MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-206F08
Chromosome	7 (Build37)
Map Location	110,551,290 - 110,552,520
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Stim1, Rrm1, Olfr543, Olfr544, Olfr545, LOC667284, Olfr547, Olfr548-ps1, Olfr549, Trim21, LOC384699, Olfr550, Olfr551, Olfr552, Olfr553, Olfr554, LOC100040840, Olfr555, Olfr556, Trim68, Olfr557, Olfr558, Olfr33, Olfr559, Olfr78, Olfr560, Olfr561, Olfr562-ps1, Olfr563-ps1, Olfr564, Olfr565-ps1, Olfr566, GA_x5J8B7W5P47-379997-380552, Olfr567-ps1, Olfr568, Olfr569, Olfr570, Olfr571, Olfr572, Olfr573-ps1, Olfr574, Olfr575, Olfr576, Olfr577, Olfr578, Olfr1527-ps1, Olfr579-ps1, Olfr580-ps1, Olfr581-ps1, Olfr582, Olfr583, Olfr584, Olfr585, Olfr586, Olfr587-ps1, Olfr588-ps1, Olfr589, Olfr590-ps1, Olfr591, Olfr592, Olfr593, Olfr594, Olfr595-ps1, Usp17, Dub2a, LOC100041187, Olfr597, GA_x5J8B7TU1BB-380-666, Olfr598, Olfr599, Olfr600, Olfr601, Olfr602-ps1, Olfr604, Olfr596-ps1
Downstream gene	Dub2, Olfr605, Olfr606, EG546989, Olfr608, Olfr609, Olfr610, Olfr611, EG545985, Olfr614, Olfr615, Olfr616, LOC100042167, Olfr617, Olfr618, Olfr619, Olfr620, LOC667639, Olfr622, Olfr623, Olfr624, Olfr625-ps1, Olfr261-ps1, Olfr260-ps1, Olfr627, Olfr1526-ps1, Olfr629, Olfr630, Olfr69, Olfr68, Olfr67, Hbb-b1, EG436003, Hbb-bh1, Hbb-y, Olfr66, Olfr64, Olfr65, Olfr631, Olfr632, Olfr633, Olfr634-ps1, LOC233614, Olfr635, Olfr636-ps1, Olfr637-ps1, Olfr638, Olfr639, Olfr640, Olfr641, Olfr642, Olfr643, Olfr644, Olfr645, Olfr646, 4931431F19Rik, Ubqln3, Ubqlnl, E030002O03Rik, Olfr647-ps1, Olfr648, Olfr649, Olfr650-ps1, Trim6, LOC667497, EG667823, Trim12, Trim34, 9230105E10Rik, A530023O14Rik, EG434219, LOC100041595
Link	Open Mouse BAC browser

Click to get alignment info.

name	Stim1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20866 MGI:107476
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rrm1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20133 MGI:98180
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr543 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257947 MGI:3030377
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr544 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257926 MGI:3030378
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr545 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258837 MGI:3030379
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667284 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667284
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 35 ESTs, 10 Proteins pseudo : _no_value

name	Olfr547 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259083 MGI:3030381
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr548-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258229 MGI:3030382
definition	gene_synonym : MOR31-13 note : olfactory receptor 548, pseudogene 1 pseudo : _no_value

name	Olfr549 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259105 MGI:3030383
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trim21 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20821 MGI:106657
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC384699 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:384699
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	Olfr550 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259108 MGI:3030384
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr551 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258750 MGI:3030385
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr552 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259106 MGI:3030386
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr553 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233578 MGI:3030387
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr554 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258322 MGI:3030388
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040840 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040840
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Olfr555 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259107 MGI:3030389
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr556 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258749 MGI:3030390
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trim68 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:101700 MGI:2142077
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr557 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258358 MGI:3030391
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr558 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259097 MGI:3030392
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr33 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18332 MGI:109302
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr559 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259116 MGI:3030393
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr78 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170639 MGI:2157548
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr560 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259117 MGI:3030394
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr561 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259096 MGI:3030395
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr562-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259090 MGI:3030396
definition	gene_synonym : MOR14-5 note : olfactory receptor 562, pseudogene 1 pseudo : _no_value

name	Olfr563-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259157 MGI:3030397
definition	gene_synonym : MOR0-4P note : olfactory receptor 563, pseudogene 1 pseudo : _no_value

name	Olfr564 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258356 MGI:3030398
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr565-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258142 MGI:3030399
definition	gene_synonym : MOR14-8P note : olfactory receptor 565, pseudogene 1 pseudo : _no_value

name	Olfr566 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258168 MGI:3030400
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W5P47-379997-380552 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257730
definition	note : olfactory receptor GA_x5J8B7W5P47-379997-380552 pseudo : _no_value

name	Olfr567-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258140 MGI:3030401
definition	gene_synonym : MOR30-4P note : olfactory receptor 567, pseudogene 1 pseudo : _no_value

name	Olfr568 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259095 MGI:3030402
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr569 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259092 MGI:3030403
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr570 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259114 MGI:3030404
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr571 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259089 MGI:3030405
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr572 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259093 MGI:3030406
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr573-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258230 MGI:3030407
definition	gene_synonym : MOR10-3P; MOR10-4 note : olfactory receptor 573, pseudogene 1 pseudo : _no_value

name	Olfr574 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258357 MGI:3030408
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr575 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259118 MGI:3030409
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr576 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258248 MGI:3030410
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr577 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259113 MGI:3030411
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr578 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259119 MGI:3030412
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1527-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259158 MGI:3031361
definition	gene_synonym : MOR8-6P note : olfactory receptor 1527, pseudogene 1 pseudo : _no_value

name	Olfr579-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258141 MGI:3030413
definition	gene_synonym : MOR171-29P; MOR8-9_p note : olfactory receptor 579, pseudogene 1 pseudo : _no_value

name	Olfr580-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258213 MGI:3030414
definition	gene_synonym : MOR8-4P note : olfactory receptor 580, pseudogene 1 pseudo : _no_value

name	Olfr581-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404406 MGI:3030415
definition	gene_synonym : MOR8-8_p note : olfactory receptor 581, pseudogene 1 pseudo : _no_value

name	Olfr582 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259055 MGI:3030416
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr583 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258752 MGI:3030417
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr584 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259056 MGI:3030418
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr585 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259091 MGI:3030419
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr586 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259115 MGI:3030420
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr587-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404407 MGI:3030421
definition	gene_synonym : MOR7-3_p note : olfactory receptor 587, pseudogene 1 pseudo : _no_value

name	Olfr588-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259094 MGI:3030422
definition	gene_synonym : MOR6-1 note : olfactory receptor 588, pseudogene 1 pseudo : _no_value

name	Olfr589 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259054 MGI:3030423
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr590-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258170 MGI:3030424
definition	gene_synonym : MOR0-1P note : olfactory receptor 590, pseudogene 1 pseudo : _no_value

name	Olfr591 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258139 MGI:3030425
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr592 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404317 MGI:3030426
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr593 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258378 MGI:3030427
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr594 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258246 MGI:3030428
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr595-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258175 MGI:3030429
definition	gene_synonym : MOR32-6P note : olfactory receptor 595, pseudogene 1 pseudo : _no_value

name	Usp17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:436004 MGI:3582591
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dub2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384701 MGI:3051372
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041187 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041187
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 436 Proteins

name	Olfr597 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258135 MGI:3030431
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7TU1BB-380-666 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257742
definition	note : olfactory receptor GA_x5J8B7TU1BB-380-666 pseudo : _no_value

name	Olfr598 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257975 MGI:3030432
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr599 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258726 MGI:3030433
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr600 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259048 MGI:3030434
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr601 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258311 MGI:3030435
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr602-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257976 MGI:3030436
definition	gene_synonym : MOR23-3P note : olfactory receptor 602, pseudogene 1 pseudo : _no_value

name	Olfr604 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259073 MGI:3030438
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr596-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404408 MGI:3030430
definition	note : olfactory receptor 596, pseudogene 1 pseudo : _no_value

name	Dub2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13532 MGI:107698
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr605 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258156 MGI:3030439
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr606 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259098 MGI:3030440
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG546989 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546989 MGI:3643880
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 298 Proteins

name	Olfr608 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258751 MGI:3030442
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr609 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259086 MGI:3030443
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr610 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259085 MGI:3030444
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr611 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258722 MGI:3030445
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG545985 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545985 MGI:3643905
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 349 Proteins

name	Olfr614 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259104 MGI:3030448
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr615 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259084 MGI:3030449
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr616 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259103 MGI:3030450
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042167 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042167
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 11 ESTs

name	Olfr617 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258838 MGI:3030451
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr618 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259049 MGI:3030452
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr619 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259080 MGI:3030453
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr620 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258808 MGI:3030454
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667639 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667639
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 186 Proteins pseudo : _no_value

name	Olfr622 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259087 MGI:3030456
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr623 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259126 MGI:3030457
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr624 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258189 MGI:3030458
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr625-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258169 MGI:3030459
definition	gene_synonym : MOR31-15P note : olfactory receptor 625, pseudogene 1 pseudo : _no_value

name	Olfr261-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404366 MGI:3030095
definition	gene_synonym : MOR4-6_p note : olfactory receptor 261, pseudogene 1 pseudo : _no_value

name	Olfr260-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404365 MGI:3030094
definition	gene_synonym : MOR26-4_p note : olfactory receptor 260, pseudogene 1 pseudo : _no_value

name	Olfr627 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:436002 MGI:3030461
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1526-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259159 MGI:3031360
definition	gene_synonym : MOR22-4P note : olfactory receptor 1526, pseudogene 1 pseudo : _no_value

name	Olfr629 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258818 MGI:3030463
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr630 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259102 MGI:3030464
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr69 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18370 MGI:1341789
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr68 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18369 MGI:1341790
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr67 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18368 MGI:1341911
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hbb-b1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15129 MGI:96021
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG436003 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:436003 MGI:3645277
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 Proteins

name	Hbb-bh1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15132 MGI:96024
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hbb-y (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15135 MGI:96027
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr66 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18367 MGI:1341906
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr64 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18366 MGI:1341900
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr65 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18365 MGI:1341910
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr631 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258961 MGI:3030465
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr632 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259123 MGI:3030466
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr633 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258351 MGI:3030467
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr634-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257949 MGI:3030468
definition	gene_synonym : MOR12-4 note : olfactory receptor 634, pseudogene 1 pseudo : _no_value

name	LOC233614 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:233614
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Olfr635 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259122 MGI:3030469
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr636-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258144 MGI:3030470
definition	gene_synonym : MOR12-2P note : olfactory receptor 636, pseudogene 1 pseudo : _no_value

name	Olfr637-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258143 MGI:3030471
definition	gene_synonym : MOR12-3P note : olfactory receptor 637, pseudogene 1 pseudo : _no_value

name	Olfr638 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259124 MGI:3030472
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr639 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259088 MGI:3030473
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr640 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258819 MGI:3030474
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr641 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259075 MGI:3030475
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr642 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258326 MGI:3030476
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr643 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259081 MGI:3030477
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr644 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259125 MGI:3030478
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr645 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258247 MGI:3030479
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr646 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259058 MGI:3030480
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4931431F19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70980 MGI:1918230
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs, 2 Proteins

name	Ubqln3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244178 MGI:3045291
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ubqlnl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244179 MGI:2685336
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	E030002O03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244180 MGI:2443346
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr647-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258137 MGI:3030481
definition	gene_synonym : MOR0-5P note : olfactory receptor 647, pseudogene 1 pseudo : _no_value

name	Olfr648 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258746 MGI:3030482
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr649 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259057 MGI:3030483
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr650-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258212 MGI:3030484
definition	gene_synonym : MOR31-14 note : olfactory receptor 650, pseudogene 1 pseudo : _no_value

name	Trim6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94088 MGI:2137352
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667497 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667497
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 ESTs, 5 Proteins pseudo : _no_value

name	EG667823 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667823 MGI:3646853
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 22 ESTs, 16 Proteins

name	Trim12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76681 MGI:1923931
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trim34 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94094 MGI:2137359
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9230105E10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319236 MGI:2441735
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A530023O14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244183 MGI:2443916
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG434219 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434219 MGI:3647719
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins

name	LOC100041595 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041595
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 25 Proteins pseudo : _no_value

name	Stim1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802100 GeneID:20866 MGI:107476
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : stromal interaction molecule 1 transcript_id : NM_009287.3

name	Rrm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982025 GeneID:20133 MGI:98180
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribonucleotide reductase M1 transcript_id : NM_009103.2

name	Olfr543 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801333 GeneID:257947 MGI:3030377
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 543 transcript_id : NM_001011782.1

name	Olfr544 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9938011 GeneID:257926 MGI:3030378
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 544 transcript_id : NM_020289.1

name	Olfr545 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22203792 GeneID:258837 MGI:3030379
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 545 transcript_id : NM_146840.1

name	Olfr547 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110735423 GeneID:259083 MGI:3030381
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 547 transcript_id : NM_147079.2

name	Olfr549 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128766 GeneID:259105 MGI:3030383
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 549 transcript_id : NM_147101.1

name	Trim21 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:127139523 GeneID:20821 MGI:106657
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tripartite motif protein 21 transcript_id : NM_001082552.1

name	Trim21 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:127139139 GeneID:20821 MGI:106657
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tripartite motif protein 21 transcript_id : NM_009277.3

name	Olfr550 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128764 GeneID:259108 MGI:3030384
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 550 transcript_id : NM_147104.1

name	Olfr551 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129334 GeneID:258750 MGI:3030385
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 551 transcript_id : NM_146755.1

name	Olfr552 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121583539 GeneID:259106 MGI:3030386
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 552 transcript_id : NM_147102.2

name	Olfr553 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46518535 GeneID:233578 MGI:3030387
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 553 transcript_id : NM_207621.1

name	Olfr554 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121247461 GeneID:258322 MGI:3030388
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 554 transcript_id : NM_146325.2

name	Olfr555 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128762 GeneID:259107 MGI:3030389
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 555 transcript_id : NM_147103.1

name	Olfr556 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129340 GeneID:258749 MGI:3030390
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 556 transcript_id : NM_146754.1

name	Trim68 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37574099 GeneID:101700 MGI:2142077
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tripartite motif containing 68 transcript_id : NM_198012.1

name	Olfr557 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129580 GeneID:258358 MGI:3030391
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 557 transcript_id : NM_146361.1

name	Olfr558 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369590 GeneID:259097 MGI:3030392
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 558 transcript_id : NM_147093.3

name	Olfr33 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22165411 GeneID:18332 MGI:109302
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 33 transcript_id : NM_147073.1

name	Olfr559 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128740 GeneID:259116 MGI:3030393
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 559 transcript_id : NM_147112.1

name	Olfr78 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142362165 GeneID:170639 MGI:2157548
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 78 transcript_id : NM_130866.3

name	Olfr560 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121583537 GeneID:259117 MGI:3030394
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 560 transcript_id : NM_147113.2

name	Olfr561 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128784 GeneID:259096 MGI:3030395
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 561 transcript_id : NM_147092.1

name	Olfr564 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129584 GeneID:258356 MGI:3030398
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 564 transcript_id : NM_146359.1

name	Olfr566 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58372143 GeneID:258168 MGI:3030400
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 566 transcript_id : NM_001011536.1

name	Olfr568 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112983540 GeneID:259095 MGI:3030402
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 568 transcript_id : NM_147091.2

name	Olfr569 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128792 GeneID:259092 MGI:3030403
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 569 transcript_id : NM_147088.1

name	Olfr570 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128736 GeneID:259114 MGI:3030404
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 570 transcript_id : NM_147110.1

name	Olfr571 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128800 GeneID:259089 MGI:3030405
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 571 transcript_id : NM_147085.1

name	Olfr572 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128786 GeneID:259093 MGI:3030406
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 572 transcript_id : NM_147089.1

name	Olfr574 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125719162 GeneID:258357 MGI:3030408
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 574 transcript_id : NM_146360.2

name	Olfr575 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128744 GeneID:259118 MGI:3030409
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 575 transcript_id : NM_147114.1

name	Olfr576 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126090632 GeneID:258248 MGI:3030410
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 576 transcript_id : NM_001001805.2

name	Olfr577 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128796 GeneID:259113 MGI:3030411
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 577 transcript_id : NM_147109.1

name	Olfr578 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128746 GeneID:259119 MGI:3030412
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 578 transcript_id : NM_147115.1

name	Olfr582 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128844 GeneID:259055 MGI:3030416
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 582 transcript_id : NM_147053.1

name	Olfr583 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129330 GeneID:258752 MGI:3030417
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 583 transcript_id : NM_146757.1

name	Olfr584 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128846 GeneID:259056 MGI:3030418
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 584 transcript_id : NM_147054.1

name	Olfr585 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892363 GeneID:259091 MGI:3030419
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 585 transcript_id : NM_147087.2

name	Olfr586 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128738 GeneID:259115 MGI:3030420
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 586 transcript_id : NM_147111.1

name	Olfr589 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128850 GeneID:259054 MGI:3030423
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 589 transcript_id : NM_147052.1

name	Olfr591 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801451 GeneID:258139 MGI:3030425
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 591 transcript_id : NM_001011847.1

name	Olfr592 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121583632 GeneID:404317 MGI:3030426
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 592 transcript_id : NM_207556.2

name	Olfr593 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129544 GeneID:258378 MGI:3030427
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 593 transcript_id : NM_146380.1

name	Olfr594 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46369490 GeneID:258246 MGI:3030428
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 594 transcript_id : NM_207143.1

name	Usp17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802311 GeneID:436004 MGI:3582591
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin specific peptidase 17 (homolog) transcript_id : NM_001033494.2

name	Dub2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112983633 GeneID:384701 MGI:3051372
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : deubiquitinating enzyme 2a transcript_id : NM_001001559.2

name	LOC100041187 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257620 GeneID:100041187
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 436 Proteins product : similar to olfactory receptor MOR32-2 transcript_id : XM_001475935.1

name	Olfr597 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801447 GeneID:258135 MGI:3030431
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 597 transcript_id : NM_001011845.1

name	Olfr598 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801351 GeneID:257975 MGI:3030432
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 598 transcript_id : NM_001011793.1

name	Olfr599 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129380 GeneID:258726 MGI:3030433
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 599 transcript_id : NM_146731.1

name	Olfr600 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128862 GeneID:259048 MGI:3030434
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 600 transcript_id : NM_147046.1

name	Olfr601 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129660 GeneID:258311 MGI:3030435
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 601 transcript_id : NM_146314.1

name	Olfr604 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116089297 GeneID:259073 MGI:3030438
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 604 transcript_id : NM_147070.2

name	Dub2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119964687 GeneID:13532 MGI:107698
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : deubiquitinating enzyme 2 transcript_id : NM_010089.3

name	Olfr605 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801465 GeneID:258156 MGI:3030439
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 605 transcript_id : NM_001011854.1

name	Olfr606 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128780 GeneID:259098 MGI:3030440
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 606 transcript_id : NM_147094.1

name	EG546989 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257624 GeneID:546989 MGI:3643880
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 298 Proteins product : predicted gene, EG546989 transcript_id : XM_001476076.1

name	Olfr608 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:122056741 GeneID:258751 MGI:3030442
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 608 transcript_id : NM_146756.2

name	Olfr609 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128802 GeneID:259086 MGI:3030443
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 609 transcript_id : NM_147082.1

name	Olfr610 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128924 GeneID:259085 MGI:3030444
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 610 transcript_id : NM_147081.1

name	Olfr611 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129382 GeneID:258722 MGI:3030445
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 611 transcript_id : NM_146727.1

name	EG545985 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380888 GeneID:545985 MGI:3643905
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 349 Proteins product : predicted gene, EG545985 transcript_id : XM_620537.3

name	Olfr614 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84370267 GeneID:259104 MGI:3030448
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 614 transcript_id : NM_147100.2

name	Olfr615 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128808 GeneID:259084 MGI:3030449
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 615 transcript_id : NM_147080.1

name	Olfr616 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128770 GeneID:259103 MGI:3030450
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 616 transcript_id : NM_147099.1

name	LOC100042167 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257647 GeneID:100042167
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 11 ESTs product : hypothetical protein LOC100042167 transcript_id : XM_001477481.1

name	Olfr617 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129182 GeneID:258838 MGI:3030451
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 617 transcript_id : NM_146841.1

name	Olfr618 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128856 GeneID:259049 MGI:3030452
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 618 transcript_id : NM_147047.1

name	Olfr619 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128810 GeneID:259080 MGI:3030453
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 619 transcript_id : NM_147076.1

name	Olfr620 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129422 GeneID:258808 MGI:3030454
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 620 transcript_id : NM_146812.1

name	Olfr622 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128804 GeneID:259087 MGI:3030456
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 622 transcript_id : NM_147083.1

name	Olfr623 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128756 GeneID:259126 MGI:3030457
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 623 transcript_id : NM_147122.1

name	Olfr624 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111185925 GeneID:258189 MGI:3030458
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 624 transcript_id : NM_001011865.2

name	Olfr627 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70794773 GeneID:436002 MGI:3030461
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 627 transcript_id : NM_001025386.1

name	Olfr629 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133778936 GeneID:258818 MGI:3030463
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 629 transcript_id : NM_146821.2

name	Olfr630 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128644 GeneID:259102 MGI:3030464
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 630 transcript_id : NM_147098.1

name	Olfr69 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46048107 GeneID:18370 MGI:1341789
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 69 transcript_id : NM_013621.2

name	Olfr68 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134947982 GeneID:18369 MGI:1341790
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 68 transcript_id : NM_013620.2

name	Olfr67 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120407030 GeneID:18368 MGI:1341911
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 67 transcript_id : NM_013619.3

name	Hbb-b1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982299 GeneID:15129 MGI:96021
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hemoglobin, beta adult major chain transcript_id : NM_008220.2

name	EG436003 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51762090 GeneID:436003 MGI:3645277
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 Proteins product : predicted gene, EG436003 transcript_id : XM_488069.1

name	Hbb-bh1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982298 GeneID:15132 MGI:96024
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hemoglobin Z, beta-like embryonic chain transcript_id : NM_008219.2

name	Hbb-y (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366327 GeneID:15135 MGI:96027
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hemoglobin Y, beta-like embryonic chain transcript_id : NM_008221.3

name	Olfr66 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134948666 GeneID:18367 MGI:1341906
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 66 transcript_id : NM_013618.3

name	Olfr64 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134948614 GeneID:18366 MGI:1341900
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 64 transcript_id : NM_013617.3

name	Olfr65 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22165350 GeneID:18365 MGI:1341910
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 65 transcript_id : NM_013616.2

name	Olfr631 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116089293 GeneID:258961 MGI:3030465
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 631 transcript_id : NM_146959.2

name	Olfr632 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128750 GeneID:259123 MGI:3030466
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 632 transcript_id : NM_147119.1

name	Olfr633 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129590 GeneID:258351 MGI:3030467
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 633 transcript_id : NM_146354.1

name	Olfr635 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128748 GeneID:259122 MGI:3030469
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 635 transcript_id : NM_147118.1

name	Olfr638 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128752 GeneID:259124 MGI:3030472
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 638 transcript_id : NM_147120.1

name	Olfr639 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128798 GeneID:259088 MGI:3030473
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 639 transcript_id : NM_147084.1

name	Olfr640 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129216 GeneID:258819 MGI:3030474
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 640 transcript_id : NM_146822.1

name	Olfr641 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128814 GeneID:259075 MGI:3030475
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 641 transcript_id : NM_147072.1

name	Olfr642 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122856 GeneID:258326 MGI:3030476
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 642 transcript_id : NM_146329.1

name	Olfr643 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128812 GeneID:259081 MGI:3030477
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 643 transcript_id : NM_147077.1

name	Olfr644 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128754 GeneID:259125 MGI:3030478
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 644 transcript_id : NM_147121.1

name	Olfr645 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46369494 GeneID:258247 MGI:3030479
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 645 transcript_id : NM_207144.1

name	Olfr646 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128838 GeneID:259058 MGI:3030480
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 646 transcript_id : NM_147056.1

name	4931431F19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380891 GeneID:70980 MGI:1918230
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs, 2 Proteins product : RIKEN cDNA 4931431F19 gene transcript_id : XM_133663.5

name	Ubqln3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801660 GeneID:244178 MGI:3045291
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquilin 3 transcript_id : NM_198623.2

name	Ubqlnl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385042 GeneID:244179 MGI:2685336
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquilin-like transcript_id : NM_198624.2

name	E030002O03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254252 GeneID:244180 MGI:2443346
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA E030002O03 gene transcript_id : NM_172905.2

name	Olfr648 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129342 GeneID:258746 MGI:3030482
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 648 transcript_id : NM_146751.1

name	Olfr649 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128842 GeneID:259057 MGI:3030483
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 649 transcript_id : NM_147055.1

name	Trim6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119637826 GeneID:94088 MGI:2137352
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tripartite motif protein 6 transcript_id : NM_001013616.2

name	EG667823 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257652 GeneID:667823 MGI:3646853
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 22 ESTs, 16 Proteins product : predicted gene, EG667823 transcript_id : XM_992714.2

name	Trim12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115299738 GeneID:76681 MGI:1923931
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tripartite motif protein 12 transcript_id : NM_023835.2

name	Trim34 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142371122 GeneID:94094 MGI:2137359
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tripartite motif protein 34 transcript_id : NM_030684.2

name	9230105E10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982206 GeneID:319236 MGI:2441735
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9230105E10 gene transcript_id : NM_175677.3

name	A530023O14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31342270 GeneID:244183 MGI:2443916
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A530023O14 gene transcript_id : NM_175648.2

name	EG434219 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257631 GeneID:434219 MGI:3647719
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins product : predicted gene, EG434219 transcript_id : XM_485980.4

name	Stim1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981983 CCDS:CCDS21530.1 GeneID:20866 MGI:107476
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0030176 - integral to endoplasmic reticulum membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence ISS] [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] [Evidence IPI] GO_process : GO:0032237 - activation of store-operated calcium channel activity [Evidence ISS]; GO:0006816 - calcium ion transport [Evidence IEA]; GO:0005513 - detection of calcium ion [Evidence ISS]; GO:0006811 - ion transport [Evidence IEA]; GO:0051924 - regulation of calcium ion transport [Evidence ISS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : stromal interaction molecule 1 protein_id : NP_033313.2

name	Rrm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982026 GeneID:20133 MGI:98180
definition	GO_component : GO:0005971 - ribonucleoside-diphosphate reductase complex [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0004748 - ribonucleoside-diphosphate reductase activity [Evidence IEA] GO_process : GO:0006260 - DNA replication [Evidence IEA] codon_start : 1 product : ribonucleotide reductase M1 protein_id : NP_033129.2

name	Olfr543 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801334 CCDS:CCDS21531.1 GeneID:257947 MGI:3030377
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-5199377-5198367; olfactory receptor MOR42-2 product : olfactory receptor 543 protein_id : NP_001011782.1

name	Olfr544 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9938012 CCDS:CCDS21532.1 GeneID:257926 MGI:3030378
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-5206624-5205620; odorant receptor S6; olfactory receptor MOR42-3; odorant receptor S79; G-protein-coupled receptor product : olfactory receptor 544 protein_id : NP_064685.1

name	Olfr545 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22203793 CCDS:CCDS21533.1 GeneID:258837 MGI:3030379
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-5216160-5215210; olfactory receptor MOR42-1 product : olfactory receptor 545 protein_id : NP_667051.1

name	Olfr547 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110735424 GeneID:259083 MGI:3030381
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-5256044-5256988; olfactory receptor MOR31-4 product : olfactory receptor 547 protein_id : NP_667290.2

name	Olfr549 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128767 CCDS:CCDS21534.1 GeneID:259105 MGI:3030383
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-5274337-5275287; olfactory receptor MOR31-3 product : olfactory receptor 549 protein_id : NP_667312.1

name	Trim21 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:127139524 GeneID:20821 MGI:106657
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : Sjogren syndrome antigen A1; 52kD Ro/SSA autoantigen product : tripartite motif protein 21 protein_id : NP_001076021.1

name	Trim21 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:127139140 GeneID:20821 MGI:106657
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : Sjogren syndrome antigen A1; 52kD Ro/SSA autoantigen product : tripartite motif protein 21 protein_id : NP_033303.3

name	Olfr550 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128765 CCDS:CCDS21535.1 GeneID:259108 MGI:3030384
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-5297243-5298193; olfactory receptor MOR16-1 product : olfactory receptor 550 protein_id : NP_667315.1

name	Olfr551 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129335 CCDS:CCDS21536.1 GeneID:258750 MGI:3030385
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-5307445-5306498; olfactory receptor MOR29-1 product : olfactory receptor 551 protein_id : NP_666966.1

name	Olfr552 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121583540 CCDS:CCDS21537.1 GeneID:259106 MGI:3030386
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-5323062-5324015; olfactory receptor MOR28-1 product : olfactory receptor 552 protein_id : NP_667313.2

name	Olfr553 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46518536 CCDS:CCDS21538.1 GeneID:233578 MGI:3030387
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-5333671-5332712; GA_x5J8B7W5P47-604988-605242 product : olfactory receptor 553 protein_id : NP_997504.1

name	Olfr554 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121247462 CCDS:CCDS21539.1 GeneID:258322 MGI:3030388
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-5356887-5357840; olfactory receptor MOR25-1 product : olfactory receptor 554 protein_id : NP_666437.2

name	Olfr555 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128763 CCDS:CCDS21540.1 GeneID:259107 MGI:3030389
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-5375442-5376389; olfactory receptor MOR10-1 product : olfactory receptor 555 protein_id : NP_667314.1

name	Olfr556 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129341 CCDS:CCDS21541.1 GeneID:258749 MGI:3030390
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-5386601-5387575; olfactory receptor MOR41-1 product : olfactory receptor 556 protein_id : NP_666965.1

name	Trim68 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37574100 GeneID:101700 MGI:2142077
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : ring finger protein 137 product : tripartite motif containing 68 protein_id : NP_932129.1

name	Olfr557 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129581 CCDS:CCDS21542.1 GeneID:258358 MGI:3030391
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-5414934-5415902; olfactory receptor MOR18-3 product : olfactory receptor 557 protein_id : NP_666473.1

name	Olfr558 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128779 CCDS:CCDS21543.1 GeneID:259097 MGI:3030392
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-5425951-5426904; olfactory receptor MOR18-1; prostate overexpressed G protein coupled receptor product : olfactory receptor 558 protein_id : NP_667304.1

name	Olfr33 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22165412 CCDS:CCDS21544.1 GeneID:18332 MGI:109302
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-5431102-5430146; odorant receptor product : olfactory receptor 33 protein_id : NP_667284.1

name	Olfr559 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128741 CCDS:CCDS21545.1 GeneID:259116 MGI:3030393
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-5441154-5440198; olfactory receptor MOR11-1 product : olfactory receptor 559 protein_id : NP_667323.1

name	Olfr78 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18700008 CCDS:CCDS21546.1 GeneID:170639 MGI:2157548
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0004984 - olfactory receptor activity [Evidence ISS] [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-5459657-5458695; olfactory receptor MOR18-2 product : olfactory receptor 78 protein_id : NP_570936.1

name	Olfr560 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121583538 GeneID:259117 MGI:3030394
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-5470572-5469628; olfactory receptor MOR14-1 product : olfactory receptor 560 protein_id : NP_667324.2

name	Olfr561 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128785 CCDS:CCDS21547.1 GeneID:259096 MGI:3030395
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-5491151-5492095; olfactory receptor MOR14-2 product : olfactory receptor 561 protein_id : NP_667303.1

name	Olfr564 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129585 GeneID:258356 MGI:3030398
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : GA_x6K02T2PBJ9-5513635-5514627; olfactory receptor MOR14-10 product : olfactory receptor 564 protein_id : NP_666471.1

name	Olfr566 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58372144 CCDS:CCDS21548.1 GeneID:258168 MGI:3030400
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-5560696-5559746; olfactory receptor MOR14-7P product : olfactory receptor 566 protein_id : NP_001011536.1

name	Olfr568 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112983541 CCDS:CCDS21549.1 GeneID:259095 MGI:3030402
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-5588278-5589228; olfactory receptor MOR14-3 product : olfactory receptor 568 protein_id : NP_667302.2

name	Olfr569 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128793 CCDS:CCDS21550.1 GeneID:259092 MGI:3030403
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-5599295-5598351; olfactory receptor MOR30-1 product : olfactory receptor 569 protein_id : NP_667299.1

name	Olfr570 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128737 CCDS:CCDS21551.1 GeneID:259114 MGI:3030404
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-5611412-5612350; olfactory receptor MOR8-3 product : olfactory receptor 570 protein_id : NP_667321.1

name	Olfr571 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128801 CCDS:CCDS21552.1 GeneID:259089 MGI:3030405
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-5620890-5619922; olfactory receptor MOR21-1 product : olfactory receptor 571 protein_id : NP_667296.1

name	Olfr572 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128787 CCDS:CCDS21553.1 GeneID:259093 MGI:3030406
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-5638785-5639741; olfactory receptor MOR10-2 product : olfactory receptor 572 protein_id : NP_667300.1

name	Olfr574 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125719163 CCDS:CCDS21554.1 GeneID:258357 MGI:3030408
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-5659738-5660748; olfactory receptor MOR14-9 product : olfactory receptor 574 protein_id : NP_666472.2

name	Olfr575 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128745 CCDS:CCDS21555.1 GeneID:259118 MGI:3030409
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-5666843-5665908; olfactory receptor MOR8-1 product : olfactory receptor 575 protein_id : NP_667325.1

name	Olfr576 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126090633 GeneID:258248 MGI:3030410
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-5676385-5677371; olfactory receptor MOR8-5; olfactory receptor 576, pseudogene 1 product : olfactory receptor 576 protein_id : NP_001001805.2

name	Olfr577 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128797 CCDS:CCDS21556.1 GeneID:259113 MGI:3030411
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-5685322-5684384; olfactory receptor MOR7-2 product : olfactory receptor 577 protein_id : NP_667320.1

name	Olfr578 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128747 CCDS:CCDS21557.1 GeneID:259119 MGI:3030412
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-5696486-5695545; olfactory receptor MOR7-1 product : olfactory receptor 578 protein_id : NP_667326.1

name	Olfr582 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128845 CCDS:CCDS21558.1 GeneID:259055 MGI:3030416
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-5752857-5753801; olfactory receptor MOR30-3 product : olfactory receptor 582 protein_id : NP_667264.1

name	Olfr583 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129331 CCDS:CCDS21559.1 GeneID:258752 MGI:3030417
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-5762668-5763618; olfactory receptor MOR14-6 product : olfactory receptor 583 protein_id : NP_666968.1

name	Olfr584 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128847 CCDS:CCDS21560.1 GeneID:259056 MGI:3030418
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-5796876-5797820; olfactory receptor MOR30-2 product : olfactory receptor 584 protein_id : NP_667265.1

name	Olfr585 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133892364 GeneID:259091 MGI:3030419
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-5809085-5810035; olfactory receptor MOR14-4 product : olfactory receptor 585 protein_id : NP_667298.2

name	Olfr586 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128739 CCDS:CCDS21561.1 GeneID:259115 MGI:3030420
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-5836380-5835439; olfactory receptor MOR8-2 product : olfactory receptor 586 protein_id : NP_667322.1

name	Olfr589 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128851 CCDS:CCDS21562.1 GeneID:259054 MGI:3030423
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-5871256-5870303; olfactory receptor MOR32-3 product : olfactory receptor 589 protein_id : NP_667263.1

name	Olfr591 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801452 CCDS:CCDS21563.1 GeneID:258139 MGI:3030425
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-5889409-5888465; olfactory receptor MOR24-1P product : olfactory receptor 591 protein_id : NP_001011847.1

name	Olfr592 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121583633 CCDS:CCDS21564.1 GeneID:404317 MGI:3030426
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-5902266-5903204 product : olfactory receptor 592 protein_id : NP_997439.2

name	Olfr593 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129545 CCDS:CCDS21565.1 GeneID:258378 MGI:3030427
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-5927412-5928362; olfactory receptor MOR24-2 product : olfactory receptor 593 protein_id : NP_666492.1

name	Olfr594 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46369491 CCDS:CCDS21566.1 GeneID:258246 MGI:3030428
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-5935234-5936169; olfactory receptor MOR32-10 product : olfactory receptor 594 protein_id : NP_997026.1

name	Dub2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112983634 CCDS:CCDS21567.1 GeneID:384701 MGI:3051372
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0004843 - ubiquitin-specific protease activity [Evidence IDA] GO_process : GO:0016579 - protein deubiquitination [Evidence IC] codon_start : 1 product : deubiquitinating enzyme 2a protein_id : NP_001001559.2

name	Usp17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75677446 GeneID:436004 MGI:3582591
definition	GO_function : GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004221 - ubiquitin thiolesterase activity [Evidence IEA] GO_process : GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : ubiquitin specific protease 17 (homolog) product : ubiquitin specific peptidase 17 (homolog) protein_id : NP_001028666.1

name	LOC100041187 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257621 GeneID:100041187
definition	codon_start : 1 product : similar to olfactory receptor MOR32-2 protein_id : XP_001475985.1

name	Olfr597 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801448 GeneID:258135 MGI:3030431
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-6029614-6030561; olfactory receptor MOR23-2; olfactory receptor GA_x5J8B7TU1BB-380-666 product : olfactory receptor 597 protein_id : NP_001011845.1

name	Olfr598 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801352 GeneID:257975 MGI:3030432
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-6037823-6038782; olfactory receptor MOR23-4P product : olfactory receptor 598 protein_id : NP_001011793.1

name	Olfr599 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129381 CCDS:CCDS21568.1 GeneID:258726 MGI:3030433
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-6047402-6048349; olfactory receptor MOR23-1 product : olfactory receptor 599 protein_id : NP_666942.1

name	Olfr600 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128863 CCDS:CCDS21569.1 GeneID:259048 MGI:3030434
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-6056235-6055291; olfactory receptor MOR39-1 product : olfactory receptor 600 protein_id : NP_667257.1

name	Olfr601 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129661 CCDS:CCDS21570.1 GeneID:258311 MGI:3030435
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-6068534-6067590; olfactory receptor MOR24-3 product : olfactory receptor 601 protein_id : NP_666426.1

name	Olfr604 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116089298 CCDS:CCDS21571.1 GeneID:259073 MGI:3030438
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-6096387-6095449; olfactory receptor MOR32-2 product : olfactory receptor 604 protein_id : NP_667281.2

name	Dub2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119964688 CCDS:CCDS21572.1 GeneID:13532 MGI:107698
definition	GO_function : GO:0004843 - ubiquitin-specific protease activity [Evidence IDA] GO_process : GO:0016579 - protein deubiquitination [Evidence IDA] codon_start : 1 product : deubiquitinating enzyme 2 protein_id : NP_034219.3

name	Olfr605 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801466 CCDS:CCDS21573.1 GeneID:258156 MGI:3030439
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-6164792-6163848; olfactory receptor MOR202-22P product : olfactory receptor 605 protein_id : NP_001011854.1

name	Olfr606 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128781 CCDS:CCDS21574.1 GeneID:259098 MGI:3030440
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-6173009-6173968; olfactory receptor MOR17-2 product : olfactory receptor 606 protein_id : NP_667305.1

name	EG546989 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257625 GeneID:546989 MGI:3643880
definition	codon_start : 1 product : olfactory receptor 607 protein_id : XP_001476126.1

name	Olfr608 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:122056742 CCDS:CCDS21575.1 GeneID:258751 MGI:3030442
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-6191595-6192545; olfactory receptor MOR26-3 product : olfactory receptor 608 protein_id : NP_666967.2

name	Olfr609 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128803 CCDS:CCDS21576.1 GeneID:259086 MGI:3030443
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-6207735-6206776; olfactory receptor MOR9-1 product : olfactory receptor 609 protein_id : NP_667293.1

name	Olfr610 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128925 CCDS:CCDS21577.1 GeneID:259085 MGI:3030444
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-6221839-6220892; olfactory receptor MOR9-2 product : olfactory receptor 610 protein_id : NP_667292.1

name	Olfr611 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129383 GeneID:258722 MGI:3030445
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : GA_x6K02T2PBJ9-6236637-6235666; olfactory receptor MOR15-1 product : olfactory receptor 611 protein_id : NP_666938.1

name	EG545985 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94380889 GeneID:545985 MGI:3643905
definition	codon_start : 1 product : similar to olfactory receptor Olfr612 protein_id : XP_620537.3

name	Olfr614 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84370268 GeneID:259104 MGI:3030448
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-6275524-6276477; olfactory receptor MOR20-1 product : olfactory receptor 614 protein_id : NP_667311.2

name	Olfr615 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128809 GeneID:259084 MGI:3030449
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-6284902-6285843; olfactory receptor MOR19-2 product : olfactory receptor 615 protein_id : NP_667291.1

name	Olfr616 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128771 GeneID:259103 MGI:3030450
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-6289676-6288723; olfactory receptor MOR19-1 product : olfactory receptor 616 protein_id : NP_667310.1

name	LOC100042167 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257648 GeneID:100042167
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477531.1

name	Olfr617 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129183 CCDS:CCDS21579.1 GeneID:258838 MGI:3030451
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-6306819-6307775; olfactory receptor MOR31-10 product : olfactory receptor 617 protein_id : NP_667052.1

name	Olfr618 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128857 CCDS:CCDS21580.1 GeneID:259049 MGI:3030452
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-6320148-6321104; olfactory receptor MOR31-9 product : olfactory receptor 618 protein_id : NP_667258.1

name	Olfr619 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128811 CCDS:CCDS21581.1 GeneID:259080 MGI:3030453
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-6326488-6327450; olfactory receptor MOR31-5 product : olfactory receptor 619 protein_id : NP_667287.1

name	Olfr620 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129423 CCDS:CCDS21582.1 GeneID:258808 MGI:3030454
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-6335095-6334154; olfactory receptor MOR4-1 product : olfactory receptor 620 protein_id : NP_667023.1

name	Olfr622 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128805 CCDS:CCDS21583.1 GeneID:259087 MGI:3030456
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-6362863-6361910; olfactory receptor MOR26-1 product : olfactory receptor 622 protein_id : NP_667294.1

name	Olfr623 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128757 CCDS:CCDS21584.1 GeneID:259126 MGI:3030457
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-6384836-6383883; olfactory receptor MOR1-4 product : olfactory receptor 623 protein_id : NP_667333.1

name	Olfr624 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111185926 CCDS:CCDS21585.1 GeneID:258189 MGI:3030458
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-6394126-6393197; olfactory receptor MOR4-2P product : olfactory receptor 624 protein_id : NP_001011865.2

name	Olfr627 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70794774 CCDS:CCDS21586.1 GeneID:436002 MGI:3030461
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-6440320-6440766 product : olfactory receptor 627 protein_id : NP_001020557.1

name	Olfr629 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133778937 CCDS:CCDS21588.1 GeneID:258818 MGI:3030463
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-6466772-6465828; olfactory receptor MOR26-2 product : olfactory receptor 629 protein_id : NP_667032.2

name	Olfr630 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128645 CCDS:CCDS21589.1 GeneID:259102 MGI:3030464
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-6483085-6482126; olfactory receptor MOR17-1 product : olfactory receptor 630 protein_id : NP_667309.1

name	Olfr69 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305353 CCDS:CCDS21590.1 GeneID:18370 MGI:1341789
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : olfactory receptor MOR22-2; GA_x6K02T2PBJ9-6494485-6493535 product : olfactory receptor 69 protein_id : NP_038649.1

name	Olfr68 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134947983 CCDS:CCDS21591.1 GeneID:18369 MGI:1341790
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : olfactory receptor MOR22-3; GA_x6K02T2PBJ9-6504436-6503489 product : olfactory receptor 68 protein_id : NP_038648.2

name	Olfr67 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120407031 GeneID:18368 MGI:1341911
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-6515150-6514170; olfactory receptor MOR31-1 product : olfactory receptor 67 protein_id : NP_038647.2

name	Hbb-b1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982300 GeneID:15129 MGI:96021
definition	GO_component : GO:0005833 - hemoglobin complex [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0019825 - oxygen binding [Evidence IEA]; GO:0005344 - oxygen transporter activity [Evidence IMP] GO_process : GO:0030097 - hemopoiesis [Evidence IMP]; GO:0015671 - oxygen transport [Evidence IMP]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : beta major globin; beta-1-globin product : hemoglobin, beta adult major chain protein_id : NP_032246.2

name	EG436003 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51762091 GeneID:436003 MGI:3645277
definition	codon_start : 1 product : similar to Hemoglobin subunit beta (Hemoglobin beta chain) (Beta-globin) protein_id : XP_488069.1

name	Hbb-bh1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680179 CCDS:CCDS21592.1 GeneID:15132 MGI:96024
definition	GO_component : GO:0005833 - hemoglobin complex [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0019825 - oxygen binding [Evidence IEA]; GO:0005344 - oxygen transporter activity [Evidence IEA] GO_process : GO:0015671 - oxygen transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : beta Hl globin product : hemoglobin Z, beta-like embryonic chain protein_id : NP_032245.1

name	Hbb-y (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680177 CCDS:CCDS21593.1 GeneID:15135 MGI:96027
definition	GO_component : GO:0005833 - hemoglobin complex [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0019825 - oxygen binding [Evidence IEA]; GO:0005344 - oxygen transporter activity [Evidence IEA] GO_process : GO:0015671 - oxygen transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : epsilon Y globin product : hemoglobin Y, beta-like embryonic chain protein_id : NP_032247.1

name	Olfr66 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134948667 CCDS:CCDS21594.1 GeneID:18367 MGI:1341906
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-6620959-6620024 product : olfactory receptor 66 protein_id : NP_038646.2

name	Olfr64 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134948615 GeneID:18366 MGI:1341900
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-6648196-6649143 product : olfactory receptor 64 protein_id : NP_038645.2

name	Olfr65 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305343 CCDS:CCDS21596.1 GeneID:18365 MGI:1341910
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-6634906-6633983 product : olfactory receptor 65 protein_id : NP_038644.1

name	Olfr631 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116089294 CCDS:CCDS21597.1 GeneID:258961 MGI:3030465
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-6662699-6663658; olfactory receptor MOR3-1 product : olfactory receptor 631 protein_id : NP_667170.2

name	Olfr632 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128751 CCDS:CCDS21598.1 GeneID:259123 MGI:3030466
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-6671256-6672209; olfactory receptor MOR2-1 product : olfactory receptor 632 protein_id : NP_667330.1

name	Olfr633 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129591 CCDS:CCDS21599.1 GeneID:258351 MGI:3030467
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-6681230-6682168; olfactory receptor MOR12-5 product : olfactory receptor 633 protein_id : NP_666466.1

name	Olfr635 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128749 CCDS:CCDS21600.1 GeneID:259122 MGI:3030469
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-6713641-6714588; olfactory receptor MOR5-2 product : olfactory receptor 635 protein_id : NP_667329.1

name	Olfr638 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128753 CCDS:CCDS21601.1 GeneID:259124 MGI:3030472
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-6737723-6738670; olfactory receptor MOR5-1 product : olfactory receptor 638 protein_id : NP_667331.1

name	Olfr639 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128799 GeneID:259088 MGI:3030473
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-6747143-6746193; olfactory receptor MOR12-1 product : olfactory receptor 639 protein_id : NP_667295.1

name	Olfr640 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129217 CCDS:CCDS21602.1 GeneID:258819 MGI:3030474
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-6756759-6755815; olfactory receptor MOR13-4 product : olfactory receptor 640 protein_id : NP_667033.1

name	Olfr641 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128815 CCDS:CCDS21603.1 GeneID:259075 MGI:3030475
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-6773690-6774628; olfactory receptor MOR13-3 product : olfactory receptor 641 protein_id : NP_667283.1

name	Olfr642 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122857 CCDS:CCDS21604.1 GeneID:258326 MGI:3030476
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-6784380-6783436; olfactory receptor MOR13-6; odorant receptor S85; G-protein-coupled receptor product : olfactory receptor 642 protein_id : NP_666441.1

name	Olfr643 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128813 CCDS:CCDS21605.1 GeneID:259081 MGI:3030477
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-6793628-6792684; olfactory receptor MOR13-2 product : olfactory receptor 643 protein_id : NP_667288.1

name	Olfr644 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128755 CCDS:CCDS21606.1 GeneID:259125 MGI:3030478
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-6803062-6802118; olfactory receptor MOR13-1 product : olfactory receptor 644 protein_id : NP_667332.1

name	Olfr645 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46369495 CCDS:CCDS21607.1 GeneID:258247 MGI:3030479
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-6819097-6818150; olfactory receptor MOR13-5 product : olfactory receptor 645 protein_id : NP_997027.1

name	Olfr646 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128839 CCDS:CCDS21608.1 GeneID:259058 MGI:3030480
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-6841330-6842268; olfactory receptor MOR33-2 product : olfactory receptor 646 protein_id : NP_667267.1

name	4931431F19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20839440 GeneID:70980 MGI:1918230
definition	codon_start : 1 product : hypothetical protein LOC70980 protein_id : XP_133663.1

name	Ubqln3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38348486 CCDS:CCDS21610.1 GeneID:244178 MGI:3045291
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006464 - protein modification [Evidence IEA] codon_start : 1 product : ubiquilin 3 protein_id : NP_941025.1

name	Ubqlnl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38348490 CCDS:CCDS21611.1 GeneID:244179 MGI:2685336
definition	GO_process : GO:0006464 - protein modification [Evidence IEA] codon_start : 1 exception : mismatches in translation product : ubiquilin-like protein_id : NP_941026.1

name	E030002O03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370386 CCDS:CCDS21612.1 GeneID:244180 MGI:2443346
definition	codon_start : 1 product : hypothetical protein LOC244180 protein_id : NP_766493.1

name	Olfr648 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129343 CCDS:CCDS21613.1 GeneID:258746 MGI:3030482
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-6914780-6913830; olfactory receptor MOR31-12 product : olfactory receptor 648 protein_id : NP_666962.1

name	Olfr649 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128843 CCDS:CCDS21614.1 GeneID:259057 MGI:3030483
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-6924585-6923647; olfactory receptor MOR31-7 product : olfactory receptor 649 protein_id : NP_667266.1

name	Trim6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61966933 GeneID:94088 MGI:2137352
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 product : tripartite motif protein 6 protein_id : NP_001013637.1

name	EG667823 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257653 GeneID:667823 MGI:3646853
definition	codon_start : 1 product : hypothetical protein LOC667823 protein_id : XP_997808.2

name	Trim12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115299739 GeneID:76681 MGI:1923931
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : tripartite motif protein 12 protein_id : NP_076324.2

name	Trim34 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13507607 GeneID:94094 MGI:2137359
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : unclassified translation discrepancy product : tripartite motif protein 34 protein_id : NP_109609.1

name	9230105E10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982207 GeneID:319236 MGI:2441735
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : tripartite motif protein TRIM5 protein_id : NP_783608.2

name	A530023O14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28316738 GeneID:244183 MGI:2443916
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC244183 protein_id : NP_783579.1

name	EG434219 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257632 GeneID:434219 MGI:3647719
definition	codon_start : 1 product : similar to Expressed sequence AI451617 protein_id : XP_485980.4

name	LOC384699 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:384699
definition	number : 3 pseudo : _no_value

name	LOC384699 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:384699
definition	number : 2 pseudo : _no_value

name	LOC384699 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:384699
definition	number : 1 pseudo : _no_value

name	LOC100040840 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040840
definition	number : 2 pseudo : _no_value

name	LOC100040840 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040840
definition	number : 1 pseudo : _no_value

name	LOC233614 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:233614
definition	number : 3 pseudo : _no_value

name	LOC233614 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:233614
definition	number : 2 pseudo : _no_value

name	LOC233614 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:233614
definition	number : 1 pseudo : _no_value

name	LOC100041595 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041595
definition	number : 2 pseudo : _no_value

name	LOC667284 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149257615 GeneID:667284
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 35 ESTs, 10 Proteins product : similar to Hmgb1 protein pseudo : _no_value transcript_id : XR_032143.1

name	LOC667639 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149257630 GeneID:667639
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 186 Proteins product : similar to olfactory receptor Olr120 pseudo : _no_value transcript_id : XR_032639.1

name	LOC667497 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149257654 GeneID:667497
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 ESTs, 5 Proteins product : similar to ribosomal protein L27a pseudo : _no_value transcript_id : XR_033409.1

clone name	MSMg01-457P17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-330N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-384A05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-092G20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-396E22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-352M18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536K11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-235J02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-335I11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-420G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-059P14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-217G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377O16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-398I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-358P24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-058D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-544P06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-481L14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-069A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-300D13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-271J04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-412C15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-179F14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-420J12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-358A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-076K14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-143K07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-447D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-520M02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-276G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-383J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-050D18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-421G14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-073F13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-275M17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-208B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-208B07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-373K11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-417B06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-100H16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-275M17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-546J08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-421G14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-317N17
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-484K16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-546J08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-075I15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-426G19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-384D01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-490H15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-364P22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-404P11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-426O05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-393M01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-170F07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-106E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-268K02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-453N09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-144D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-537G20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-274K04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-407N20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-499A18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-119J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-458N06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-088C16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519A07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-483N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-386L17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-165D13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-147L12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-117K16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-388I18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-468H20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-449O15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-117N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-374H15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-133N02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-330C07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-520G11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-317H23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-233J11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-084B16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-457F12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-376G16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-336B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-150H06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340C07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-177O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-272C16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-453A23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-203E05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273C17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-380H21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-116F20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-051M18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-543B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-115C01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-500E09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-146N05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-400I02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-428N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-447B06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-493L24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-087N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-397F03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171I05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323G22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-018D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-044E04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-291K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-257G22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284J09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029J19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214O20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-254L07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086P02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293I12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-038K08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-281H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171B20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-282J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061L17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-061O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-145A19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087E17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-011M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-027D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180D13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-145K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232K21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305K11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-332F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-057G20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260O22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206F08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015N05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-235E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295B12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-257I06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-337K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164F10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-043G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207C11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-254A05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-176L13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-307O07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-254G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163O18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-315M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230I16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030M23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-200D20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028E01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207A22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-273C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176F12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125F16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-128D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-202F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349M14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015I13
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-206F08.b	B6Ng01-206F08.g
ACC	GA025777	GA025778
length	1,210	996
definition	B6Ng01-206F08.b	B6Ng01-206F08.g
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattctcaacaaaggaattttgtatggccaggaatcactaaaagaaagg ttcgatgtttttagtcatcacggaaatgcaaatcaaaaggaccctgaaat tccatcctgcaccaataagaatgactaagtaattagtagaatcactaaaa tgtagcctataatatcaatgcagaaatggacttgttaccaaggcaaggtt aaggaggcaaagagcaaaaatcttcctttttacctgtcgttgtctagtag caggtgttgctagattagatctggattcaagatttggattcaaggttggt cttctcccttccagatccggattaaggtgtgtcttcctcaaagattcaga tcagaagttattctccctcttcaatttagaaaaacaaaagaaaacctaca ggagtgccctccattttttgctatttagttatcaccagatgtagtcaaat tgaccaccaagagtagccatcacagtttccaataatctttggaaaaaatt atccacctgaagggaatgctgcttcagggtactttcttactccaccatga aagctagttcaagaacagaattgtgtcccacactatcatgtgaactgatg gctaacacacaaatgagcaagcctgattccattttaagatcagaagtgaa aggccagttcaggacctttggaaaatctcaccagacccctcctctcctgg aagagaaaggtcatagagcactcaggcaccccccaccccctctggaaaag aaaggctaattacattcctcagaccacagggtgggtggggtgaccaccag ccacctgtgggtgggggatacccagagcatgtagacacattctgcagggt ggacagactgttggccaccgaaagacaattgttggccacctcattcccta aagtccaatcagtttaaaagtcacactgttctatcaaatcacattgtgcc taatggatgctgctctgaaaactgtataaaactcagtgaacaagctgccc acggtcatatctccccttagtgtgcaggagaactctcagcatgctgaaca acaaaaatctctgctttggcatcaatcgtcactcacaattgttcgctcag ggggggctctgtagttaaagctgtcagagtctacagaagctttttataat gtaaaagaagcttttctgtgtaaaactagcttatttctggaattgaccga tattaacttt	gaattcactcctgagtttgattatttcctgccatctactcctcttgggtg aatttgcttcctttttttctagagcttttagatgtgttgtcaggctgcta gtatgtgctctctcccgtttcttcttggagacactcagagctatgagttt ccctcttagaaatgctttcattgtgtcccaaaggtttgggtacgttgtgg cttcattgtcattaaactctaaaaagtctttaatttctttctttattcct tccttgaccaaggtatcattgagaagagtgttgttcagtttccacgtgaa tgtttgctttccattatttatgttgttattgaagatcagtcttaggccat ggtggtctgataggatacatgggacaatttcaatatttttgtatctgttg aggcctgttttgtgaccaattatatggtcaattttggagaaggtcccgtg aggtgctgagaagaaggtatatccttttgtttttaggataaaatgttctg tagatatctgtcaggtccatttgtttcataacttctgttagtttaactgt gtccctgtttagtttctgtttccacgatctgtccattgatgaaagtggtg tgttgaaatctcccactattattgtgtgaggtgcaatatgtgctttgagc tttactaaaatgtctttaatgaatgtggctgcccttgcatttggagcgta gatattcagaattgagagttcctcttgtaggattttacctttgatgagta tgaagtgtccctccttgtcttttttgataactttgggttggaagtcgatt ttatccgatattagaatggctactccagcctgtttctcagaccatttgct tggaaaattgttttccagcctttcactctgaggtagtgtctgtctttttc tctgagatgggtttcctgtaagtagcagaatgttggtcctgtttgcgtag ccagtcttgttagtctatgttctttttattggggaattgagtccat
quality values	Open. Hide. 62 41 30 41 62 62 62 32 46 47 38 33 62 62 62 62 62 44 47 62 62 49 44 62 62 59 62 59 62 59 59 24 16 24 23 23 23 23 27 27 28 28 43 54 48 62 62 62 62 59 59 62 62 62 62 59 62 62 62 62 49 59 59 62 62 59 62 62 62 62 62 62 62 54 62 62 62 62 59 50 32 43 59 59 59 59 62 62 62 62 59 59 62 62 62 54 54 54 54 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 59 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 42 54 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 58 58 54 52 58 58 47 58 58 58 58 58 58 58 58 54 58 58 58 58 54 58 58 58 58 58 54 58 58 54 54 58 58 49 58 58 52 58 58 52 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 49 58 58 58 54 52 58 54 52 58 50 58 49 58 58 58 58 58 53 58 58 58 58 58 58 58 58 45 38 58 58 47 34 54 58 58 48 50 58 52 54 50 53 41 53 58 53 50 53 58 58 58 41 42 44 25 51 42 51 58 58 53 50 46 58 36 33 58 50 58 54 44 48 58 58 41 44 36 58 49 50 50 39 49 37 52 54 29 58 58 58 51 50 49 49 49 42 42 58 41 38 44 58 51 34 58 23 51 58 43 40 51 27 52 39 50 50 42 54 35 52 45 41 53 49 37 17 51 39 37 51 54 46 42 49 44 40 42 33 33 34 54 41 50 39 49 49 41 54 54 47 32 53 54 45 34 50 21 39 34 50 37 44 27 50 26 53 41 33 39 53 42 40 28 39 23 37 37 41 40 20 36 46 22 35 54 54 28 31 54 54 51 31 52 28 17 41 31 47 45 34 39 42 53 29 21 40 32 53 32 33 51 47 25 33 49 52 52 51 31 21 35 33 46 47 28 26 35 23 43 35 32 52 31 32 31 32 28 24 45 25 32 33 41 39 42 29 14 6 47 51 24 41 33 21 21 36 34 33 32 31 45 25 24 25 16 12 11 21 27 30 21 30 47 30 32 31 21 30 31 25 42 42 32 28 42 31 26 31 23 30 46 42 33 26 46 31 30 48 37 26 22 47 32 34 31 32 31 31 30 31 35 21 21 26 48 28 12 47 48 36 32 33 32 23 32 31 31 29 31 19 13 29 32 38 36 11 6 46 7 9 31 30 31 24 31 28 29 21 31 20 30 22 18 31 12 25 31 17 20 26 22 22 26 26 31 32 31 21 37 48 44 26 27 25 33 13 21 31 22 48 48 31 24 36 31 25 9 8 18 25 33 24 21 29 17 23 12 18 17 43 16 11 6 4 12 10 28 15 43 11 23 17 23 24 48 48 17 18 20 33 10 9 18 11 33 27 9 24 21 23 9 6 9 6 22 24 33 21 28 17 14 20 24 27 19 15 17 11 12 27 20 22 19 9 28 47 40 6 19 11 3 4 8 16 16 19 40 13 7 14 13 14 14 11 11 12 18 27 7 14 27 12 20 24 28 7 20 13 9 25 13 10 13 27 20 9 7 7 7 13 21 25 28 26 26 14 15 7 7 9 11 14 5 22 7 9 11 11 19 14 13 10 11 8 6 10 4 3 3 3 7 9 12 5 4 3 5 22 25 9 15 18 28 28 23 5 5 8 8 21 9 20 6 17 28 26 23 8 6 5 4 1 5 28 25 20 8 7 6 3 2 2 2 1 8 3 3 3 2 1 1 5 2 5 16 15 5 6 6 5 8 8 14 7 9 4 6 7 25 5 11 7 5 4 14 10 12 8 5 21 18	Open. Hide. 62 59 51 59 62 49 51 59 62 62 51 49 38 30 30 50 46 54 42 54 54 42 62 59 62 62 62 62 62 62 62 59 43 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 59 62 49 49 42 54 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 49 42 54 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 49 54 62 62 62 62 62 62 59 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 54 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 50 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 54 58 58 58 58 58 58 58 58 52 58 58 58 58 58 58 58 58 58 54 54 54 58 58 58 41 54 58 43 58 58 58 58 58 58 58 58 58 58 54 58 54 58 58 58 58 53 58 58 58 47 58 54 54 45 35 58 58 58 52 58 58 58 58 58 54 52 58 58 58 58 48 58 58 58 58 51 50 58 51 51 58 53 58 49 58 58 51 58 58 49 58 53 58 58 54 50 58 32 49 51 47 50 46 58 58 52 58 53 58 58 39 58 52 58 46 58 54 53 52 51 58 51 58 51 58 58 58 51 51 39 58 58 58 41 50 53 53 39 58 58 42 40 58 25 58 52 58 49 42 58 51 53 52 54 49 51 32 58 51 42 49 50 50 58 44 50 49 40 50 39 47 54 40 54 52 51 32 54 49 37 52 20 49 32 37 39 54 45 47 35 54 52 39 54 49 51 35 39 32 40 35 45 54 50 53 53 53 53 29 33 28 37 52 24 54 54 51 37 35 51 41 54 40 45 53 34 40 53 32 31 42 37 37 51 54 31 43 54 37 53 52 36 31 32 44 33 32 51 25 45 31 53 53 52 49 37 31 35 32 25 31 31 33 46 42 32 52 52 33 31 31 34 35 39 30 31 31 19 35 17 51 51 31 31 31 31 51 24 35 26 31 35 32 32 33 41 42 26 51 43 30 32 31 31 31 42 29 24 28 31 32 31 29 31 47 31 22 46 16 25 17 23 11 25 27 31 47 41 31 31 46 12 14 43 43 48 47 23 16 34 32 30 46 37 37 23 15 15 25 26 41 27 47 12 17 21 31 27 23 30 26 37 19 41 19 31 21 32 39 25 35 31 31 27 33 38 48 48 46 21 29 21 23 31 32 31 22 26 20 32 48 29 22 44 31 25 33 29 30 23 29 37 31 33 32 28 32 31 9 37 34 24 21 8 30 13 8 6 19 36 32 24 14 37 25 17 10 7 19 32 12 33 21 19 27 20 10 7 10 15 16 32 32 21 25 31 25 13 10 8 8 7 7 16 39 43 37 24 6 15 16 32 48 48 20 22 32 13 21 25 32 21 11 26 23 20 21

Alignment Information

BAC End 1

BAC End 2

seq1: chr7_110551290_110552520
seq2: B6Ng01-206F08.b_48_1257

seq1  GAATTCTCAACAAAGGAATTTTGTATGGCCAGGAATCACTAAAAGAAAGG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTCAACAAAGGAATTTTGTATGGCCAGGAATCACTAAAAGAAAGG  50

seq1  TTCGATGTTTTTAGTCATCACGGAAATGCAAATCAAAAGGACCCTGAAAT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCGATGTTTTTAGTCATCACGGAAATGCAAATCAAAAGGACCCTGAAAT  100

seq1  TCCATCCTGCACCAATAAGAATGACTAAGTAATTAGTAGAATCACTAAAA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCATCCTGCACCAATAAGAATGACTAAGTAATTAGTAGAATCACTAAAA  150

seq1  TGTAGCCTATAATATCAATGCAGAAATGGACTTGTTACCAAGGCAAGGTT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTAGCCTATAATATCAATGCAGAAATGGACTTGTTACCAAGGCAAGGTT  200

seq1  AAGGAGGCAAAGAGCAAAAATCTTCCTTTTTACCTGTCGTTGTCTAGTAG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGAGGCAAAGAGCAAAAATCTTCCTTTTTACCTGTCGTTGTCTAGTAG  250

seq1  CAGGTGTTGCTAGATTAGATCTGGATTCAAGATTTGGATTCAAGGTTGGT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGTGTTGCTAGATTAGATCTGGATTCAAGATTTGGATTCAAGGTTGGT  300

seq1  CTTCTCCCTTCCAGATCCGGATTAAGGTGTGTCTTCCTCAAAGATTCAGA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCTCCCTTCCAGATCCGGATTAAGGTGTGTCTTCCTCAAAGATTCAGA  350

seq1  TCAGAAGTTATTCTCCCTCTTCAATTTAGAAAAACAAAAGAAAACCTACA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGAAGTTATTCTCCCTCTTCAATTTAGAAAAACAAAAGAAAACCTACA  400

seq1  GGAGTGCCCTCCATTTTTTGCTATTTAGTTATCACCAGATGTAGTCAAAT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAGTGCCCTCCATTTTTTGCTATTTAGTTATCACCAGATGTAGTCAAAT  450

seq1  TGACCACCAAGAGTAGCCATCACAGTTTCCAATAATCTTTGGAAAAAATT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGACCACCAAGAGTAGCCATCACAGTTTCCAATAATCTTTGGAAAAAATT  500

seq1  ATCCACCTGAAGGGAATGCTGCTTCAGGGTACTTTCTTACTCCACCATGA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCCACCTGAAGGGAATGCTGCTTCAGGGTACTTTCTTACTCCACCATGA  550

seq1  AAGCTAGTTCAAGAACAGAATTGTGTCCCACACTATCATGTGAACTGATG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGCTAGTTCAAGAACAGAATTGTGTCCCACACTATCATGTGAACTGATG  600

seq1  GCTAACACACAAATGAGCAAGCCTGATTCCATTTTAAGATCAGAAGTGAA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTAACACACAAATGAGCAAGCCTGATTCCATTTTAAGATCAGAAGTGAA  650

seq1  AGGCCAGTTCAGGACCTTTGGAAAATCTCACCAGACCCCTCCTCTCCTGG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGCCAGTTCAGGACCTTTGGAAAATCTCACCAGACCCCTCCTCTCCTGG  700

seq1  AAGAGAAAGGTCATAGAGCACTCAGGCACCCCCCACCCCCTCTGGAAAAG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGAGAAAGGTCATAGAGCACTCAGGCACCCCCCACCCCCTCTGGAAAAG  750

seq1  AAAGGCTAATTACATTCCTCAGACCACAGGGTGGGTGGGGTGACCACCAG  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGGCTAATTACATTCCTCAGACCACAGGGTGGGTGGGGTGACCACCAG  800

seq1  CCACCTGTGGGTGGGGGATACCCAGAGCATGTAGACACATTCTGCAGGGT  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCACCTGTGGGTGGGGGATACCCAGAGCATGTAGACACATTCTGCAGGGT  850

seq1  GGACAGACTGTTGGCCACCGAAAGACAATTGTTGGCCACCTCATTCCCTA  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGACAGACTGTTGGCCACCGAAAGACAATTGTTGGCCACCTCATTCCCTA  900

seq1  AAGTCCAATCAGTTTAAAAGTCACACTGTTCTATC-AATCACATTGTGCC  949
      ||||||||||||||||||||||||||||||||||| ||||||||||||||
seq2  AAGTCCAATCAGTTTAAAAGTCACACTGTTCTATCAAATCACATTGTGCC  950

seq1  TAATGGATGCTGCTCTGAAAACTGTATAAAACTCAGTGAACAAGCTGCCC  999
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAATGGATGCTGCTCTGAAAACTGTATAAAACTCAGTGAACAAGCTGCCC  1000

seq1  ACGGTCATTATCTCCCCTTAGTGTGCAGGGAGACTCTCAGCATGCTGGAA  1049
      ||||||| |||||||||||||||||||||   |||||||||||||| |||
seq2  ACGGTCA-TATCTCCCCTTAGTGTGCAGGAGAACTCTCAGCATGCT-GAA  1048

seq1  CAACAAAATTCCTCTTGCTTTGGCATCAATCGTCCACTCCACATTGTTCG  1099
      |||||||| | ||| |||||||||||||||||| |||||   ||||||||
seq2  CAACAAAAAT-CTC-TGCTTTGGCATCAATCGT-CACTCACAATTGTTCG  1095

seq1  CTCAGGGGGGGCTCTGGTAAGTTAAAGCTTGTCAGAGTCTTACAGAAGCT  1149
      ||||||||||||||||   ||||||||| |||||||||| ||||||||||
seq2  CTCAGGGGGGGCTCTG--TAGTTAAAGC-TGTCAGAGTC-TACAGAAGCT  1141

seq1  TTTTATAATGTAAAAGACAGTTTTTCTGTTGGTTATAAAACTTAAGTTTT  1199
      ||||||||||||||||| || |||||||     | |||||||  ||   |
seq2  TTTTATAATGTAAAAGA-AGCTTTTCTG-----TGTAAAACT--AG--CT  1181

seq1  TATTTCTTGGAATTTGAACCGATATTAACTTT  1231
      |||||| |||||||   |||||||||||||||
seq2  TATTTC-TGGAATT--GACCGATATTAACTTT  1210

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information