MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-206P05
Chromosome	7 (Build37)
Map Location	12,572,031 - 12,674,047
singlet/doublet	doublet
Overlap gene	LOC628946, LOC100043075
Upstream gene	EG665798, Gm397, Zscan4-ps1, LOC635187, LOC100042997, LOC100042293, Zscan4d, LOC628737, LOC676750, LOC672893, LOC546931, LOC675762, Zscan4e, LOC665857, LOC665861, Zscan4f, LOC673742, LOC665887, LOC637541, LOC100042361, Zscan4-ps2, LOC675782, LOC100042386, LOC665926, LOC637571, LOC100043042, LOC628853, V1rg1, V1rg2, EG628898, V1rg5, V1rg6, LOC665999, V1rg4, LOC100042423
Downstream gene	LOC100042433, V1rg7, LOC100042437, V1rg3, LOC100042446, LOC100043092, V1rg9, V1rg12, V1rg8, V1rg11, Zfp551, EG666065, Zfp606, 2900092C05Rik, EG637908, EG666085, Vmn2r55, LOC629079, LOC629081, EG232875, LOC100043128, LOC100042515, Zfp329, Zfp110, Zfp128, Zscan22, Rps5, 2310014L17Rik, 1810019N24Rik, Zfp324, Zfp446, Slc27a5, ZBTB45, LOC100042553, Trim28, Chmp2a, Ube2m, Mzf1, V1rj3
Link	Open Mouse BAC browser

Click to get alignment info.

name	EG665798 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665798 MGI:3648689
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 19 Proteins pseudo : _no_value

name	Gm397 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245109 MGI:2685243
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zscan4-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545912 MGI:3645953
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 21 ESTs

name	LOC635187 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:635187
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins pseudo : _no_value

name	LOC100042997 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042997
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 47 Proteins pseudo : _no_value

name	LOC100042293 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042293
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Zscan4d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545913 MGI:3645954
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 30 ESTs

name	LOC628737 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628737
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 18 Proteins pseudo : _no_value

name	LOC676750 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:676750
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	LOC672893 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:672893
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC546931 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546931
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 Proteins pseudo : _no_value

name	LOC675762 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:675762
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	Zscan4e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665848 MGI:3643613
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs

name	LOC665857 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665857
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	LOC665861 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665861
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 12 Proteins pseudo : _no_value

name	Zscan4f (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665902 MGI:3708485
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 30 ESTs

name	LOC673742 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:673742
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	LOC665887 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665887
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 30 Proteins pseudo : _no_value

name	LOC637541 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:637541
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 12 Proteins pseudo : _no_value

name	LOC100042361 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042361
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs

name	Zscan4-ps2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665913 MGI:3708487
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 28 ESTs

name	LOC675782 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:675782
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 16 Proteins pseudo : _no_value

name	LOC100042386 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042386
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	LOC665926 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665926
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 22 Proteins pseudo : _no_value

name	LOC637571 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:637571
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 13 Proteins pseudo : _no_value

name	LOC100043042 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043042
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 28 ESTs

name	LOC628853 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628853
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	V1rg1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:252905 MGI:2182256
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rg2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171237 MGI:2159641
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG628898 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628898 MGI:3645961
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 28 Proteins pseudo : _no_value

name	V1rg5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171240 MGI:2159644
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rg6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171241 MGI:2159645
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665999 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665999
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	V1rg4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171239 MGI:2159643
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042423 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042423
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC628946 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628946
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 26 Proteins

name	LOC100043075 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043075
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 22 ESTs, 5 Proteins pseudo : _no_value

name	LOC100042433 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042433
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	V1rg7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171242 MGI:2159646
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042437 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042437
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 32 Proteins

name	V1rg3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171238 MGI:2159642
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042446 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042446
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC100043092 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043092
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	V1rg9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171244 MGI:2159648
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rg12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171268 MGI:2159656
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rg8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171243 MGI:2159647
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rg11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171267 MGI:2159655
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp551 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:619331 MGI:3588205
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG666065 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666065 MGI:3644790
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 Proteins pseudo : _no_value

name	Zfp606 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67370 MGI:1914620
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	2900092C05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73090 MGI:1920340
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG637908 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:637908 MGI:3644480
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins pseudo : _no_value

name	EG666085 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666085 MGI:3704110
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vmn2r55 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042499
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 Proteins

name	LOC629079 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629079
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 Proteins

name	LOC629081 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629081
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 23 Proteins pseudo : _no_value

name	EG232875 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232875 MGI:3643810
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 44 ESTs, 3 Proteins

name	LOC100043128 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043128
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 25 ESTs, 24 Proteins pseudo : _no_value

name	LOC100042515 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042515
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 26 ESTs, 11 Proteins

name	Zfp329 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67230 MGI:1921283
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp110 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:65020 MGI:1890378
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp128 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243833 MGI:2389445
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zscan22 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232878 MGI:2443312
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rps5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20103 MGI:1097682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310014L17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381845 MGI:1924198
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1810019N24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69086 MGI:1916336
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Zfp324 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243834 MGI:2444641
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp446 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269870 MGI:2442185
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc27a5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26459 MGI:1347100
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	ZBTB45 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232879 MGI:2685003
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042553 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042553
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 12 ESTs

name	Trim28 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21849 MGI:109274
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chmp2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68953 MGI:1916203
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ube2m (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22192 MGI:108278
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mzf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109889 MGI:107457
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rj3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:252909 MGI:2182262
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm397 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131157 GeneID:245109 MGI:2685243
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 397, (NCBI) transcript_id : NM_001013765.2

name	Zscan4-ps1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379416 GeneID:545912 MGI:3645953
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 19 ESTs product : zinc finger and SCAN domain containing 4, pseudogene 1, transcript variant 2 transcript_id : XM_891198.2

name	Zscan4-ps1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379414 GeneID:545912 MGI:3645953
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 18 ESTs product : zinc finger and SCAN domain containing 4, pseudogene 1, transcript variant 3 transcript_id : XM_983203.1

name	Zscan4d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379420 GeneID:545913 MGI:3645954
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 27 ESTs product : zinc finger and SCAN domain containing 4D, transcript variant 4 transcript_id : XM_899474.2

name	Zscan4d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379421 GeneID:545913 MGI:3645954
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 28 ESTs product : zinc finger and SCAN domain containing 4D, transcript variant 1 transcript_id : XM_620418.3

name	Zscan4e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256374 GeneID:665848 MGI:3643613
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs product : zinc finger and SCAN domain containing 4E transcript_id : XM_979850.2

name	Zscan4f (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256381 GeneID:665902 MGI:3708485
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 27 ESTs product : zinc finger and SCAN domain containing 4F transcript_id : XM_001479557.1

name	Zscan4f (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379425 GeneID:665902 MGI:3708485
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 28 ESTs product : zinc finger and SCAN domain containing 4F, transcript variant 2 transcript_id : XM_983435.1

name	LOC100042361 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256132 GeneID:100042361
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs product : similar to pol protein transcript_id : XM_001478041.1

name	Zscan4-ps2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256390 GeneID:665913 MGI:3708487
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 25 ESTs product : zinc finger and SCAN domain containing 4, pseudogene 2, transcript variant 1 transcript_id : XM_001479576.1

name	Zscan4-ps2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256392 GeneID:665913 MGI:3708487
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 28 ESTs product : zinc finger and SCAN domain containing 4, pseudogene 2, transcript variant 2 transcript_id : XM_001479587.1

name	LOC100043042 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256406 GeneID:100043042
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 25 ESTs product : similar to CG2712-PA, transcript variant 1 transcript_id : XM_001479610.1

name	LOC100043042 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256408 GeneID:100043042
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 26 ESTs product : similar to CG2712-PA, transcript variant 2 transcript_id : XM_001479616.1

name	V1rg1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22003893 GeneID:252905 MGI:2182256
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, G1 transcript_id : NM_145843.1

name	V1rg2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717720 GeneID:171237 MGI:2159641
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, G2 transcript_id : NM_134203.1

name	V1rg5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717734 GeneID:171240 MGI:2159644
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, G5 transcript_id : NM_134206.1

name	V1rg6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717728 GeneID:171241 MGI:2159645
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, G6 transcript_id : NM_134207.1

name	V1rg4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112821682 GeneID:171239 MGI:2159643
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, G4 transcript_id : NM_134205.2

name	LOC628946 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256422 GeneID:628946
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 26 Proteins product : similar to vomeronasal V1r-type receptor V1rg16 transcript_id : XM_001479628.1

name	V1rg7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717738 GeneID:171242 MGI:2159646
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, G7 transcript_id : NM_134208.1

name	LOC100042437 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256137 GeneID:100042437
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 32 Proteins product : similar to vomeronasal receptor V1RG10 transcript_id : XM_001478204.1

name	V1rg3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120300966 GeneID:171238 MGI:2159642
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, G3 transcript_id : NM_134204.2

name	LOC100043092 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256434 GeneID:100043092
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100043092 transcript_id : XM_001479642.1

name	V1rg9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717742 GeneID:171244 MGI:2159648
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, G9 transcript_id : NM_134210.1

name	V1rg12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717776 GeneID:171268 MGI:2159656
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, G12 transcript_id : NM_134234.1

name	V1rg8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717732 GeneID:171243 MGI:2159647
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, G8 transcript_id : NM_134209.1

name	V1rg11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717782 GeneID:171267 MGI:2159655
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, G11 transcript_id : NM_134233.1

name	Zfp551 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802370 GeneID:619331 MGI:3588205
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc fingr protein 551 transcript_id : NM_001033820.2

name	Zfp606 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129854 GeneID:67370 MGI:1914620
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 606 transcript_id : NM_026112.3

name	Zfp606 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:90265806 GeneID:67370 MGI:1914620
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 606 transcript_id : NM_001039951.1

name	2900092C05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370547 GeneID:73090 MGI:1920340
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2900092C05 gene transcript_id : NM_028434.2

name	EG666085 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124517669 GeneID:666085 MGI:3704110
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG666085 transcript_id : NM_001081449.1

name	Vmn2r55 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256147 GeneID:100042499
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 Proteins product : vomeronasal receptor Vmn2r55 transcript_id : XM_001478322.1

name	LOC629079 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256149 GeneID:629079
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 Proteins product : similar to V2R receptor transcript_id : XM_893901.2

name	EG232875 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256152 GeneID:232875 MGI:3643810
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 44 ESTs, 3 Proteins product : predicted gene, EG232875 transcript_id : XM_001478350.1

name	LOC100042515 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256154 GeneID:100042515
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 26 ESTs, 11 Proteins product : similar to hCG26831 transcript_id : XM_001478362.1

name	Zfp329 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133505150 GeneID:67230 MGI:1921283
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 329 transcript_id : NM_026046.3

name	Zfp110 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42734473 GeneID:65020 MGI:1890378
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 110 transcript_id : NM_022981.3

name	Zfp128 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:57863764 GeneID:243833 MGI:2389445
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 128 transcript_id : NM_153802.3

name	Zscan22 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374570 GeneID:232878 MGI:2443312
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger and SCAN domain containing 22 transcript_id : NM_001001447.2

name	Rps5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6677806 GeneID:20103 MGI:1097682
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein S5 transcript_id : NM_009095.1

name	2310014L17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037476 GeneID:381845 MGI:1924198
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310014L17 gene transcript_id : NM_029809.1

name	1810019N24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256158 GeneID:69086 MGI:1916336
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : RIKEN cDNA 1810019N24 gene transcript_id : XM_001478400.1

name	Zfp324 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56118255 GeneID:243834 MGI:2444641
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 324 transcript_id : NM_178732.3

name	Zfp446 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803275 GeneID:269870 MGI:2442185
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 446 transcript_id : NM_175558.3

name	Slc27a5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678010 GeneID:26459 MGI:1347100
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 27 (fatty acid transporter), member 5 transcript_id : NM_009512.1

name	ZBTB45 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85701533 GeneID:232879 MGI:2685003
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger and BTB domain containing 45 transcript_id : NM_001024699.1

name	LOC100042553 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256160 GeneID:100042553
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 12 ESTs product : hypothetical protein LOC100042553 transcript_id : XM_001478426.1

name	Trim28 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349667 GeneID:21849 MGI:109274
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tripartite motif protein 28 transcript_id : NM_011588.2

name	Chmp2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367036 GeneID:68953 MGI:1916203
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chromatin modifying protein 2A transcript_id : NM_026885.2

name	Ube2m (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21704161 GeneID:22192 MGI:108278
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin-conjugating enzyme E2M (UBC12 homolog, yeast) transcript_id : NM_145578.1

name	Mzf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41281742 GeneID:109889 MGI:107457
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myeloid zinc finger 1 transcript_id : NM_145819.1

name	V1rj3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22003905 GeneID:252909 MGI:2182262
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, J3 transcript_id : NM_145847.1

name	Gm397 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62000642 GeneID:245109 MGI:2685243
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : hypothetical protein LOC245109 protein_id : NP_001013787.1

name	Zscan4-ps1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82903136 GeneID:545912 MGI:3645953
definition	codon_start : 1 product : similar to Gene model 397, (NCBI) isoform 2 protein_id : XP_896291.1

name	Zscan4-ps1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94379415 GeneID:545912 MGI:3645953
definition	codon_start : 1 product : similar to Gene model 397, (NCBI) isoform 3 protein_id : XP_988297.1

name	Zscan4d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63555372 GeneID:545913 MGI:3645954
definition	codon_start : 1 product : similar to Gene model 397, (NCBI) isoform 1 protein_id : XP_620418.1

name	Zscan4d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82903148 GeneID:545913 MGI:3645954
definition	codon_start : 1 product : similar to Gene model 397, (NCBI) isoform 4 protein_id : XP_904567.1

name	Zscan4e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94379413 GeneID:665848 MGI:3643613
definition	codon_start : 1 product : similar to Gene model 397, (NCBI) protein_id : XP_984944.1

name	Zscan4f (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256382 GeneID:665902 MGI:3708485
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479607.1

name	Zscan4f (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94379426 GeneID:665902 MGI:3708485
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_988529.1

name	LOC100042361 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256133 GeneID:100042361
definition	codon_start : 1 product : similar to pol protein protein_id : XP_001478091.1

name	Zscan4-ps2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256391 GeneID:665913 MGI:3708487
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001479626.1

name	Zscan4-ps2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256393 GeneID:665913 MGI:3708487
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001479637.1

name	LOC100043042 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256407 GeneID:100043042
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001479660.1

name	LOC100043042 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256409 GeneID:100043042
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001479666.1

name	V1rg1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22003894 CCDS:CCDS20799.1 GeneID:252905 MGI:2182256
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0016503 - pheromone receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA] codon_start : 1 product : vomeronasal 1 receptor, G1 protein_id : NP_665842.1

name	V1rg2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717721 CCDS:CCDS20800.1 GeneID:171237 MGI:2159641
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, G2 protein_id : NP_598964.1

name	V1rg5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717735 CCDS:CCDS20801.1 GeneID:171240 MGI:2159644
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, G5 protein_id : NP_598967.1

name	V1rg6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717729 CCDS:CCDS20802.1 GeneID:171241 MGI:2159645
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, G6 protein_id : NP_598968.1

name	V1rg4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112821683 CCDS:CCDS20803.1 GeneID:171239 MGI:2159643
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, G4 protein_id : NP_598966.2

name	LOC628946 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256423 GeneID:628946
definition	codon_start : 1 product : similar to vomeronasal V1r-type receptor V1rg16 protein_id : XP_001479678.1

name	V1rg7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717739 CCDS:CCDS20804.1 GeneID:171242 MGI:2159646
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 exception : mismatches in translation product : vomeronasal 1 receptor, G7 protein_id : NP_598969.1

name	LOC100042437 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256138 GeneID:100042437
definition	codon_start : 1 product : similar to vomeronasal receptor V1RG10 protein_id : XP_001478254.1

name	V1rg3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120300967 CCDS:CCDS20805.1 GeneID:171238 MGI:2159642
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, G3 protein_id : NP_598965.2

name	LOC100043092 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256435 GeneID:100043092
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479692.1

name	V1rg9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717743 CCDS:CCDS20806.1 GeneID:171244 MGI:2159648
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, G9 protein_id : NP_598971.1

name	V1rg12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717777 GeneID:171268 MGI:2159656
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, G12 protein_id : NP_598995.1

name	V1rg8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717733 CCDS:CCDS20807.1 GeneID:171243 MGI:2159647
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, G8 protein_id : NP_598970.1

name	V1rg11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717783 CCDS:CCDS20808.1 GeneID:171267 MGI:2159655
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, G11 protein_id : NP_598994.1

name	Zfp551 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702167 CCDS:CCDS20809.1 GeneID:619331 MGI:3588205
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc fingr protein 551 protein_id : NP_001028992.1

name	Zfp606 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328284 CCDS:CCDS20810.1 GeneID:67370 MGI:1914620
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : zinc finger protein 606 isoform 1 protein_id : NP_080388.2

name	Zfp606 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:90265807 GeneID:67370 MGI:1914620
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : zinc finger protein 606 isoform 2 protein_id : NP_001035040.1

name	2900092C05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33469013 CCDS:CCDS20811.1 GeneID:73090 MGI:1920340
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC73090 protein_id : NP_082710.1

name	EG666085 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124517670 GeneID:666085 MGI:3704110
definition	codon_start : 1 note : V2R receptor product : predicted gene, EG666085 protein_id : NP_001074918.1

name	Vmn2r55 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256148 GeneID:100042499
definition	codon_start : 1 product : similar to V2R receptor protein_id : XP_001478372.1

name	LOC629079 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256150 GeneID:629079
definition	codon_start : 1 product : similar to V2R receptor protein_id : XP_898994.2

name	EG232875 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256153 GeneID:232875 MGI:3643810
definition	codon_start : 1 product : hypothetical protein LOC232875 protein_id : XP_001478400.1

name	LOC100042515 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256155 GeneID:100042515
definition	codon_start : 1 product : similar to hCG26831 protein_id : XP_001478412.1

name	Zfp329 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71037393 CCDS:CCDS20813.1 GeneID:67230 MGI:1921283
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger protein 329 protein_id : NP_080322.2

name	Zfp110 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:42734474 CCDS:CCDS20814.1 GeneID:65020 MGI:1890378
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : neurotrophin receptor interacting factor product : zinc finger protein 110 protein_id : NP_075357.3

name	Zfp128 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24418923 CCDS:CCDS20815.1 GeneID:243833 MGI:2389445
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030509 - BMP signaling pathway [Evidence IMP]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA] codon_start : 1 note : zinc finger protein 8 product : zinc finger protein 128 protein_id : NP_722497.1

name	Zscan22 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47824880 CCDS:CCDS20816.1 GeneID:232878 MGI:2443312
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : GLI-Kruppel family member HKR2 protein_id : NP_001001447.1

name	Rps5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677807 CCDS:CCDS20817.1 GeneID:20103 MGI:1097682
definition	GO_component : GO:0005830 - cytosolic ribosome (sensu Eukaryota) [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA]; GO:0015935 - small ribosomal subunit [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0007046 - ribosome biogenesis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : S5 ribosomal protein product : ribosomal protein S5 protein_id : NP_033121.1

name	2310014L17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037477 CCDS:CCDS20818.1 GeneID:381845 MGI:1924198
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC381845 protein_id : NP_084085.1

name	1810019N24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256159 GeneID:69086 MGI:1916336
definition	codon_start : 1 product : hypothetical protein LOC69086 protein_id : XP_001478450.1

name	Zfp324 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56118256 CCDS:CCDS20819.1 GeneID:243834 MGI:2444641
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : zinc finger protein 324 protein_id : NP_848847.3

name	Zfp446 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425348 CCDS:CCDS20820.1 GeneID:269870 MGI:2442185
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 product : zinc finger protein 446 protein_id : NP_780767.1

name	Slc27a5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678011 CCDS:CCDS20821.1 GeneID:26459 MGI:1347100
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence TAS]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0047747 - cholate-CoA ligase activity [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0004467 - long-chain-fatty-acid-CoA ligase activity [Evidence TAS]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006631 - fatty acid metabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0001676 - long-chain fatty acid metabolism [Evidence TAS] codon_start : 1 exception : mismatches in translation note : very long-chain acyl-Coenzyme A dehydrogenase synthase related product : solute carrier family 27 (fatty acid transporter), member 5 protein_id : NP_033538.1

name	ZBTB45 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701534 CCDS:CCDS20822.1 GeneID:232879 MGI:2685003
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger protein 499 protein_id : NP_001019870.1

name	LOC100042553 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256161 GeneID:100042553
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478476.1

name	Trim28 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755787 CCDS:CCDS20823.1 GeneID:21849 MGI:109274
definition	GO_component : GO:0000785 - chromatin [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003713 - transcription coactivator activity [Evidence IDA]; GO:0016564 - transcriptional repressor activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0045893 - positive regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : transcriptional intermediary factor 1, beta product : tripartite motif protein 28 protein_id : NP_035718.1

name	Chmp2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312151 CCDS:CCDS20824.1 GeneID:68953 MGI:1916203
definition	GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : putative breast adenocarcinoma marker protein_id : NP_081161.1

name	Ube2m (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704162 CCDS:CCDS20825.1 GeneID:22192 MGI:108278
definition	GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0004842 - ubiquitin-protein ligase activity [Evidence IEA] GO_process : GO:0006464 - protein modification [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : UBC12 homolog, yeast; ubiquitin C, related sequence 2 product : ubiquitin-conjugating enzyme E2M protein_id : NP_663553.1

name	Mzf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41281743 CCDS:CCDS20826.1 GeneID:109889 MGI:107457
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : Myeloid zinc finger protein 2; Myeloid zinc finger protein 1; zinc finger protein 121; myeloid-specific retinoic acid-responsive zinc finger protein product : zinc finger protein 98 protein_id : NP_665818.1

name	V1rj3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22003906 CCDS:CCDS20827.1 GeneID:252909 MGI:2182262
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0016503 - pheromone receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA] codon_start : 1 product : vomeronasal 1 receptor, J3 protein_id : NP_665846.1

name	LOC635187 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:635187
definition	number : 1 pseudo : _no_value

name	LOC635187 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:635187
definition	number : 2 pseudo : _no_value

name	LOC635187 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:635187
definition	number : 3 pseudo : _no_value

name	LOC635187 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:635187
definition	number : 4 pseudo : _no_value

name	LOC635187 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:635187
definition	number : 5 pseudo : _no_value

name	LOC635187 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:635187
definition	number : 6 pseudo : _no_value

name	LOC635187 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:635187
definition	number : 7 pseudo : _no_value

name	LOC100042293 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042293
definition	number : 3 pseudo : _no_value

name	LOC100042293 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042293
definition	number : 2 pseudo : _no_value

name	LOC100042293 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042293
definition	number : 1 pseudo : _no_value

name	LOC676750 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676750
definition	number : 3 pseudo : _no_value

name	LOC676750 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676750
definition	number : 2 pseudo : _no_value

name	LOC676750 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676750
definition	number : 1 pseudo : _no_value

name	LOC672893 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672893
definition	number : 1 pseudo : _no_value

name	LOC672893 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672893
definition	number : 2 pseudo : _no_value

name	LOC672893 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672893
definition	number : 3 pseudo : _no_value

name	LOC672893 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672893
definition	number : 4 pseudo : _no_value

name	LOC672893 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672893
definition	number : 5 pseudo : _no_value

name	LOC672893 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672893
definition	number : 6 pseudo : _no_value

name	LOC546931 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:546931
definition	number : 1 pseudo : _no_value

name	LOC675762 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675762
definition	number : 3 pseudo : _no_value

name	LOC675762 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675762
definition	number : 2 pseudo : _no_value

name	LOC675762 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675762
definition	number : 1 pseudo : _no_value

name	LOC665857 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665857
definition	number : 1 pseudo : _no_value

name	LOC665857 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665857
definition	number : 2 pseudo : _no_value

name	LOC673742 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673742
definition	number : 1 pseudo : _no_value

name	LOC673742 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673742
definition	number : 2 pseudo : _no_value

name	LOC100042386 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042386
definition	number : 1 pseudo : _no_value

name	LOC100042386 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042386
definition	number : 2 pseudo : _no_value

name	LOC628853 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628853
definition	number : 1 pseudo : _no_value

name	LOC665999 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665999
definition	number : 1 pseudo : _no_value

name	LOC665999 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665999
definition	number : 2 pseudo : _no_value

name	LOC100042423 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042423
definition	number : 1 pseudo : _no_value

name	LOC100042423 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042423
definition	number : 2 pseudo : _no_value

name	LOC100042423 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042423
definition	number : 3 pseudo : _no_value

name	LOC100042433 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042433
definition	number : 5 pseudo : _no_value

name	LOC100042433 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042433
definition	number : 4 pseudo : _no_value

name	LOC100042433 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042433
definition	number : 3 pseudo : _no_value

name	LOC100042433 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042433
definition	number : 2 pseudo : _no_value

name	LOC100042433 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042433
definition	number : 1 pseudo : _no_value

name	LOC100042446 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042446
definition	number : 1 pseudo : _no_value

name	LOC100042446 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042446
definition	number : 2 pseudo : _no_value

name	LOC100042446 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042446
definition	number : 3 pseudo : _no_value

name	EG666065 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666065
definition	number : 1 pseudo : _no_value

name	EG666065 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666065
definition	number : 2 pseudo : _no_value

name	EG666065 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666065
definition	number : 3 pseudo : _no_value

name	EG666065 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666065
definition	number : 4 pseudo : _no_value

name	EG666065 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666065
definition	number : 5 pseudo : _no_value

name	EG666065 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666065
definition	number : 6 pseudo : _no_value

name	EG666065 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666065
definition	number : 7 pseudo : _no_value

name	EG637908 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:637908
definition	number : 6 pseudo : _no_value

name	EG637908 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:637908
definition	number : 5 pseudo : _no_value

name	EG637908 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:637908
definition	number : 4 pseudo : _no_value

name	EG637908 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:637908
definition	number : 3 pseudo : _no_value

name	EG637908 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:637908
definition	number : 2 pseudo : _no_value

name	EG637908 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:637908
definition	number : 1 pseudo : _no_value

name	EG665798 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149256351 GeneID:665798 MGI:3648689
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 19 Proteins product : predicted gene, EG665798 pseudo : _no_value transcript_id : XR_002295.2

name	LOC100042997 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256358 GeneID:100042997
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 47 Proteins product : similar to tropomyosin pseudo : _no_value transcript_id : XR_034250.1

name	LOC628737 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256365 GeneID:628737
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 18 Proteins product : similar to aurora kinase C pseudo : _no_value transcript_id : XR_034260.1

name	LOC665861 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256378 GeneID:665861
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 12 Proteins product : similar to serine/threonine kinase AIE1 pseudo : _no_value transcript_id : XR_034271.1

name	LOC665887 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256385 GeneID:665887
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 30 Proteins product : similar to tropomyosin pseudo : _no_value transcript_id : XR_034281.1

name	LOC637541 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256131 GeneID:637541
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 12 Proteins product : similar to aurora kinase C pseudo : _no_value transcript_id : XR_033505.1

name	LOC675782 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256135 GeneID:675782
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 16 Proteins product : similar to aurora kinase C pseudo : _no_value transcript_id : XR_033520.1

name	LOC665926 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256400 GeneID:665926
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 22 Proteins product : similar to tropomyosin pseudo : _no_value transcript_id : XR_034287.1

name	LOC637571 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256403 GeneID:637571
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 13 Proteins product : similar to aurora kinase C pseudo : _no_value transcript_id : XR_034289.1

name	EG628898 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149256136 GeneID:628898 MGI:3645961
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 28 Proteins product : predicted gene, EG628898 pseudo : _no_value transcript_id : XR_033554.1

name	LOC100043075 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256426 GeneID:100043075
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 22 ESTs, 5 Proteins product : similar to ring finger protein 141 pseudo : _no_value transcript_id : XR_034297.1

name	LOC629081 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256151 GeneID:629081
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 23 Proteins product : similar to LOC654472 protein pseudo : _no_value transcript_id : XR_033648.1

name	LOC100043128 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256449 GeneID:100043128
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 25 ESTs, 24 Proteins product : similar to DnaJ (Hsp40) homolog, subfamily B, member 6 pseudo : _no_value transcript_id : XR_034320.1

clone name	MSMg01-055N16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-139M22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-299A17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-184D02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-520A15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-458O01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-339M02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-503D02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-525F21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-420C16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-235E04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-449A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-084C17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-154B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-269P02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-093L21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-430J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-114A19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-516C12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528J14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-066O18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-494C21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-426A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-217E23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-305P15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-383K16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548H19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-161H02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-135E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-543G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-499F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-437K08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-202J14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-473P22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352P19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-205L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548C17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-111C19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-214M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-532G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-134O20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-403G04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377B22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-308G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381G15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-233J09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-236A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-158A10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-512N15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-088I21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-436B16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-435P21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-356M24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-510C01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-522I17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-414H01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-345J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-532I09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-533P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-302L18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-302K17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-406O18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-180N01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-364F09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-132L10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-247B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072P08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-051P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-114F03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232N02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-270A02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-328F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-190G10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-264D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-202A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-336D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-332O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-185E08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071L11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149C07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-257A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-225A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-226E12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-258J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282G10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268C20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-028F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-224K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-178I09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206M19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173P01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-319E21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-028N04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329A01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-217P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253A07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-014O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-285L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005F02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283A05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-051P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251N16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-349E13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109K23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183B24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-258K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-120K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061C19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245L10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209P11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069C10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078A09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169J05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-048D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-335L21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078I03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283A09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284A20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-269E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-136K23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-118D21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-060J21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109G05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073L13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073O14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-119D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231D09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-314D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226G23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-026E12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293E04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010N08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099F22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099F23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-213M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-326A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-074I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264E20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173G07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242L19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235J19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-048O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139K02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-180D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-004D20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-025J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-186H20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172G14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169J16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-168N08
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-206P05.b	B6Ng01-206P05.g
ACC	GA026230	GA026231
length	1,099	216
definition	B6Ng01-206P05.b	B6Ng01-206P05.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(12,672,948 - 12,674,047)	(12,572,031 - 12,572,246)
sequence	gaattccactgtatgtgtatagaataatttatacacattgggtatagaat catgaaatgcttttagcatgaactatcctgaaggaggttgctgtgagttt tgctttaattgaattccaatgcacataggaatgcttttcaaagaagcagc ttctgtgaagcatcactacacattgggatttgccttttttgataaaactt cagaacatttaaaaatgactataattgtagcaatgtttccagtagaagta tcagagggctgctctttgatgtaatgtcattcatttcatgcaggcagaat ttaacattgatttttaatacatgttttgaaaaataatataattctatttt ctcatggctgctcctaaaacatgaagaaatgtgtatttttctttgtgatt tttgtccacaaaaaatatttttcccaaaaaaatttactctggggttaaag agatagaagacaagaacaactcctgtttctgtggagcactcagttgagtc cccagaaccaacttggtagataagtcgtcctaggtgatctcaaacccact ttgggactcgatggccactactcaggcatgtgttgcagatacagttggat gcacaagatattcatacacattaaagacaatataaaaaagctatctacct tgtcactggatagcttcttccttttgagttccatcagcaataactcagga tcctgacaaattctaaatgattaaacagacagaaatgtcttcttcctgtt tgctgaaaccttttgagcacctgcagtagaaagacagggcatcaagtaga gggatgggatttgcgaccccatagtcaaaaactctgatccagaattgttt cctgtctaaaagaactgaagggacaaaaaaggaggagagcctaaagggaa aggaggttcagtgaccggcccaaattgaaatcagttcaggggaagcccca aacctgacactataactgatgctaatggtgtgcttaaaaacaggagccta gcatgactgcccttctcaaaggccaaaaagcagataaagagtcagatgca gaatacttgcaccttacaatgaacgaagccaaagaccatgtggtggaat	aatgtaaaaattcatcatttggctgaactgatagttcctgctgatgaaat tctggattttaatatgttaaagcaaccttgatcagaagaagcatccatat gaaaatagttgttttcacgaggatttaaaaaaaaaaaaaaaaaaacatgc tcaagggagaaccgctaccctctcagagaagagacgcagatgggaggggg gactgggggaaggaga
quality values	Open. Hide. 46 31 52 35 62 62 41 24 47 62 62 47 62 47 49 47 49 62 51 62 47 62 62 62 62 62 62 59 62 59 62 43 30 43 15 35 25 50 49 43 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 62 54 62 62 62 54 54 62 56 62 62 54 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 49 42 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 54 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 49 62 54 54 62 62 62 56 62 62 62 62 47 45 62 62 62 49 62 62 62 62 49 62 62 54 62 62 62 62 62 54 52 62 62 62 62 62 62 62 42 62 62 62 62 58 52 58 58 58 54 54 54 52 58 52 54 58 45 42 54 58 54 58 46 30 58 54 52 54 42 58 54 54 54 54 45 58 58 54 58 58 58 52 58 54 58 42 54 58 58 54 58 37 41 49 54 54 58 36 58 58 58 58 41 39 54 58 52 58 58 54 54 58 58 58 47 54 45 50 52 47 58 58 58 31 37 49 50 54 58 50 54 58 42 37 58 54 58 58 58 51 53 50 51 51 29 41 32 54 51 50 40 39 53 52 52 33 53 53 51 51 41 50 58 28 46 33 58 48 58 58 41 21 58 35 36 58 51 37 46 58 41 39 53 53 40 49 50 58 44 50 52 42 53 40 41 41 51 58 20 31 58 52 52 39 39 41 53 41 37 47 32 51 39 58 46 39 31 51 30 33 58 50 32 38 41 54 54 53 43 53 23 41 32 47 42 44 53 53 33 25 40 53 31 54 54 44 32 33 19 25 18 34 42 39 32 45 26 33 34 47 42 42 25 53 28 54 23 36 20 37 54 47 22 11 54 6 25 39 31 42 16 54 54 54 15 31 40 29 26 28 33 49 52 51 27 28 45 39 31 31 31 35 28 40 27 26 53 18 12 47 22 9 52 11 9 15 22 32 31 31 33 15 46 51 46 7 33 33 30 31 30 30 24 6 41 28 12 11 30 45 37 46 51 31 8 41 40 14 21 34 13 42 20 27 32 25 12 46 15 29 43 30 27 46 23 12 24 31 23 27 10 31 32 35 34 33 42 18 9 36 17 22 24 46 30 27 37 26 25 21 11 6 46 30 21 46 10 16 16 17 17 10 12 46 31 19 15 14 36 9 36 39 41 21 38 26 31 27 23 28 11 6 6 13 32 11 35 7 13 12 23 38 27 22 32 32 11 8 6 9 31 32 9 37 21 34 20 32 9 12 20 38 42 19 23 8 17 17 33 13 29 14 8 11 22 19 22 33 29 30 17 27 21 16 43 18 16 10 10 8 23 18 39 15 22 10 13 15 9 31 39 34 15 6 13 6 5 4 4 10 30 31 8 6 4 4 6 5 6 23 20 24 24 10 9 28 8 9 16 22 10 13 17 5 6 10 15 11 10 8 7 4 14 17 14 5 5 6 10 11 27 8 18 20 10 28 5 3 3 3 15 12 6 6 7 16 16 3 4 9 6 4 2	Open. Hide. 36 62 62 59 43 24 30 27 27 27 34 38 23 23 43 38 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 59 56 49 49 42 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 59 59 59 50 56 50 48 56 50 56 46 51 51 56 62 46 46 34 43 45 51 59 56 46 59 51 59 59 56 56 59 43 43 39 23 46 30 44 50 30 56 31 46 46 24 45 39 24 59 43 59 59 50 56 56 59 62 62 62 56 31 44 50 49 56 56 56 56 51 56 56 62 31 19 14

Alignment Information

BAC End 1

BAC End 2

seq1: chr7_12672948_12674047
seq2: B6Ng01-206P05.b_50_1148 (reverse)

seq1  ATTCCACCACATGGTTCCTTGGCTTCTGTCCATTGGTTAGGTGCAAGTA-  49
      |||||||||||||| || |||||||| || |||| || ||||||||||| 
seq2  ATTCCACCACATGG-TCTTTGGCTTC-GTTCATT-GTAAGGTGCAAGTAT  47

seq1  TCTGCATCTGACTCTTTTATCTGCTTTTTGGGCCTTTGAG-AGGGCAGTC  98
      |||||||||||||| |||||||||||||| |||||||||| |||||||||
seq2  TCTGCATCTGACTC-TTTATCTGCTTTTT-GGCCTTTGAGAAGGGCAGTC  95

seq1  ATGCTAGGCTCCTGTTTTTAAGCACACCA-TAGCATCAGTAATAGTGTCA  147
      ||||||||||||||||||||||||||||| |||||||||| |||||||||
seq2  ATGCTAGGCTCCTGTTTTTAAGCACACCATTAGCATCAGTTATAGTGTCA  145

seq1  GGTTTGGGGCCTCCCCCTGAACTGGATTTCAATTTGGGCCGGTCACTGAA  197
      ||||||||| || |||||||||| ||||||||||||||||||||||||||
seq2  GGTTTGGGG-CTTCCCCTGAACT-GATTTCAATTTGGGCCGGTCACTGAA  193

seq1  CCTCCTTTCCC-TTAGGCTCTCCTCCTTTTTTGTCCCTTCAGTTCTTTTA  246
      ||||||||||| ||||||||||||||||||||||||||||||||||||||
seq2  CCTCCTTTCCCTTTAGGCTCTCCTCCTTTTTTGTCCCTTCAGTTCTTTTA  243

seq1  GACAGG-AACAATTCTGGATCAGAGTTTTTGACTATGGGGTCGC-AATCC  294
      |||||| ||||||||||||||||||||||||||||||||||||| |||||
seq2  GACAGGAAACAATTCTGGATCAGAGTTTTTGACTATGGGGTCGCAAATCC  293

seq1  CATCCCTCTACTTGATGCCCTGTCTTTCTACTGCAGGTGCTCAAAAGGTT  344
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATCCCTCTACTTGATGCCCTGTCTTTCTACTGCAGGTGCTCAAAAGGTT  343

seq1  TCAGCAAACAGGAAGAAGACATTTCTGTCTGTTTAATCATTTAGAATTTG  394
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGCAAACAGGAAGAAGACATTTCTGTCTGTTTAATCATTTAGAATTTG  393

seq1  TCAGGATCCTGAGTTATTGCTGATGGAACTCAAAAGGAAGAAGCTATCCA  444
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGGATCCTGAGTTATTGCTGATGGAACTCAAAAGGAAGAAGCTATCCA  443

seq1  GTGACAAGGTAGATAGCTTTTTTATATTGTCTTTAATGTGTATGAATATC  494
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGACAAGGTAGATAGCTTTTTTATATTGTCTTTAATGTGTATGAATATC  493

seq1  TTGTGCATCCAACTGTATCTGCAACACATGCCTGAGTAGTGGCCATCGAG  544
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTGCATCCAACTGTATCTGCAACACATGCCTGAGTAGTGGCCATCGAG  543

seq1  TCCCAAAGTGGGTTTGAGATCACCTAGGACGACTTATCTACCAAGTTGGT  594
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCCAAAGTGGGTTTGAGATCACCTAGGACGACTTATCTACCAAGTTGGT  593

seq1  TCTGGGGACTCAACTGAGTGCTCCACAGAAACAGGAGTTGTTCTTGTCTT  644
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGGGGACTCAACTGAGTGCTCCACAGAAACAGGAGTTGTTCTTGTCTT  643

seq1  CTATCTCTTTAACCCCAGAGTAAATTTTTTTGGGAAAAATATTTTTTGTG  694
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTATCTCTTTAACCCCAGAGTAAATTTTTTTGGGAAAAATATTTTTTGTG  693

seq1  GACAAAAATCACAAAGAAAAATACACATTTCTTCATGTTTTAGGAGCAGC  744
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACAAAAATCACAAAGAAAAATACACATTTCTTCATGTTTTAGGAGCAGC  743

seq1  CATGAGAAAATAGAATTATATTATTTTTCAAAACATGTATTAAAAATCAA  794
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGAGAAAATAGAATTATATTATTTTTCAAAACATGTATTAAAAATCAA  793

seq1  TGTTAAATTCTGCCTGCATGAAATGAATGACATTACATCAAAGAGCAGCC  844
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTAAATTCTGCCTGCATGAAATGAATGACATTACATCAAAGAGCAGCC  843

seq1  CTCTGATACTTCTACTGGAAACATTGCTACAATTATAGTCATTTTTAAAT  894
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTGATACTTCTACTGGAAACATTGCTACAATTATAGTCATTTTTAAAT  893

seq1  GTTCTGAAGTTTTATCAAAAAAGGCAAATCCCAATGTGTAGTGATGCTTC  944
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTCTGAAGTTTTATCAAAAAAGGCAAATCCCAATGTGTAGTGATGCTTC  943

seq1  ACAGAAGCTGCTTCTTTGAAAAGCATTCCTATGTGCATTGGAATTCAATT  994
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGAAGCTGCTTCTTTGAAAAGCATTCCTATGTGCATTGGAATTCAATT  993

seq1  AAAGCAAAACTCACAGCAACCTCCTTCAGGATAGTTCATGCTAAAAGCAT  1044
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGCAAAACTCACAGCAACCTCCTTCAGGATAGTTCATGCTAAAAGCAT  1043

seq1  TTCATGATTCTATACCCAATGTGTATAAATTATTCTATACACATACAGTG  1094
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCATGATTCTATACCCAATGTGTATAAATTATTCTATACACATACAGTG  1093

seq1  GAATTC  1100
      ||||||
seq2  GAATTC  1099

seq1: chr7_12572031_12572246
seq2: B6Ng01-206P05.g_75_290

seq1  AATGTAAAAATTCATCATTTGGCTGAACTGATAGTTCCTGCTGATGAAAT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATGTAAAAATTCATCATTTGGCTGAACTGATAGTTCCTGCTGATGAAAT  50

seq1  TCTGGATTTTAATATGTTAAAGCAACCTTGATCAGAAGAAGCATCCATAT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGGATTTTAATATGTTAAAGCAACCTTGATCAGAAGAAGCATCCATAT  100

seq1  GAAAATAGTTGTTTTCACGAGGATTTAAAAAAAAAAAAAAAAAAACATGC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAAATAGTTGTTTTCACGAGGATTTAAAAAAAAAAAAAAAAAAACATGC  150

seq1  TCAAGGGAGAACCGCTACCCTCTCAGAGAAGAGACGCAGATGGGAGGGGG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAAGGGAGAACCGCTACCCTCTCAGAGAAGAGACGCAGATGGGAGGGGG  200

seq1  GACTGGGGGAAGGAGA  216
      ||||||||||||||||
seq2  GACTGGGGGAAGGAGA  216

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information