MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-199F21
Chromosome	7 (Build37)
Map Location	48,137,419 - 48,178,801
singlet/doublet	doublet
Overlap gene	LOC100039094, 2900093B09Rik
Upstream gene	EG628161
Downstream gene	4930433I11Rik, EG233164, LOC668555, EG627987, LOC100039269, LOC545955, EG628304, LOC668561, EG434172, LOC100039221, LOC668565, AI987944, EG269902, LOC100039375, EG628359, 2610021A01Rik, 2810426N06Rik, LOC668576, Gprc2a-rs5, LOC628372, EG668579, EG628403, EG628422
Link	Open Mouse BAC browser

Click to get alignment info.

name	EG628161 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628161 MGI:3643618
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 42 ESTs, 4 Proteins

name	LOC100039094 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039094
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	2900093B09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58188 MGI:1914525
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930433I11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243944 MGI:2685327
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG233164 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233164 MGI:3649090
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668555 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668555
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	EG627987 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627987 MGI:3647709
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC100039269 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039269
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 2 ESTs, 7 Proteins

name	LOC545955 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545955
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 12 Proteins pseudo : _no_value

name	EG628304 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628304 MGI:3646160
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins

name	LOC668561 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668561
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	EG434172 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434172 MGI:3648691
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039221 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039221
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC668565 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668565
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins pseudo : _no_value

name	AI987944 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233168 MGI:2142079
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG269902 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269902 MGI:3703084
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039375 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039375
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 42 ESTs, 9 Proteins pseudo : _no_value

name	EG628359 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628359 MGI:3643456
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	2610021A01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668572 MGI:1922662
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 27 ESTs, 4 Proteins

name	2810426N06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67607 MGI:1914857
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668576 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668576
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 29 ESTs, 4 Proteins pseudo : _no_value

name	Gprc2a-rs5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75835 MGI:1351350
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC628372 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628372
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	EG668579 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668579 MGI:3645134
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	EG628403 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628403 MGI:3647693
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 11 Proteins

name	EG628422 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628422 MGI:3647877
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 25 Proteins

name	EG628161 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380356 GeneID:628161 MGI:3643618
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 42 ESTs, 4 Proteins product : predicted gene, EG628161 transcript_id : XM_892890.2

name	LOC100039094 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257200 GeneID:100039094
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100039094 transcript_id : XM_001472249.1

name	2900093B09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370338 GeneID:58188 MGI:1914525
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2900093B09 gene transcript_id : NM_021387.2

name	4930433I11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801797 GeneID:243944 MGI:2685327
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930433I11 gene transcript_id : NM_207248.2

name	EG233164 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:139948924 GeneID:233164 MGI:3649090
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG233164 transcript_id : NM_183166.2

name	LOC100039269 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257211 GeneID:100039269
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 2 ESTs, 7 Proteins product : hypothetical protein LOC100039269 transcript_id : XM_001472401.1

name	EG628304 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380357 GeneID:628304 MGI:3646160
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins product : predicted gene, EG628304 transcript_id : XM_001002281.1

name	EG434172 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345369 GeneID:434172 MGI:3648691
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG434172 transcript_id : NM_001033782.2

name	AI987944 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130718 GeneID:233168 MGI:2142079
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AI987944 transcript_id : NM_183167.3

name	EG269902 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369995 GeneID:269902 MGI:3703084
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG269902 transcript_id : NM_177764.3

name	EG628359 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257209 GeneID:628359 MGI:3643456
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG628359 transcript_id : XM_893095.3

name	2810426N06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:130493405 GeneID:67607 MGI:1914857
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2810426N06 gene transcript_id : NM_023363.2

name	Gprc2a-rs5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803327 GeneID:75835 MGI:1351350
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor, family C, group 2, member A, related sequence 5 transcript_id : NM_029460.2

name	EG628403 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257216 GeneID:628403 MGI:3647693
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 11 Proteins product : predicted gene, EG628403 transcript_id : XM_893137.2

name	EG628422 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257218 GeneID:628422 MGI:3647877
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 25 Proteins product : predicted gene, EG628422 transcript_id : XM_145558.7

name	EG628161 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82905251 GeneID:628161 MGI:3643618
definition	codon_start : 1 product : hypothetical protein protein_id : XP_897983.1

name	LOC100039094 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257201 GeneID:100039094
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472299.1

name	2900093B09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946730 CCDS:CCDS21160.1 GeneID:58188 MGI:1914525
definition	codon_start : 1 function : expression of this gene product inhibits the growth of E. coli product : hypothetical protein LOC58188 protein_id : NP_067362.1

name	4930433I11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46402245 GeneID:243944 MGI:2685327
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC243944 protein_id : NP_997131.1

name	EG233164 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:139948925 GeneID:233164 MGI:3649090
definition	codon_start : 1 product : hypothetical protein LOC233164 protein_id : NP_898989.2

name	LOC100039269 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257212 GeneID:100039269
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472451.1

name	EG628304 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94380358 GeneID:628304 MGI:3646160
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001002281.1

name	EG434172 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702095 GeneID:434172 MGI:3648691
definition	codon_start : 1 product : hypothetical protein LOC434172 protein_id : NP_001028954.1

name	AI987944 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34147201 GeneID:233168 MGI:2142079
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : hypothetical protein LOC233168 protein_id : NP_898990.1

name	EG269902 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244266 GeneID:269902 MGI:3703084
definition	codon_start : 1 product : hypothetical protein LOC269902 protein_id : NP_808432.1

name	EG628359 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257210 GeneID:628359 MGI:3643456
definition	codon_start : 1 product : similar to EG435970 protein protein_id : XP_898188.3

name	2810426N06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789173 GeneID:67607 MGI:1914857
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : hypothetical protein LOC67607 protein_id : NP_075852.1

name	Gprc2a-rs5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386402 GeneID:75835 MGI:1351350
definition	codon_start : 1 note : calcium sensing receptor, related sequence 5 product : G protein-coupled receptor, family C, group 2, member A, related sequence 5 protein_id : NP_083736.1

name	EG628403 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257217 GeneID:628403 MGI:3647693
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_898230.2

name	EG628422 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257219 GeneID:628422 MGI:3647877
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_145558.7

name	LOC668555 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668555
definition	number : 1 pseudo : _no_value

name	LOC668555 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668555
definition	number : 2 pseudo : _no_value

name	LOC668555 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668555
definition	number : 3 pseudo : _no_value

name	EG627987 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627987
definition	number : 1 pseudo : _no_value

name	EG627987 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627987
definition	number : 2 pseudo : _no_value

name	EG627987 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627987
definition	number : 3 pseudo : _no_value

name	LOC668561 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668561
definition	number : 1 pseudo : _no_value

name	LOC668561 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668561
definition	number : 2 pseudo : _no_value

name	LOC100039221 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039221
definition	number : 1 pseudo : _no_value

name	LOC100039221 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039221
definition	number : 2 pseudo : _no_value

name	LOC100039221 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039221
definition	number : 3 pseudo : _no_value

name	LOC100039221 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039221
definition	number : 4 pseudo : _no_value

name	LOC628372 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628372
definition	number : 3 pseudo : _no_value

name	LOC628372 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628372
definition	number : 2 pseudo : _no_value

name	LOC628372 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628372
definition	number : 1 pseudo : _no_value

name	EG668579 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668579
definition	number : 2 pseudo : _no_value

name	EG668579 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668579
definition	number : 1 pseudo : _no_value

name	LOC545955 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149257213 GeneID:545955
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 12 Proteins product : similar to heterogeneous nuclear ribonucleoprotein A3 pseudo : _no_value transcript_id : XR_030710.1

name	LOC668565 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149257208 GeneID:668565
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : similar to protein kinase C binding protein 1 pseudo : _no_value transcript_id : XR_030730.1

name	LOC100039375 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149257224 GeneID:100039375
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 42 ESTs, 9 Proteins product : similar to ornithine decarboxylase pseudo : _no_value transcript_id : XR_030737.1

name	2610021A01Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149257214 GeneID:668572 MGI:1922662
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 27 ESTs, 4 Proteins product : RIKEN cDNA 2610021A01 gene transcript_id : XR_030795.1

name	LOC668576 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149257215 GeneID:668576
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 29 ESTs, 4 Proteins product : similar to Phosphoglycerate dehydrogenase pseudo : _no_value transcript_id : XR_035655.1

clone name	MSMg01-524J04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-487E02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-432D09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-493P01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-345N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-269I18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548L21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-147D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529H12
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-085J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-542D16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-474F10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-278I16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-278C16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-516G04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-473B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-209M11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-384J22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-188I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-356P01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-378H18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-083M07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-087I14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-499M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-363E14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-464J16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416B01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-168M13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-470J23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-120F01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309J05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-446K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-528E06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-133J07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-454O21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-421I11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-412A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-375O23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052D03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-519L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-326L23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-318G16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-427A03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-467A11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-505O16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-337G20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-075B11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-336F03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-312E15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-301H15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-337L18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-457F02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-104F19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-463P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-302N05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-407I10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-495L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298N07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139G24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193G23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-292I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264F16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184P12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-014K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176P09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084G24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136M09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-164B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030J20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-219B24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-277B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-338K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103O04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123O16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283M23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-339P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-192J15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181L05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110J21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-335A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253I02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-175P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170E20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344P14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034F13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-091O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167N15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-060I24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-167A03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-055L22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065E21
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-199F21.b	B6Ng01-199F21.g
ACC	GA020718	GA020719
length	1,144	1,122
definition	B6Ng01-199F21.b	B6Ng01-199F21.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(48,177,663 - 48,178,801)	(48,137,419 - 48,138,546)
sequence	gaattcctgttgtgatgtttagcactgggctacaggtctactctgtatgt ggggcctgagtctctacctcctagacttccagatgcagccaaaactgttc actgctttctgaactggtaagtgcaactctgcttgaccttgtagagcaca agtacacaatgctggatagatgtgtttggctcagctgggatgggctcact aatctcctttctgacactcgtaggcgactgaatagagactgaatagatag gtggtaagctgaactgattggatgctaacagcctctcatctatttcttcc ctttcagaggagaacaaggaatagtgctggagtacacataagtatatgag tcataataaagctggaaacttgggcagcctggaaggtgaggaaagccctg ggaagcagtctggctgattcatcttcacctcaaaccaagcactgctgcct tgatttttcgttgttgttgttgttttttttcaagacagggtttctctgtg tagtcctggctatcctggaactcactctgtaaaccaggctggcctcgaac tcagaaatccacctgcctctgcctcccaagtgctgggattaaaggcgtgc accaccacacctggcttgattgttcttaatgaaactgaactgtctttagc tcaagatgaaggtaaaaaaaattaatgtttatcatttaggaagtgagaag gaaaatagatactctggaatcatttaaaagagactctgaatcaagtggag tggcacataatctcaacacttaggcagaaggattaaacgtttcgtcagcc tggattacatactgagacctgacaccacgtttgtgtaagaggaggaaaat gaaaggaggaaaggtagagaggaaaaggaagtagggaaacagaggacgaa tgggaagtgcagataataaatataatatgaagaaaacccagaaaggaata catgaatattgggtggatgtgctcgcatgtatatactctctctctctctc tctctctctcactctctcacacacacacatgcacaccatgcacacatgca ccacatctcattctagcattcttttgtctgggaaaattcctcattctatt tatccagccaccaggagaatttctaagcctggtcagaaagtgta	gaattctccttccaacatcttttcacaggcactggtgtggggcataccaa gcataatccacaatgttaaaacaagtcagataattgtctttcctgcattg taaattactttcttttaagaaacacattaaagcaaaatgtgtgtgtgtgt gtgtatgtgtggtttaaaacgaaaagccattttcctcactagtattattt tagatgagctaaatggtgttagttcttaaattgaaatgaaggggaaaagt atgcacaagctatggacaattttaattttcaacacttgcagggtgaataa tactgccgatgtcgtgaagagtttctatggtggtttatactcatttgcct aaacactccgctccagactgcagtactgaagaattaaaaggtgacttgag cctgttagtatgttctctacgcttctcagaaaaaagaccctggctgcagc tattgtcagagtcataaggtatcctgtggccctcataggaaacagccatt gaagaaggttcatttggtgagcttgattgcagcctgtcaaaaccaaaaga gagccatgtcactcctgcaaatgattctatggccagccagaagcagcacc tctcactacaggacatccaaaggggacagtgtagccagcaggatgcaagt accttaaacccaaagcccattattccacaatgtctgctgatagcttgaaa agaacacacagtcttcaaatcaagaaagtttctcttcccttcactcagag ccaggatgaaattaatcaagccacaagatgtatccaggctcagcacattt ctaccccaaggtcagagcctattctggagtccatcccaagctcaaaagag ccaggccaaaggaagtgtgtacagcttctcaggacaaagctccttctacg ttatagagaccagagaccatgggagaacaatcatcagcgtggtcagccac ctggtggtctatcctcggccacctgtggtctatccccagctctgctccaa gcacagctcacttataccccactctagtttcatgtaactattctcaagct ctggatgagtgtttggtcccatggccagtactcttgccttatagtttttc tgctgctggtgataaacactga
quality values	Open. Hide. 58 26 22 30 58 58 58 54 58 58 58 58 58 58 28 21 29 36 58 41 47 62 62 52 47 62 62 62 62 62 54 56 62 47 62 62 62 62 62 62 35 62 62 62 62 49 62 54 62 62 62 62 62 59 62 62 62 59 59 59 59 62 62 62 59 62 62 62 62 62 62 59 62 62 59 62 62 62 49 46 47 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 49 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 47 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 58 58 58 58 58 42 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 54 58 58 58 58 54 58 54 58 58 58 58 58 54 58 58 52 58 54 54 58 58 58 58 58 54 52 58 58 54 54 54 58 58 58 58 58 58 40 58 51 53 51 58 58 51 58 53 49 50 58 58 51 50 48 49 46 58 41 47 58 58 58 54 51 58 58 58 41 48 49 58 47 48 58 50 54 58 50 54 58 58 58 36 28 43 50 58 50 51 58 39 47 51 58 50 31 44 58 50 49 58 50 58 50 49 58 51 58 49 49 58 50 54 39 37 58 58 39 50 50 58 50 47 41 42 58 51 58 50 50 51 51 58 44 43 51 58 52 50 53 58 53 53 41 49 53 42 39 52 52 41 25 39 52 53 26 39 29 32 54 54 54 54 54 54 36 50 52 45 32 33 44 28 54 54 41 50 45 36 52 38 39 39 19 51 49 53 42 53 52 52 42 53 41 20 33 31 54 54 19 31 53 45 42 52 42 45 53 53 42 49 54 42 25 38 37 33 32 54 53 39 54 54 49 27 54 26 31 27 47 40 42 40 46 37 40 42 33 31 33 52 51 31 47 24 32 46 31 32 31 47 32 53 41 29 31 42 52 43 41 29 40 26 32 33 45 32 10 53 32 31 33 53 41 9 52 28 20 45 30 46 30 32 31 31 51 36 36 32 32 39 29 28 33 31 30 16 24 7 15 31 31 36 33 37 29 31 30 33 34 29 30 17 23 31 31 33 29 21 29 36 24 32 28 32 48 31 43 31 43 31 21 29 13 35 18 23 42 26 33 31 48 48 31 32 31 12 46 15 33 21 41 26 31 11 46 13 33 31 22 31 31 36 13 29 22 32 33 47 46 44 23 44 21 33 22 28 11 23 46 15 19 47 31 31 17 21 39 12 23 31 32 21 30 22 31 32 48 35 37 31 26 28 32 32 23 18 31 12 29 13 22 20 44 15 26 17 16 25 14 19 29 14 36 17 30 17 20 44 38 32 9 44 25 10 11 29 41 31 6 13 31 18 25 21 22 12 13 23 13 15 30 5 5 7 30 39 18 11 12 26 17 19 26 18 33 29 16 19 7 14 23 25 32 9 9 8 8 8 19 18 26 21 31 16 8 19 7 19 17 19 20 16 15 18 8 10 10 7 5 6 9 8 29 6 12 6 17 5 6 6 18 10 13 4 9 5 15 10 11 9 17 11 8 19 28 22 28 10 20 10 7 10 13 15 16 10 8 6 9 11 13 14 10 7 14 5 6 17 8 28 13 14 7 27 7 9 6 13 30 16 17 20 19 7 17 7 32 7 7 6 5 10 19 8 26 13 10 30 28 11 7 20 8 16 3 6 11 15 16 14 9 9 14 21 14 10 9 7 11 16 8 5 4 13 6 10 7 8 4 17 6 8 7 4 25 15 6 6 17 9 4 3 2 3 4 1 1 5 4 4 9 9 2 2 2 4 4 4	Open. Hide. 62 47 40 37 62 62 62 62 62 62 62 62 39 22 44 59 29 46 46 46 59 62 62 59 43 59 59 62 62 59 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 54 62 62 62 62 62 62 62 62 62 54 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 38 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 45 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 41 62 62 62 58 58 58 58 58 58 52 54 58 58 54 58 58 58 58 58 58 54 58 52 58 58 58 58 58 58 58 58 58 54 58 58 46 58 58 54 58 58 52 47 41 58 58 58 54 58 54 58 58 58 58 54 58 54 54 58 52 58 58 58 58 58 52 58 58 41 54 41 58 58 53 58 58 58 58 58 50 58 58 51 51 58 58 58 46 41 58 58 51 50 53 54 58 58 58 58 51 53 51 58 48 30 43 47 58 58 58 58 58 52 58 52 48 43 50 54 58 58 52 52 53 58 53 58 58 58 49 50 58 58 44 58 39 29 58 58 53 58 58 58 54 42 50 50 52 49 44 40 40 58 58 37 53 53 50 50 42 47 44 51 51 51 52 50 40 54 50 50 47 33 58 54 36 35 51 50 43 50 49 46 50 58 58 51 39 25 47 52 42 54 49 51 40 51 53 36 53 52 53 37 54 33 30 50 38 33 50 52 53 39 42 44 50 52 42 49 39 31 31 44 26 44 47 49 38 50 25 35 42 52 42 35 44 29 38 32 42 41 46 52 54 42 53 39 51 37 42 52 33 37 52 33 52 41 44 51 41 54 54 53 37 53 53 37 40 41 52 53 42 33 35 52 32 41 31 43 52 30 38 32 32 38 32 52 49 41 31 35 52 40 32 32 41 41 43 35 52 32 32 32 32 29 33 47 31 21 21 35 15 34 36 24 32 39 31 31 36 51 46 27 23 33 28 30 31 31 30 34 30 40 31 31 35 27 33 31 41 29 43 37 34 42 31 43 25 31 45 31 31 31 36 30 31 30 31 20 22 47 31 31 35 31 27 40 33 29 23 27 37 42 24 28 27 18 42 14 20 23 31 27 40 22 25 29 46 31 31 17 31 33 31 26 31 24 42 31 18 30 30 31 31 29 24 46 46 39 21 38 17 31 29 21 30 39 23 28 25 41 34 24 32 14 20 21 34 37 32 37 30 30 31 30 36 20 33 22 31 31 30 13 7 21 38 19 19 46 31 22 21 37 18 22 18 38 26 32 35 33 27 37 36 22 25 26 24 36 28 28 13 26 21 21 32 17 18 6 19 24 33 32 47 21 24 12 8 22 6 14 21 32 29 31 38 33 35 24 31 32 18 16 4 8 27 31 15 16 12 16 20 21 16 27 11 22 8 23 4 14 10 7 6 17 27 18 17 7 26 18 5 6 14 21 21 21 10 14 33 15 31 27 32 32 32 31 24 14 20 23 19 34 28 23 29 23 17 9 16 12 16 27 27 20 14 13 27 20 23 9 26 17 18 10 27 27 19 28 28 34 15 18 16 20 13 7 8 11 20 40 20 11 25 6 8 5 3 4 21 16 6 15 7 17 14 14 28 11 3 5 14 10 3 7 7 12 3 4 6 5 4 8 8 28 11 11 13 6 18 26 13 3 3 10 16 6 8 11 10 19 16 21 16 8 5 7 8 15 19 4 5 17 6 5 11 6 28 30 28 11 15 4 9 18 10 14 16 6 5 17 8 11 16 7 15 27 16 9 5 17 8 15 5

Alignment Information

BAC End 1

BAC End 2

seq1: chr7_48177663_48178801
seq2: B6Ng01-199F21.b_44_1187 (reverse)

seq1  TACACTTTTCTGACAGGGCTTTAGAAA-TCTTCT-GTTGCTGGATAAATA  48
      ||||| ||||||||  ||| ||||||| ||| || || ||||||||||||
seq2  TACAC-TTTCTGACCAGGC-TTAGAAATTCTCCTGGTGGCTGGATAAATA  48

seq1  GAAATGAGGAATTTT-CCAGAC-AAAGGATGCTTAGATTGAGATGT-GTG  95
      | ||||||||||||| |||||| |||| |||| |||| |||||||| |||
seq2  G-AATGAGGAATTTTCCCAGACAAAAGAATGC-TAGAATGAGATGTGGTG  96

seq1  CATGTGTGCAT-GTGTGCATGTGTGTGTGTGAGAGAGTGAGAGAGAGAGA  144
      ||||||||||| ||||||||||||||||||||||||||||||||||||||
seq2  CATGTGTGCATGGTGTGCATGTGTGTGTGTGAGAGAGTGAGAGAGAGAGA  146

seq1  GAGAGAGAGAGAGTATATACATGCGAGCACATCCACCC-ATATTCATTGT  193
      |||||||||||||||||||||||||||||||||||||| ||||||| |||
seq2  GAGAGAGAGAGAGTATATACATGCGAGCACATCCACCCAATATTCA-TGT  195

seq1  ATT-CTTTCT-GGTTTTCTTCATTATTATATTTATTATCTGCACTTCCCA  241
      ||| |||||| ||||||||||| |||||||||||||||||||||||||||
seq2  ATTCCTTTCTGGGTTTTCTTCA-TATTATATTTATTATCTGCACTTCCCA  244

seq1  TTCGTCCTCTGTTTCCCTACTTCCTTTTCCTCTCTACC-TTCCTCC-TTC  289
      |||||||||||||||||||||||||||||||||||||| ||||||| |||
seq2  TTCGTCCTCTGTTTCCCTACTTCCTTTTCCTCTCTACCTTTCCTCCTTTC  294

seq1  ATTTTCCTCCTCTTACACAAACGTGGTGTCAGGTCTCAGTATGTAATCCA  339
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTTCCTCCTCTTACACAAACGTGGTGTCAGGTCTCAGTATGTAATCCA  344

seq1  GGCTGACGAAACGTTTAATCCTTCTGCCTAAGTGTTGAGATTATGTGCCA  389
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCTGACGAAACGTTTAATCCTTCTGCCTAAGTGTTGAGATTATGTGCCA  394

seq1  CTCCACTTGATTCAGAGTCTCTTTTAAATGATTCCAGAGTATCTATTTTC  439
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCACTTGATTCAGAGTCTCTTTTAAATGATTCCAGAGTATCTATTTTC  444

seq1  CTTCTCACTTCCTAAATGATAAACATTAATTTTTTTTACCTTCATCTTGA  489
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCTCACTTCCTAAATGATAAACATTAATTTTTTTTACCTTCATCTTGA  494

seq1  GCTAAAGACAGTTCAGTTTCATTAAGAACAATCAAGCCAGGTGTGGTGGT  539
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTAAAGACAGTTCAGTTTCATTAAGAACAATCAAGCCAGGTGTGGTGGT  544

seq1  GCACGCCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGGTGGATTTCTGA  589
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCACGCCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGGTGGATTTCTGA  594

seq1  GTTCGAGGCCAGCCTGGTTTACAGAGTGAGTTCCAGGATAGCCAGGACTA  639
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTCGAGGCCAGCCTGGTTTACAGAGTGAGTTCCAGGATAGCCAGGACTA  644

seq1  CACAGAGAAACCCTGTCTTGAAAAAAAACAACAACAACAACGAAAAATCA  689
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACAGAGAAACCCTGTCTTGAAAAAAAACAACAACAACAACGAAAAATCA  694

seq1  AGGCAGCAGTGCTTGGTTTGAGGTGAAGATGAATCAGCCAGACTGCTTCC  739
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGCAGCAGTGCTTGGTTTGAGGTGAAGATGAATCAGCCAGACTGCTTCC  744

seq1  CAGGGCTTTCCTCACCTTCCAGGCTGCCCAAGTTTCCAGCTTTATTATGA  789
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGGCTTTCCTCACCTTCCAGGCTGCCCAAGTTTCCAGCTTTATTATGA  794

seq1  CTCATATACTTATGTGTACTCCAGCACTATTCCTTGTTCTCCTCTGAAAG  839
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCATATACTTATGTGTACTCCAGCACTATTCCTTGTTCTCCTCTGAAAG  844

seq1  GGAAGAAATAGATGAGAGGCTGTTAGCATCCAATCAGTTCAGCTTACCAC  889
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAAGAAATAGATGAGAGGCTGTTAGCATCCAATCAGTTCAGCTTACCAC  894

seq1  CTATCTATTCAGTCTCTATTCAGTCGCCTACGAGTGTCAGAAAGGAGATT  939
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTATCTATTCAGTCTCTATTCAGTCGCCTACGAGTGTCAGAAAGGAGATT  944

seq1  AGTGAGCCCATCCCAGCTGAGCCAAACACATCTATCCAGCATTGTGTACT  989
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGAGCCCATCCCAGCTGAGCCAAACACATCTATCCAGCATTGTGTACT  994

seq1  TGTGCTCTACAAGGTCAAGCAGAGTTGCACTTACCAGTTCAGAAAGCAGT  1039
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGCTCTACAAGGTCAAGCAGAGTTGCACTTACCAGTTCAGAAAGCAGT  1044

seq1  GAACAGTTTTGGCTGCATCTGGAAGTCTAGGAGGTAGAGACTCAGGCCCC  1089
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAACAGTTTTGGCTGCATCTGGAAGTCTAGGAGGTAGAGACTCAGGCCCC  1094

seq1  ACATACAGAGTAGACCTGTAGCCCAGTGCTAAACATCACAACAGGAATTC  1139
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATACAGAGTAGACCTGTAGCCCAGTGCTAAACATCACAACAGGAATTC  1144

seq1: chr7_48137419_48138546
seq2: B6Ng01-199F21.g_60_1181

seq1  GAATTCTCCTTCCAACATCTTTTCACAGGCACTGGTGTGGGGCATACCAA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTCCTTCCAACATCTTTTCACAGGCACTGGTGTGGGGCATACCAA  50

seq1  GCATAATCCACAATGTTAAAACAAGTCAGATAATTGTCTTTCCTGCATTG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCATAATCCACAATGTTAAAACAAGTCAGATAATTGTCTTTCCTGCATTG  100

seq1  TAAATTACTTTCTTTTAAGAAACACATTAAAGCAAAATGTGTGTGTGTGT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAATTACTTTCTTTTAAGAAACACATTAAAGCAAAATGTGTGTGTGTGT  150

seq1  GTGTATGTGTGGTTTAAAACGAAAAGCCATTTTCCTCACTAGTATTATTT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTATGTGTGGTTTAAAACGAAAAGCCATTTTCCTCACTAGTATTATTT  200

seq1  TAGATGAGCTAAATGGTGTTAGTTCTTAAATTGAAATGAAGGGGAAAAGT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGATGAGCTAAATGGTGTTAGTTCTTAAATTGAAATGAAGGGGAAAAGT  250

seq1  ATGCACAAGCTATGGACAATTTTAATTTTCAACACTTGCAGGGTGAATAA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGCACAAGCTATGGACAATTTTAATTTTCAACACTTGCAGGGTGAATAA  300

seq1  TACTGCCGATGTCGTGAAGAGTTTCTATGGTGGTTTATACTCATTTGCCT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACTGCCGATGTCGTGAAGAGTTTCTATGGTGGTTTATACTCATTTGCCT  350

seq1  AAACACTCCGCTCCAGACTGCAGTACTGAAGAATTAAAAGGTGACTTGAG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACACTCCGCTCCAGACTGCAGTACTGAAGAATTAAAAGGTGACTTGAG  400

seq1  CCTGTTAGTATGTTCTCTACGCTTCTCAGAAAAAAGACCCTGGCTGCAGC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGTTAGTATGTTCTCTACGCTTCTCAGAAAAAAGACCCTGGCTGCAGC  450

seq1  TATTGTCAGAGTCATAAGGTATCCTGTGGCCCTCATAGGAAACAGCCATT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTGTCAGAGTCATAAGGTATCCTGTGGCCCTCATAGGAAACAGCCATT  500

seq1  GAAGAAGGTTCATTTGGTGAGCTTGATTGCAGCCTGTCAAAACCAAAAGA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAGAAGGTTCATTTGGTGAGCTTGATTGCAGCCTGTCAAAACCAAAAGA  550

seq1  GAGCCATGTCACTCCTGCAAATGATTCTATGGCCAGCCAGAAGCAGCACC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGCCATGTCACTCCTGCAAATGATTCTATGGCCAGCCAGAAGCAGCACC  600

seq1  TCTCACTACAGGACATCCAAAGGGGACAGTGTAGCCAGCAGGATGCAAGT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCACTACAGGACATCCAAAGGGGACAGTGTAGCCAGCAGGATGCAAGT  650

seq1  ACCTTAAACCCAAAGCCCATTATTCCACAATGTCTGCTGATAGCTTGAAA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCTTAAACCCAAAGCCCATTATTCCACAATGTCTGCTGATAGCTTGAAA  700

seq1  AGAACACACAGTCTTCAAATCAAGAAAGTTTCTCTTCCCTTCACTCAGAG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAACACACAGTCTTCAAATCAAGAAAGTTTCTCTTCCCTTCACTCAGAG  750

seq1  CCAGGATGAAATTAATCAAGCCACAAGATGTATCCAGGCTCAGCACATTT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGGATGAAATTAATCAAGCCACAAGATGTATCCAGGCTCAGCACATTT  800

seq1  CTACCCCAAGGTCAGAGCCTATTCTGGAGTCCATCCCAAGCTCAAAAGAG  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTACCCCAAGGTCAGAGCCTATTCTGGAGTCCATCCCAAGCTCAAAAGAG  850

seq1  CCAGGCCAAAGGAAGTGTGTACAGCTTCTCAGGACAAAGCTCCTTCTACG  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGGCCAAAGGAAGTGTGTACAGCTTCTCAGGACAAAGCTCCTTCTACG  900

seq1  TTATAGAGACCAGAGACCATGGGAGAACAATCATCAGCGTGGGTCAGCCA  950
      |||||||||||||||||||||||||||||||||||||||| |||||||||
seq2  TTATAGAGACCAGAGACCATGGGAGAACAATCATCAGCGT-GGTCAGCCA  949

seq1  CCT-GTGGTCTATCCTCGGCCACCTGTGGTCTATCCCCAGCTCTGCTCCA  999
      ||| ||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGGTGGTCTATCCTCGGCCACCTGTGGTCTATCCCCAGCTCTGCTCCA  999

seq1  AGCACAGCTCACTTATACCCCACTCTAGTTTCAATGTTAACTATTCTCAA  1049
      |||||||||||||||||||||||||||||||| ||| |||||||||||||
seq2  AGCACAGCTCACTTATACCCCACTCTAGTTTC-ATG-TAACTATTCTCAA  1047

seq1  AGGCTCCTGAATTGAGTGTTTGGTCCCCAATGG-CAGTACTCTGCCCTAA  1098
        ||||  ||  |||||||||||||||  |||| |||||||||  ||| |
seq2  --GCTCTGGA--TGAGTGTTTGGTCCC--ATGGCCAGTACTCTTGCCTTA  1091

seq1  TTAGTTTTCTGCTGCT-GTGATAAACACTGA  1128
      |   |||||||||||| ||||||||||||||
seq2  TAGTTTTTCTGCTGCTGGTGATAAACACTGA  1122

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information