in ER [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : KDEL endoplasmic reticulum protein retention receptor 1 protein_id : NP_598711.1

name	Syngr4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120587011 GeneID:58867 MGI:1928903
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : synaptogyrin 4 protein product : synaptogyrin 4 protein_id : NP_067457.2

name	Tmem143 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450161 CCDS:CCDS21269.1 GeneID:70209 MGI:1917459
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC70209 protein_id : NP_659050.1

name	Emp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753750 CCDS:CCDS21270.1 GeneID:13732 MGI:1098729
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 exception : mismatches in translation product : epithelial membrane protein 3 protein_id : NP_034259.1

name	BC013491 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701754 CCDS:CCDS21271.1 GeneID:211535 MGI:2446120
definition	codon_start : 1 product : hypothetical protein LOC211535 protein_id : NP_001028415.1

name	Abcc6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9055156 CCDS:CCDS21272.1 GeneID:27421 MGI:1351634
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016887 - ATPase activity [Evidence IEA]; GO:0042626 - ATPase activity, coupled to transmembrane movement of substances [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : multidrug resistance-associated protein-6 product : ATP-binding cassette, sub-family C, member 6 protein_id : NP_061265.1

name	Nomo1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27151748 CCDS:CCDS21273.1 GeneID:211548 MGI:2385850
definition	GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0008199 - ferric iron binding [Evidence IEA] GO_process : GO:0006725 - aromatic compound metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : nodal modulator 1 protein_id : NP_694697.2

name	Kcnj11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754426 CCDS:CCDS21274.1 GeneID:16514 MGI:107501
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005242 - inward rectifier potassium channel activity [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0005267 - potassium channel activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : potassium unwardly rectifying channel, subfamily J, member 11 product : potassium inwardly rectifying channel, subfamily J, member 11 protein_id : NP_034732.1

name	Abcc8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62241017 CCDS:CCDS21275.1 GeneID:20927 MGI:1352629
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016887 - ATPase activity [Evidence IEA]; GO:0042626 - ATPase activity, coupled to transmembrane movement of substances [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0008281 - sulfonylurea receptor activity [Evidence IEA] GO_process : GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : sulfonylurea receptor product : ATP-binding cassette, sub-family C (CFTR/MRP), member 8 protein_id : NP_035640.2

name	Ush1c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41281802 CCDS:CCDS21276.1 GeneID:72088 MGI:1919338
definition	GO_component : GO:0005929 - cilium [Evidence IDA]; GO:0001917 - photoreceptor inner segment [Evidence IDA]; GO:0001750 - photoreceptor outer segment [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA]; GO:0045202 - synapse [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0051017 - actin filament bundle formation [Evidence IDA]; GO:0030046 - parallel actin filament bundle formation [Evidence IDA] codon_start : 1 exception : mismatches in translation note : isoform b3 is encoded by transcript variant b3 product : harmonin isoform b3 protein_id : NP_710143.1

name	Ush1c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963769 GeneID:72088 MGI:1919338
definition	GO_component : GO:0005929 - cilium [Evidence IDA]; GO:0001917 - photoreceptor inner segment [Evidence IDA]; GO:0001750 - photoreceptor outer segment [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA]; GO:0045202 - synapse [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0051017 - actin filament bundle formation [Evidence IDA]; GO:0030046 - parallel actin filament bundle formation [Evidence IDA] codon_start : 1 exception : mismatches in translation note : isoform a1 is encoded by transcript variant a1 product : harmonin isoform a1 protein_id : NP_076138.1

name	Otog (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257308 GeneID:18419 MGI:1202064
definition	codon_start : 1 product : otogelin protein_id : XP_001476864.1

name	Myod1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6996932 CCDS:CCDS21277.1 GeneID:17927 MGI:97275
definition	GO_component : GO:0005634 - nucleus [Evidence TAS] [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003705 - RNA polymerase II transcription factor activity, enhancer binding [Evidence TAS]; GO:0003700 - transcription factor activity [Evidence IDA]; GO:0030528 - transcription regulator activity [Evidence IDA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007517 - muscle development [Evidence IGI] [Evidence IDA]; GO:0007518 - myoblast cell fate determination [Evidence IDA]; GO:0045445 - myoblast differentiation [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0007519 - striated muscle development [Evidence TAS] [Evidence IGI] [Evidence IDA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : myogenic differentiation 1 protein_id : NP_034996.1

name	Kcnc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680522 CCDS:CCDS21278.1 GeneID:16502 MGI:96667
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0008076 - voltage-gated potassium channel complex [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0005267 - potassium channel activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA]; GO:0005249 - voltage-gated potassium channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : potassium voltage gated channel, Shaw-related subfamily, member 1 protein_id : NP_032447.1

name	Sergef (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305093 CCDS:CCDS21279.1 GeneID:27414 MGI:1351630
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS] [Evidence IDA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IDA] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0005087 - Ran guanyl-nucleotide exchange factor activity [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007165 - signal transduction [Evidence ISS] codon_start : 1 product : guanine nucleotide exchange factor (RCC1 related) protein_id : NP_038817.1

name	Tph1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678411 CCDS:CCDS21280.1 GeneID:21990 MGI:98796
definition	GO_function : GO:0016597 - amino acid binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0004510 - tryptophan 5-monooxygenase activity [Evidence IEA] GO_process : GO:0009072 - aromatic amino acid family metabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA]; GO:0042427 - serotonin biosynthesis [Evidence IEA]; GO:0006587 - serotonin biosynthesis from tryptophan [Evidence IEA] codon_start : 1 product : tryptophan hydroxylase 1 protein_id : NP_033440.1

name	Saal1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63557363 GeneID:78935 MGI:1926185
definition	codon_start : 1 product : serum amyloid A-like 1 isoform 1 protein_id : XP_620495.1

name	Saa3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755396 CCDS:CCDS21282.1 GeneID:20210 MGI:98223
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005319 - lipid transporter activity [Evidence IEA] GO_process : GO:0006953 - acute-phase response [Evidence IEA] codon_start : 1 product : serum amyloid A 3 protein_id : NP_035445.1

name	Saa4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755398 CCDS:CCDS21283.1 GeneID:20211 MGI:98224
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005319 - lipid transporter activity [Evidence IEA] GO_process : GO:0006953 - acute-phase response [Evidence IEA] codon_start : 1 product : serum amyloid A 4 protein_id : NP_035446.1

name	Saa1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677843 CCDS:CCDS21284.1 GeneID:20208 MGI:98221
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005319 - lipid transporter activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006953 - acute-phase response [Evidence IEA] codon_start : 1 note : serum amyloid A 2 product : serum amyloid A 1 protein_id : NP_033143.1

name	Saa2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755394 CCDS:CCDS21285.1 GeneID:20209 MGI:98222
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005319 - lipid transporter activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006953 - acute-phase response [Evidence IEA] codon_start : 1 note : serum amyloid A 1 product : serum amyloid A 2 protein_id : NP_035444.1

name	Hps5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:52546702 CCDS:CCDS21286.1 GeneID:246694 MGI:2180307
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006996 - organelle organization and biogenesis [Evidence IMP] codon_start : 1 exception : mismatches in translation note : isoform 1 is encoded by transcript variant 1; ruby eye 2 product : Hermansky-Pudlak syndrome 5 isoform 1 protein_id : NP_001005247.1

name	Hps5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:52546698 CCDS:CCDS21286.1 GeneID:246694 MGI:2180307
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006996 - organelle organization and biogenesis [Evidence IMP] codon_start : 1 exception : mismatches in translation note : isoform 2 is encoded by transcript variant 2; ruby eye 2 product : Hermansky-Pudlak syndrome 5 isoform 2 protein_id : NP_001005248.1

name	Gtf2h1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982313 CCDS:CCDS21287.1 GeneID:14884 MGI:1277216
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006281 - DNA repair [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : general transcription factor IIH, polypeptide 1 (62kD subunit); general transcription factor II H, polypeptide 1 (62kD subunit) product : general transcription factor II H, polypeptide 1 protein_id : NP_032212.2

name	EG668838 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94380483 GeneID:668838 MGI:3643262
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001004974.1

name	EG384622 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94380436 GeneID:384622 MGI:3647739
definition	codon_start : 1 product : similar to interferon-inducible protein 16 protein_id : XP_357752.4

name	Ldha (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754524 CCDS:CCDS21289.1 GeneID:16828 MGI:96759
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0004459 - L-lactate dehydrogenase activity [Evidence IDA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0019642 - anaerobic glycolysis [Evidence IEA]; GO:0006096 - glycolysis [Evidence IEA]; GO:0006100 - tricarboxylic acid cycle intermediate metabolism [Evidence IEA] codon_start : 1 note : lactate dehydrogenase-A product : lactate dehydrogenase 1, A chain protein_id : NP_034829.1

name	Ldhc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305229 CCDS:CCDS21290.1 GeneID:16833 MGI:96764
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0004459 - L-lactate dehydrogenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0019642 - anaerobic glycolysis [Evidence IEA]; GO:0006096 - glycolysis [Evidence IEA]; GO:0006100 - tricarboxylic acid cycle intermediate metabolism [Evidence IEA] codon_start : 1 note : LDH testis subunit; lactate dehydrogenase-X product : lactate dehydrogenase 3, C chain, sperm specific protein_id : NP_038608.1

name	Tsg101 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11230780 CCDS:CCDS21291.1 GeneID:22088 MGI:106581
definition	GO_component : GO:0005634 - nucleus [Evidence IC] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0003714 - transcription corepressor activity [Evidence IDA]; GO:0004842 - ubiquitin-protein ligase activity [Evidence IEA] GO_process : GO:0007050 - cell cycle arrest [Evidence IDA]; GO:0030154 - cell differentiation [Evidence IDA]; GO:0030216 - keratinocyte differentiation [Evidence IDA]; GO:0008285 - negative regulation of cell proliferation [Evidence IDA]; GO:0045892 - negative regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006464 - protein modification [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0001558 - regulation of cell growth [Evidence IDA]; GO:0006810 - transport [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : tumor susceptibility gene 101 protein protein_id : NP_068684.1

name	Uevld (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:104294890 GeneID:54122 MGI:1860490
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0004459 - L-lactate dehydrogenase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0004842 - ubiquitin-protein ligase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006096 - glycolysis [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006100 - tricarboxylic acid cycle intermediate metabolism [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : signaling molecule ATTP protein_id : NP_001035785.1

name	C86187 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257311 GeneID:97402 MGI:2142361
definition	codon_start : 1 product : hypothetical protein LOC97402 protein_id : XP_001477294.1

name	ENSMUSG00000056509 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257313 GeneID:629141 MGI:3642801
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477305.1

name	Spty2d1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51592080 CCDS:CCDS21293.1 GeneID:101685 MGI:2142062
definition	codon_start : 1 note : P16H6 product : SPT2, Suppressor of Ty, domain containing 1 protein_id : NP_780527.2

name	LOC100040174 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257261 GeneID:100040174
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474260.1

name	Tmem86a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312738 GeneID:67893 MGI:1915143
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : hypothetical protein LOC67893 protein_id : NP_080712.1

name	Ptpn5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305425 CCDS:CCDS21294.1 GeneID:19259 MGI:97807
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006470 - protein amino acid dephosphorylation [Evidence IEA] codon_start : 1 exception : mismatches in translation product : protein tyrosine phosphatase, non-receptor type 5 protein_id : NP_038671.1

name	LOC100041710 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257315 GeneID:100041710
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477353.1

name	Mrgpra6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124517722 GeneID:381886 MGI:3033107
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : MrgA6 G protein-coupled receptor product : MAS-related GPR, member A6 protein_id : NP_991390.2

name	EG668725 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257188 GeneID:668725 MGI:3644999
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001471972.1

name	Gm660 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257317 GeneID:269919 MGI:2685506
definition	codon_start : 1 product : similar to G-protein coupled adenine receptor protein_id : XP_195647.6

name	Mrgpra1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346521 CCDS:CCDS21295.1 GeneID:233221 MGI:3033095
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : RF-amide G protein-coupled receptor product : MAS-related GPR, member A1 protein_id : NP_694735.1

name	LOC668727 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94380442 GeneID:668727
definition	codon_start : 1 product : similar to Mrgpra2 protein protein_id : XP_001003345.1

name	Mrgpra2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346531 CCDS:CCDS21296.1 GeneID:235712 MGI:3033098
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : Mas-related gene A2; G protein-coupled receptor MrgA2 product : MAS-related GPR, member A2 protein_id : NP_694741.1

name	LOC638950 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257263 GeneID:638950
definition	codon_start : 1 product : similar to MRGA G protein-coupled receptor protein_id : XP_001474407.1

name	LOC677457 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257265 GeneID:677457
definition	codon_start : 1 product : similar to MAS-related GPR, member A4 protein_id : XP_001474459.1

name	Mrgpra3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346467 CCDS:CCDS21297.1 GeneID:233222 MGI:2684085
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : G protein-coupled receptor; Mas-related gene A3 product : G protein-coupled receptor MRGA3 protein_id : NP_694707.1

name	LOC100040314 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257267 GeneID:100040314
definition	codon_start : 1 product : similar to MAS-related GPR, member A4 protein_id : XP_001474540.1

name	LOC100040106 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040106
definition	number : 3 pseudo : _no_value

name	LOC100040106 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040106
definition	number : 2 pseudo : _no_value

name	LOC100040106 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040106
definition	number : 1 pseudo : _no_value

name	LOC100040217 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040217
definition	number : 2 pseudo : _no_value

name	LOC100040217 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040217
definition	number : 1 pseudo : _no_value

name	EG668729 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668729
definition	number : 2 pseudo : _no_value

name	EG668729 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668729
definition	number : 1 pseudo : _no_value

name	LOC677321 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149257306 GeneID:677321
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 mRNAs, 179 ESTs, 5 Proteins product : similar to ATP synthase, H+ transporting, mitochondrial F0 complex, subunit G pseudo : _no_value transcript_id : XR_032868.1

name	LOC384623 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149257309 GeneID:384623
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 ESTs, 4 Proteins product : similar to RNA polymerase II transcription factor SIII p18 subunit pseudo : _no_value transcript_id : XR_033136.1

name	LOC668846 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149257318 GeneID:668846
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 2 Proteins product : similar to 1300018J18Rik protein pseudo : _no_value transcript_id : XR_033182.1

clone name	MSMg01-531G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-290O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-422J16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423D11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-306H08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-128O08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-322G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-509H22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-089L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-450I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-315P13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-486B14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-454E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-107E06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-370F04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-262M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-489G11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-373K06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-431O15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-325L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-364P07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-107P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-234E14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-234G11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-503L08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-058D19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-061H16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-375D24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-106H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-511C08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-466L09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-072J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-439E20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-049E07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-048P19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-512P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-352B01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-153L08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-418N14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-502D02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-289P06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548E07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-417L20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352O12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-542J22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-046M06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-481K08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-152N01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-321O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-322O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-454J13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-134F14
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-134H12
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-403A24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-400K22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-279K16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-265A01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-405D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-186E15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-141L04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-312C21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-062J12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-410M11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-466N24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-117K19
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-157E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-124M03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-295F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113O21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-118C11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-217G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160H16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215J05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-106J15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016E12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-011D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039B04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-294I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111P08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-321J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183E11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-002C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-119E03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-111I12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045B20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187A13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094K08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046E18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265F12
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-193B17.b	B6Ng01-193B17.g
ACC	GA016171	GA016172
length	509	1,131
definition	B6Ng01-193B17.b	B6Ng01-193B17.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(53,805,137 - 53,805,650)	(53,969,781 - 53,970,906)
sequence	atgtgactttgagtattagtagacgctggaaagatggctgaacgtgtgaa caaaggaagggataaatgagtctacagcctagcagctggggggatgaggg agggagaaacgcctcacattgcatcatggcgggagaggaaggaagcagcg ggtgagaggaaggatgatgatggagaggcaggtgtaacgctgaggaagct ggtgtgactgagcaggtgagaagccaccaagtaggttaaagacaatggga acgagagggaaggaagggggagagagatgacaagggagtgattgactggg ggaccaggagaaaggggacatcaaagtctcacagaagcctggaggcctgt gcctaggactgtgacatcaggaaatgagaggtcggacagagaacaaggtg cttcacagatatcggttcaccgcatccttatgaacttgagattgtggtag tgttgggtcccgaccacatttctcttggctcttcccactactctgacctg tgattgctg	gaattcactggatattatgctttctgcatggaacttgtagtgtgcttctg tgtgaattcagggaagggtgcaatagccttctacagatagaatgcaggga gctatgttggttagaaagcccccacatagccctctggaaacttcctttac agttgggtttcagctggcatgattggagtgcaatgtgctttatattaatg gtccatttgcaaacccttagatagtgggattctaatgaaatacaaggaaa tggagaactagagagttccctgaaatccccttacctataatctttgtttg tatgtgtgtgggtttatgtatgaaatccagtggggtttgttaccagtgtg caaggatagatagctcagcactgcagaagcatcctccaccccacgaaatg gcatgctcatctttgttttcctggccctatagcaggatgaagccttccat tgccatcattctttgcatcttgatcctgggagttgacagccaaagatggg tccagttcatgaaagaagctggtcaaggtaggcttcaaggatgggggctg gaggttgtatttctgagttttaagaatttacttgagcagggaccacataa tcaagggcaaacatgcttgtaaaatccccatagagtggcggtgtagctct tcctgagaagtttgtagcttttttgctcagtgttgacctttttctgtgag gatcccaaatctcagatcctgtaatgtttgtacagcagtctttccacggg aatgtaggtgaaatctgtaggtcaaagatgtagactccccaatagaagtg gggaagaggcctctactgcccccttgtggagagtgatgagcagttcacgt ctatatctggttccagggaagggtgcggagggggaaaaccggggcagcag tgacaacccaacagagacagcaaacaaggctaatttaaggtttgccacac agagtgggcattgtccaaggagcataatgtatgggaaatgaattcataca ttaaaattaattctggtgggccgtaggtgtcactactacctttagaacta tgttacaaagaagcatacgttaagctatccttacttagaaacccctggaa gaagccggaattagcccaaggttagcactat
quality values	Open. Hide. 23 41 47 49 62 47 59 62 62 62 62 62 62 62 43 59 62 59 59 62 59 62 62 59 59 59 59 42 43 32 32 54 54 46 30 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 42 49 54 54 62 62 62 54 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 59 62 62 54 54 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 62 62 62 62 59 62 59 59 62 59 59 62 59 59 62 54 54 62 62 62 62 59 59 56 54 59 62 62 62 62 59 62 62 59 59 59 46 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 62 62 62 59 62 62 62 54 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 54 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 49 54 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 62 62 59 59 62 62 62 51 56 59 62 59 59 49 59 59 59 59 59 56 56 43 54 62 56 50 59 59 54 46 56 49 50 44 59 39 56 50 46 50 62 59 59 59 59 43 49 49 30 34 38 50 43 50 50 50 50 49 56 43 59 59 46 56 48 59 59 34 46 33 51 49 59 49 32 15 17 16 21 16 34 34 49 49 43 49 46 12 25 48 46 34 49 43 49 43 62 48 45 35 46 56 50 38 49 51 56 37 51 50 43 49 43 28 15 45 23 43 46 38 34 17 23 27 10 18 23 21 11 20 18 23 11 15 34 43 30 38 34 29 39 34 62 59 45 45 51 45 45 43 51 38 44 43 45 56 47 51 59 51 51 51 43 56 44 43 59 44 44 62 47 59 47 44 44 35 35 56 38 18 24 22 22 22 24 51 42 38 32 28 24 11 24 14 24 30 13 13 13 18 20 20 30 20 11 12 24 27 20 20 10 11 20 17 17 19 22 20 20 20 20 31 20 20 21 42 31 38 32 25 22 43 27 12 10	Open. Hide. 62 59 44 59 62 47 43 59 62 59 59 46 51 50 29 27 50 59 54 54 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 54 54 62 59 54 54 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 56 42 54 54 62 62 59 62 62 59 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 54 62 62 62 62 54 54 54 52 54 58 58 54 54 58 58 58 58 58 54 58 58 54 54 58 58 58 58 54 52 58 58 58 54 54 54 58 58 58 58 54 54 54 54 58 58 52 58 58 41 41 58 52 58 58 58 58 53 58 58 58 58 42 52 54 58 58 54 58 47 58 46 58 58 58 50 50 51 50 58 47 47 58 58 50 54 58 58 58 58 51 54 50 33 49 45 32 23 47 50 51 52 54 41 51 58 51 54 51 52 58 58 46 53 58 51 50 52 58 58 58 58 37 58 39 49 58 58 58 51 49 43 41 42 46 53 53 41 53 50 40 58 37 31 58 58 29 58 41 42 31 49 58 53 54 37 39 53 50 50 41 12 26 35 33 29 39 41 49 40 52 31 52 52 58 58 58 58 52 50 37 53 39 25 25 38 52 53 50 42 42 41 42 30 54 54 54 41 39 42 54 42 51 49 24 49 31 34 34 54 49 29 54 49 44 49 52 33 30 23 51 40 21 51 42 41 40 33 31 40 54 33 54 44 49 38 31 39 24 32 37 39 30 39 46 34 53 28 17 42 25 42 28 49 36 25 28 34 47 31 40 19 52 32 32 53 49 32 32 45 40 53 32 34 18 40 27 31 29 49 46 31 35 32 53 31 29 29 24 24 45 38 40 36 12 9 45 34 30 16 30 37 14 31 30 41 51 31 31 42 28 37 10 41 30 45 31 36 29 26 30 30 33 30 37 32 37 36 23 41 27 21 27 28 22 21 26 22 35 38 26 17 30 33 23 31 31 34 42 32 30 28 30 30 30 29 36 30 31 24 35 31 34 16 46 25 30 12 36 31 41 48 37 25 34 11 41 20 11 29 12 22 9 31 24 48 39 39 26 13 31 30 22 9 7 17 46 48 35 33 32 25 19 6 5 11 37 18 6 10 29 20 28 8 5 6 15 17 7 17 16 19 17 13 24 23 30 38 32 22 16 17 29 31 17 33 14 24 9 44 17 19 31 10 6 35 48 20 23 16 16 6 19 21 21 21 14 20 6 11 25 43 34 32 10 9 31 31 24 32 32 14 11 15 6 6 8 31 32 21 10 25 6 24 8 19 25 17 43 11 34 48 18 10 13 17 25 10 11 27 15 19 10 6 4 18 21 24 30 26 22 6 18 8 19 5 5 3 4 8 20 14 10 34 10 10 10 17 10 19 21 21 11 14 14 16 16 23 20 14 27 15 24 16 21 4 15 7 13 4 7 5 3 3 3 3 3 5 8 7 14 16 27 8 6 5 12 5 12 8 17 6 23 7 5 11 13 11 14 9 5 7 23 6 5 25 9 15 20 10 25 10 4 12 18 20 11 20 24 21 13 9 9 13 8 7 9 11 4 5 13 5 5 20 3 5 3 8 5 11 23 13 5 5 11 6 2 4 6 6 3 1 2 5 8 8

Alignment Information

BAC End 1

BAC End 2

seq1: chr7_53805137_53805650
seq2: B6Ng01-193B17.b_43_557

seq1  GAATTCATGTGACTTTGAGTATTAGTAGACGCTGGAAAGATGGCTGAACG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCATGTGACTTTGAGTATTAGTAGACGCTGGAAAGATGGCTGAACG  50

seq1  TGTGAACAAAGGAAGGGATAAATGAGTCTACAGCCTAGCAGCTGGGGGGA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGAACAAAGGAAGGGATAAATGAGTCTACAGCCTAGCAGCTGGGGGGA  100

seq1  TGAGGGAGGGAGAAACGCCTCACATTGCATCATGGCGGGAGAGGAAGGAA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGGGAGGGAGAAACGCCTCACATTGCATCATGGCGGGAGAGGAAGGAA  150

seq1  GCAGCGGGTGAGAGGAAGGATGATGATGGAGAGGCAGGTGTAACGCTGAG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAGCGGGTGAGAGGAAGGATGATGATGGAGAGGCAGGTGTAACGCTGAG  200

seq1  GAAGCTGGTGTGACTGAGCAGGTGAGAAGCCACCAAGTAGGTTAAAGACA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAGCTGGTGTGACTGAGCAGGTGAGAAGCCACCAAGTAGGTTAAAGACA  250

seq1  ATGGGAACGAGAGGGAAGGAAGGGGGAGAGAGATGACAAGGGAGTGATTG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGGGAACGAGAGGGAAGGAAGGGGGAGAGAGATGACAAGGGAGTGATTG  300

seq1  ACTGGGGGACCAGGAGAAAGGGGACATCAAAGTCTCACAGAAGCCTGGAG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGGGGGACCAGGAGAAAGGGGACATCAAAGTCTCACAGAAGCCTGGAG  350

seq1  GCCTGTGCCTAGGACTGTGACATCAGGAAATGAGAGGTCGGACAGAGAAC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCTGTGCCTAGGACTGTGACATCAGGAAATGAGAGGTCGGACAGAGAAC  400

seq1  AAGGTGCTTCACAGATATCGGTTCACCGCATCCTTATGAACTTGAGATTG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGTGCTTCACAGATATCGGTTCACCGCATCCTTATGAACTTGAGATTG  450

seq1  TGGTAGTGTTGGGTCCCGACCACATTTCTCTTGGCCCTT-CCACTACTCT  499
      ||||||||||||||||||||||||||||||||||| ||| ||||||||||
seq2  TGGTAGTGTTGGGTCCCGACCACATTTCTCTTGGCTCTTCCCACTACTCT  500

seq1  GACCTGTGATTGCTG  514
      |||||||||||||||
seq2  GACCTGTGATTGCTG  515

seq1: chr7_53969781_53970906
seq2: B6Ng01-193B17.g_64_1194 (reverse)

seq1  ATAGTGGCTAACC-TGGGCTAAATTCTGC-TCTTCCAGGGGTTTTCTAAG  48
      ||||| ||||||| |||||||| | | || ||||||||||| ||||||||
seq2  ATAGT-GCTAACCTTGGGCTAATTCCGGCTTCTTCCAGGGG-TTTCTAAG  48

seq1  TAA-GATAGCTT-ACGTATGC-TCTTTGT-ACATTGGTTTCCTTAAAGGG  94
      ||| |||||||| |||||||| ||||||| |||| |  |||  |||| ||
seq2  TAAGGATAGCTTAACGTATGCTTCTTTGTAACATAG--TTC--TAAA-GG  93

seq1  TAGTAGTGACACCTACG--CCACAAG-ATTAATTTTAATGTATGGAATTC  141
      |||||||||||||||||  |||| || |||||||||||||||| ||||||
seq2  TAGTAGTGACACCTACGGCCCACCAGAATTAATTTTAATGTAT-GAATTC  142

seq1  ATTT-CCATACATTATGCTCCTTGGACAATGCCCACTCTGTGTGGCAAAC  190
      |||| |||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTCCCATACATTATGCTCCTTGGACAATGCCCACTCTGTGTGGCAAAC  192

seq1  --TTAATTAGCCTTGTTTGCTGTCTCTG-TGGGTTGTCACCTGCTGCCCC  237
        | |||||||||||||||||||||||| |||||||||| ||||||||||
seq2  CTTAAATTAGCCTTGTTTGCTGTCTCTGTTGGGTTGTCA-CTGCTGCCCC  241

seq1  GGTTTTCCCCCTCCGCA-CCTTCCCTGGAACCAGATATAGACGTGAACTG  286
      ||||||||||||||||| ||||||||||||||||||||||||||||||||
seq2  GGTTTTCCCCCTCCGCACCCTTCCCTGGAACCAGATATAGACGTGAACTG  291

seq1  CTCATCACTCTCCACAAGGGGGCAGTAGAGGCCTCTTCCCCACTTCTATT  336
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCATCACTCTCCACAAGGGGGCAGTAGAGGCCTCTTCCCCACTTCTATT  341

seq1  GGGGAGTCTACATCTTTGACCTACAGATTTCACCTACATTCCCGTGGAAA  386
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGGAGTCTACATCTTTGACCTACAGATTTCACCTACATTCCCGTGGAAA  391

seq1  GACTGCTGTACAAACATTACAGGATCTGAGATTTGGGATCCTCACAGAAA  436
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACTGCTGTACAAACATTACAGGATCTGAGATTTGGGATCCTCACAGAAA  441

seq1  AAGGTCAACACTGAGCAAAAAAGCTACAAACTTCTCAGGAAGAGCTACAC  486
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGTCAACACTGAGCAAAAAAGCTACAAACTTCTCAGGAAGAGCTACAC  491

seq1  CGCCACTCTATGGGGATTTTACAAGCATGTTTGCCCTTGATTATGTGGTC  536
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGCCACTCTATGGGGATTTTACAAGCATGTTTGCCCTTGATTATGTGGTC  541

seq1  CCTGCTCAAGTAAATTCTTAAAACTCAGAAATACAACCTCCAGCCCCCAT  586
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGCTCAAGTAAATTCTTAAAACTCAGAAATACAACCTCCAGCCCCCAT  591

seq1  CCTTGAAGCCTACCTTGACCAGCTTCTTTCATGAACTGGACCCATCTTTG  636
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTTGAAGCCTACCTTGACCAGCTTCTTTCATGAACTGGACCCATCTTTG  641

seq1  GCTGTCAACTCCCAGGATCAAGATGCAAAGAATGATGGCAATGGAAGGCT  686
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTGTCAACTCCCAGGATCAAGATGCAAAGAATGATGGCAATGGAAGGCT  691

seq1  TCATCCTGCTATAGGGCCAGGAAAACAAAGATGAGCATGCCATTTCGTGG  736
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATCCTGCTATAGGGCCAGGAAAACAAAGATGAGCATGCCATTTCGTGG  741

seq1  GGTGGAGGATGCTTCTGCAGTGCTGAGCTATCTATCCTTGCACACTGGTA  786
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTGGAGGATGCTTCTGCAGTGCTGAGCTATCTATCCTTGCACACTGGTA  791

seq1  ACAAACCCCACTGGATTTCATACATAAACCCACACACATACAAACAAAGA  836
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAAACCCCACTGGATTTCATACATAAACCCACACACATACAAACAAAGA  841

seq1  TTATAGGTAAGGGGATTTCAGGGAACTCTCTAGTTCTCCATTTCCTTGTA  886
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTATAGGTAAGGGGATTTCAGGGAACTCTCTAGTTCTCCATTTCCTTGTA  891

seq1  TTTCATTAGAATCCCACTATCTAAGGGTTTGCAAATGGACCATTAATATA  936
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCATTAGAATCCCACTATCTAAGGGTTTGCAAATGGACCATTAATATA  941

seq1  AAGCACATTGCACTCCAATCATGCCAGCTGAAACCCAACTGTAAAGGAAG  986
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGCACATTGCACTCCAATCATGCCAGCTGAAACCCAACTGTAAAGGAAG  991

seq1  TTTCCAGAGGGCTATGTGGGGGCTTTCTAACCAACATAGCTCCCTGCATT  1036
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCCAGAGGGCTATGTGGGGGCTTTCTAACCAACATAGCTCCCTGCATT  1041

seq1  CTATCTGTAGAAGGCTATTGCACCCTTCCCTGAATTCACACAGAAGCACA  1086
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTATCTGTAGAAGGCTATTGCACCCTTCCCTGAATTCACACAGAAGCACA  1091

seq1  CTACAAGTTCCATGCAGAAAGCATAATATCCAGTGAATTC  1126
      ||||||||||||||||||||||||||||||||||||||||
seq2  CTACAAGTTCCATGCAGAAAGCATAATATCCAGTGAATTC  1131

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information