MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-216C08
Chromosome	7 (Build37)
Map Location	150,285,503 - 150,286,355
singlet/doublet	singlet
Overlap gene	none
Upstream gene	LOC100039728, EG668763, LOC100043616, EG665295, LOC100043617, Krtap5-2, LOC100039757, LOC100039767, EG665305, Krtap5-5, EG640223, LOC672428, LOC100039800, LOC100043627, LOC100043629, ENSMUSG00000038442, Krtap5-1, Krtap5-4, LOC270015, 6330512M04Rik, Ctsd, Syt8, Tnni2, Lsp1, ENSMUSG00000043795, Tnnt3, Mrpl23, Nctc1, H19, Igf2, Igf2as, Ins2, EG640264, EG624121, Th, Ascl2, Tspan32, R74862, Cd81, Tssc4, Trpm5
Downstream gene	Kcnq1, Cdkn1c, Slc22a18, Phlda2, Nap1l4, Cars, Tnfrsf26, Tnfrsf22, Tnfrsf23, Osbpl5, Mrgprg, Mrgpre, Nadsyn1, Dhcr7, Gm498
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100039728 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039728
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2 Proteins

name	EG668763 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668763 MGI:3645383
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 18 Proteins

name	LOC100043616 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043616
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 5 Proteins

name	EG665295 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665295 MGI:3648174
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC100043617 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043617
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 4 Proteins

name	Krtap5-2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71623 MGI:1918873
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039757 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039757
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC100039767 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039767
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	EG665305 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665305 MGI:3647476
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins

name	Krtap5-5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:114666 MGI:2149673
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG640223 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:640223 MGI:3647126
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC672428 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:672428
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC100039800 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039800
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 2 Proteins pseudo : _no_value

name	LOC100043627 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043627
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100043629 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043629
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	ENSMUSG00000038442 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:436015 MGI:3642866
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein

name	Krtap5-1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50774 MGI:1354732
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krtap5-4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50775 MGI:1354758
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC270015 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:270015
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 ESTs, 7 Proteins pseudo : _no_value

name	6330512M04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320802 MGI:2444776
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ctsd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13033 MGI:88562
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Syt8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:55925 MGI:1859867
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tnni2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21953 MGI:105070
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lsp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16985 MGI:96832
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	ENSMUSG00000043795 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:677289 MGI:3642289
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 25 ESTs

name	Tnnt3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21957 MGI:109550
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrpl23 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19935 MGI:1196612
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nctc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330677 MGI:1306816
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	H19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14955 MGI:95891
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Igf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16002 MGI:96434
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Igf2as (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:111975 MGI:1195257
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ins2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16334 MGI:96573
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG640264 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:640264 MGI:3646633
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 530 ESTs, 10 Proteins

name	EG624121 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:624121 MGI:3648397
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	Th (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21823 MGI:98735
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ascl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17173 MGI:96920
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tspan32 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27027 MGI:1350360
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	R74862 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:97423 MGI:2142382
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd81 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12520 MGI:1096398
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tssc4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56844 MGI:1861712
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Trpm5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56843 MGI:1861718
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kcnq1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16535 MGI:108083
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdkn1c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12577 MGI:104564
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc22a18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18400 MGI:1336884
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Phlda2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22113 MGI:1202307
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nap1l4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17955 MGI:1316687
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cars (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27267 MGI:1351477
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tnfrsf26 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244237 MGI:2651928
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tnfrsf22 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:79202 MGI:1930270
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tnfrsf23 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:79201 MGI:1930269
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Osbpl5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:79196 MGI:1930265
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrgprg (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381974 MGI:3033145
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrgpre (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244238 MGI:2441884
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nadsyn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78914 MGI:1926164
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dhcr7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13360 MGI:1298378
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm498 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244239 MGI:2685344
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 40 Proteins

name	LOC100039728 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258278 GeneID:100039728
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2 Proteins product : similar to keratin associated protein 5-4 transcript_id : XM_001473390.1

name	EG668763 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149258300 GeneID:668763 MGI:3645383
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : predicted gene, EG668763, transcript variant 1 transcript_id : XM_001004966.2

name	EG668763 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149258298 GeneID:668763 MGI:3645383
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 17 Proteins product : predicted gene, EG668763 transcript_id : XM_001480778.1

name	LOC100043616 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258301 GeneID:100043616
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 5 Proteins product : similar to keratin associated protein 5-5 transcript_id : XM_001480779.1

name	EG665295 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149258280 GeneID:665295 MGI:3648174
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : predicted gene, EG665295 transcript_id : XM_975911.2

name	LOC100043617 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258303 GeneID:100043617
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 4 Proteins product : similar to keratin associated protein 5-4 transcript_id : XM_001480781.1

name	Krtap5-2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801685 GeneID:71623 MGI:1918873
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin associated protein 5-2 transcript_id : NM_027844.2

name	LOC100039757 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258282 GeneID:100039757
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to keratin associated protein 5-4 transcript_id : XM_001473448.1

name	LOC100039767 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258284 GeneID:100039767
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to Y25C1A.3 transcript_id : XM_001473462.1

name	EG665305 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149258286 GeneID:665305 MGI:3647476
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : predicted gene, EG665305 transcript_id : XM_975981.2

name	Krtap5-5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83715995 GeneID:114666 MGI:2149673
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin associated protein 5-5 transcript_id : NM_001037822.1

name	EG640223 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149258288 GeneID:640223 MGI:3647126
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : predicted gene, EG640223 transcript_id : XM_924640.3

name	LOC100043627 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258305 GeneID:100043627
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs product : hypothetical protein LOC100043627 transcript_id : XM_001480790.1

name	ENSMUSG00000038442 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149258290 GeneID:436015 MGI:3642866
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein product : predicted gene, ENSMUSG00000038442 transcript_id : XM_001473558.1

name	Krtap5-1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7657282 GeneID:50774 MGI:1354732
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin associated protein 5-1 transcript_id : NM_015808.1

name	Krtap5-4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114796632 GeneID:50775 MGI:1354758
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin associated protein 5-4 transcript_id : NM_015809.2

name	6330512M04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803140 GeneID:320802 MGI:2444776
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6330512M04 gene transcript_id : NM_177265.3

name	Ctsd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450788 GeneID:13033 MGI:88562
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cathepsin D transcript_id : NM_009983.2

name	Syt8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348637 GeneID:55925 MGI:1859867
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synaptotagmin VIII transcript_id : NM_018802.3

name	Tnni2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130404 GeneID:21953 MGI:105070
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : troponin I, skeletal, fast 2 transcript_id : NM_009405.2

name	Lsp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893277 GeneID:16985 MGI:96832
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lymphocyte specific 1 transcript_id : NM_019391.2

name	ENSMUSG00000043795 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149258308 GeneID:677289 MGI:3642289
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 25 ESTs product : predicted gene, ENSMUSG00000043795 transcript_id : XM_001480835.1

name	Tnnt3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378065 GeneID:21957 MGI:109550
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : troponin T3, skeletal, fast transcript_id : NM_011620.2

name	Mrpl23 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755351 GeneID:19935 MGI:1196612
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein L23 transcript_id : NM_011288.1

name	Igf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76150628 GeneID:16002 MGI:96434
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : insulin-like growth factor 2 transcript_id : NM_010514.2

name	Ins2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350788 GeneID:16334 MGI:96573
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : insulin II transcript_id : NM_008387.3

name	EG640264 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149258292 GeneID:640264 MGI:3646633
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 530 ESTs, 10 Proteins product : predicted gene, EG640264 transcript_id : XM_976302.2

name	Th (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678336 GeneID:21823 MGI:98735
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tyrosine hydroxylase transcript_id : NM_009377.1

name	Ascl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:66792797 GeneID:17173 MGI:96920
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : achaete-scute complex homolog-like 2 (Drosophila) transcript_id : NM_008554.2

name	Tspan32 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328257 GeneID:27027 MGI:1350360
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tetraspanin 32 transcript_id : NM_020286.2

name	R74862 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19526965 GeneID:97423 MGI:2142382
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence R74862 transcript_id : NM_133790.1

name	Cd81 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19526793 GeneID:12520 MGI:1096398
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD 81 antigen transcript_id : NM_133655.1

name	Tssc4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9938003 GeneID:56844 MGI:1861712
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tumor-suppressing subchromosomal transferable fragment 4 transcript_id : NM_020285.1

name	Tssc4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41281680 GeneID:56844 MGI:1861712
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tumor-suppressing subchromosomal transferable fragment 4 transcript_id : NM_138631.1

name	Trpm5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12383053 GeneID:56843 MGI:1861718
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transient receptor potential cation channel, subfamily M, member 5 transcript_id : NM_020277.1

name	Kcnq1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70887794 GeneID:16535 MGI:108083
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium voltage-gated channel, subfamily Q, member 1 transcript_id : NM_008434.2

name	Cdkn1c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803290 GeneID:12577 MGI:104564
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin-dependent kinase inhibitor 1C (P57) transcript_id : NM_009876.3

name	Slc22a18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112363087 GeneID:18400 MGI:1336884
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 22 (organic cation transporter), member 18 transcript_id : NM_008767.2

name	Slc22a18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112363085 GeneID:18400 MGI:1336884
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 22 (organic cation transporter), member 18 transcript_id : NM_001042760.1

name	Phlda2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:57863299 GeneID:22113 MGI:1202307
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pleckstrin homology-like domain, family A, member 2 transcript_id : NM_009434.2

name	Nap1l4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130698 GeneID:17955 MGI:1316687
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleosome assembly protein 1-like 4 transcript_id : NM_008672.2

name	Cars (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352266 GeneID:27267 MGI:1351477
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cysteinyl-tRNA synthetase transcript_id : NM_013742.3

name	Tnfrsf26 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802947 GeneID:244237 MGI:2651928
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tumor necrosis factor receptor superfamily, member 26 transcript_id : NM_175649.4

name	Tnfrsf22 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328313 GeneID:79202 MGI:1930270
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tumor necrosis factor receptor superfamily, member 22 transcript_id : NM_023680.2

name	Tnfrsf23 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84875522 GeneID:79201 MGI:1930269
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tumor necrosis factor receptor superfamily, member 23 transcript_id : NM_024290.3

name	Osbpl5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130695 GeneID:79196 MGI:1930265
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : oxysterol binding protein-like 5 transcript_id : NM_024289.2

name	Mrgprg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71896630 GeneID:381974 MGI:3033145
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MAS-related GPR, member G transcript_id : NM_203492.2

name	Mrgpre (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31342123 GeneID:244238 MGI:2441884
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MAS-related GPR, member E transcript_id : NM_175534.2

name	Nadsyn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21313533 GeneID:78914 MGI:1926164
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NAD synthetase 1 transcript_id : NM_030221.1

name	Dhcr7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42544247 GeneID:13360 MGI:1298378
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 7-dehydrocholesterol reductase transcript_id : NM_007856.2

name	Gm498 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82915634 GeneID:244239 MGI:2685344
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 40 Proteins product : gene model 498, (NCBI) transcript_id : XM_146165.5

name	LOC100039728 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258279 GeneID:100039728
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473440.1

name	EG668763 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94381480 GeneID:668763 MGI:3645383
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001004966.1

name	EG668763 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149258299 GeneID:668763 MGI:3645383
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480828.1

name	LOC100043616 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258302 GeneID:100043616
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480829.1

name	EG665295 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149258281 GeneID:665295 MGI:3648174
definition	codon_start : 1 product : hypothetical protein protein_id : XP_981005.2

name	LOC100043617 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258304 GeneID:100043617
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480831.1

name	Krtap5-2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386262 GeneID:71623 MGI:1918873
definition	codon_start : 1 exception : mismatches in translation product : keratin associated protein 5-2 protein_id : NP_082120.1

name	LOC100039757 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258283 GeneID:100039757
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473498.1

name	LOC100039767 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258285 GeneID:100039767
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473512.1

name	EG665305 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149258287 GeneID:665305 MGI:3647476
definition	codon_start : 1 product : hypothetical protein protein_id : XP_981075.2

name	Krtap5-5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83715996 CCDS:CCDS22026.1 GeneID:114666 MGI:2149673
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA]; GO:0045095 - keratin filament [Evidence IEA] codon_start : 1 product : keratin associated protein 5-5 protein_id : NP_001032911.1

name	EG640223 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94381468 GeneID:640223 MGI:3647126
definition	codon_start : 1 product : hypothetical protein protein_id : XP_929733.2

name	LOC100043627 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258306 GeneID:100043627
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480840.1

name	ENSMUSG00000038442 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149258291 GeneID:436015 MGI:3642866
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473608.1

name	Krtap5-1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7657283 GeneID:50774 MGI:1354732
definition	GO_component : GO:0045095 - keratin filament [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 note : keratin-associated protein 5-1 product : keratin associated protein 5-1 protein_id : NP_056623.1

name	Krtap5-4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7657285 CCDS:CCDS22027.1 GeneID:50775 MGI:1354758
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0045095 - keratin filament [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : keratin-associated protein 5-4 product : keratin associated protein 5-4 protein_id : NP_056624.1

name	6330512M04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893327 GeneID:320802 MGI:2444776
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_process : GO:0009607 - response to biotic stimulus [Evidence IEA] codon_start : 1 product : hypothetical protein LOC320802 protein_id : NP_796239.1

name	Ctsd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753556 CCDS:CCDS22029.1 GeneID:13033 MGI:88562
definition	GO_component : GO:0005764 - lysosome [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0004190 - aspartic-type endopeptidase activity [Evidence IEA]; GO:0004192 - cathepsin D activity [Evidence IEA] [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004194 - pepsin A activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] [Evidence IC] codon_start : 1 product : cathepsin D protein_id : NP_034113.1

name	Syt8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980914 CCDS:CCDS22030.1 GeneID:55925 MGI:1859867
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0008021 - synaptic vesicle [Evidence IEA] GO_function : GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : synaptotagmin 8 product : synaptotagmin VIII protein_id : NP_061272.2

name	Tnni2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678391 GeneID:21953 MGI:105070
definition	GO_component : GO:0005861 - troponin complex [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005200 - structural constituent of cytoskeleton [Evidence IEA] GO_process : GO:0006937 - regulation of muscle contraction [Evidence IEA] codon_start : 1 product : troponin I, skeletal, fast 2 protein_id : NP_033431.1

name	Lsp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11225264 GeneID:16985 MGI:96832
definition	GO_function : GO:0003779 - actin binding [Evidence TAS]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0017022 - myosin binding [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence TAS]; GO:0006935 - chemotaxis [Evidence IMP]; GO:0007010 - cytoskeleton organization and biogenesis [Evidence TAS]; GO:0006952 - defense response [Evidence IMP]; GO:0006936 - muscle contraction [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : leukocyte specific protein 1; leukocyte-specific protein 1; lymphocyte-specific protein 1 product : lymphocyte specific 1 protein_id : NP_062264.1

name	ENSMUSG00000043795 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149258309 GeneID:677289 MGI:3642289
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480885.1

name	Tnnt3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755845 CCDS:CCDS22031.1 GeneID:21957 MGI:109550
definition	GO_component : GO:0005861 - troponin complex [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence ISS]; GO:0005200 - structural constituent of cytoskeleton [Evidence IEA] GO_process : GO:0006937 - regulation of muscle contraction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : skeletal muscle fast-twitch TnT product : troponin T3, skeletal, fast protein_id : NP_035750.1

name	Mrpl23 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755352 CCDS:CCDS22032.1 GeneID:19935 MGI:1196612
definition	GO_component : GO:0005762 - mitochondrial large ribosomal subunit [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence ISS]; GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence TAS]; GO:0007046 - ribosome biogenesis [Evidence IEA] codon_start : 1 product : mitochondrial ribosomal protein L23 protein_id : NP_035418.1

name	Igf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754310 CCDS:CCDS22033.1 GeneID:16002 MGI:96434
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0008083 - growth factor activity [Evidence IEA]; GO:0005179 - hormone activity [Evidence IEA]; GO:0005159 - insulin-like growth factor receptor binding [Evidence IPI]; GO:0005515 - protein binding [Evidence IPI]; GO:0018445 - prothoracicotrophic hormone activity [Evidence IEA] GO_process : GO:0008283 - cell proliferation [Evidence IEA]; GO:0009887 - organ morphogenesis [Evidence IMP]; GO:0007582 - physiological process [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA] codon_start : 1 product : insulin-like growth factor 2 protein_id : NP_034644.1

name	Ins2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680463 CCDS:CCDS22034.1 GeneID:16334 MGI:96573
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005732 - small nucleolar ribonucleoprotein complex [Evidence IDA] GO_function : GO:0005179 - hormone activity [Evidence TAS] GO_process : GO:0007257 - activation of JNK activity [Evidence IDA]; GO:0000187 - activation of MAPK activity [Evidence IDA]; GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0006983 - ER overload response [Evidence IMP]; GO:0006006 - glucose metabolism [Evidence IMP]; GO:0015758 - glucose transport [Evidence TAS]; GO:0008286 - insulin receptor signaling pathway [Evidence IDA]; GO:0016042 - lipid catabolism [Evidence IDA]; GO:0007582 - physiological process [Evidence IEA]; GO:0042981 - regulation of apoptosis [Evidence IMP]; GO:0042325 - regulation of phosphorylation [Evidence IDA] codon_start : 1 product : insulin II protein_id : NP_032413.1

name	EG640264 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149258293 GeneID:640264 MGI:3646633
definition	codon_start : 1 product : hypothetical protein protein_id : XP_981396.2

name	Th (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678337 CCDS:CCDS22036.1 GeneID:21823 MGI:98735
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0004511 - tyrosine 3-monooxygenase activity [Evidence TAS] GO_process : GO:0009072 - aromatic amino acid family metabolism [Evidence IEA]; GO:0042423 - catecholamine biosynthesis [Evidence IEA]; GO:0006585 - dopamine biosynthesis from tyrosine [Evidence IMP] [Evidence IDA] [Evidence TAS]; GO:0042755 - eating behavior [Evidence IMP] [Evidence IGI]; GO:0007507 - heart development [Evidence IMP]; GO:0007612 - learning [Evidence IMP]; GO:0007626 - locomotory behavior [Evidence IGI] [Evidence IMP]; GO:0007617 - mating behavior [Evidence IMP]; GO:0007613 - memory [Evidence IMP]; GO:0042136 - neurotransmitter biosynthesis [Evidence IEA]; GO:0009887 - organ morphogenesis [Evidence IMP]; GO:0008016 - regulation of heart contraction [Evidence IMP]; GO:0007268 - synaptic transmission [Evidence IEA]; GO:0001963 - synaptic transmission, dopaminergic [Evidence IMP] codon_start : 1 product : tyrosine hydroxylase protein_id : NP_033403.1

name	Ascl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66792798 GeneID:17173 MGI:96920
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0001701 - embryonic development (sensu Mammalia) [Evidence IMP]; GO:0007399 - nervous system development [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA] codon_start : 1 note : mammalian achaete scute homolog 2 product : achaete-scute complex homolog-like 2 protein_id : NP_032580.2

name	Tspan32 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:14149732 CCDS:CCDS22037.1 GeneID:27027 MGI:1350360
definition	GO_component : GO:0016021 - integral to membrane [Evidence NAS] [Evidence IEA]; GO:0005622 - intracellular [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : tumor-suppressing subchromosomal transferable fragment 6 product : pan hematopoietic expression protein_id : NP_064682.1

name	R74862 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526966 GeneID:97423 MGI:2142382
definition	codon_start : 1 product : hypothetical protein LOC97423 protein_id : NP_598551.1

name	Cd81 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526794 CCDS:CCDS22038.1 GeneID:12520 MGI:1096398
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0000187 - activation of MAPK activity [Evidence ISS]; GO:0046718 - entry of virus into host cell [Evidence ISS]; GO:0006661 - phosphatidylinositol biosynthesis [Evidence ISS]; GO:0030384 - phosphoinositide metabolism [Evidence ISS]; GO:0043128 - positive regulation of 1-phosphatidylinositol 4-kinase activity [Evidence ISS]; GO:0030890 - positive regulation of B cell proliferation [Evidence TAS]; GO:0030307 - positive regulation of cell growth [Evidence TAS]; GO:0050731 - positive regulation of peptidyl-tyrosine phosphorylation [Evidence ISS]; GO:0008104 - protein localization [Evidence ISS]; GO:0046813 - virion attachment, binding of host cell surface receptor [Evidence ISS] codon_start : 1 product : CD 81 antigen protein_id : NP_598416.1

name	Tssc4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9938004 GeneID:56844 MGI:1861712
definition	codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : tumor-suppressing subchromosomal transferable fragment 4 isoform 1 protein_id : NP_064681.1

name	Tssc4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41281681 GeneID:56844 MGI:1861712
definition	codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : tumor-suppressing subchromosomal transferable fragment 4 isoform 2 protein_id : NP_619537.1

name	Trpm5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12383054 GeneID:56843 MGI:1861718
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy function : TRP channel note : long transient receptor potential-related channel 5 product : transient receptor potential cation channel, subfamily M, member 5 protein_id : NP_064673.1

name	Kcnq1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70887795 CCDS:CCDS22039.1 GeneID:16535 MGI:108083
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0008076 - voltage-gated potassium channel complex [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0005267 - potassium channel activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA]; GO:0005249 - voltage-gated potassium channel activity [Evidence IEA] GO_process : GO:0016458 - gene silencing [Evidence IMP]; GO:0006349 - imprinting [Evidence IMP]; GO:0006811 - ion transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : potassium voltage-gated channel subfamily Q member 1 product : potassium voltage-gated channel, subfamily Q, member 1 protein_id : NP_032460.2

name	Cdkn1c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981849 CCDS:CCDS22040.1 GeneID:12577 MGI:104564
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0004861 - cyclin-dependent protein kinase inhibitor activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004860 - protein kinase inhibitor activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0007050 - cell cycle arrest [Evidence IEA]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IGI]; GO:0042551 - neuron maturation [Evidence IMP] codon_start : 1 exception : mismatches in translation product : cyclin-dependent kinase inhibitor 1C (P57) protein_id : NP_034006.2

name	Slc22a18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112363086 GeneID:18400 MGI:1336884
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008514 - organic anion transporter activity [Evidence TAS]; GO:0015293 - symporter activity [Evidence IEA]; GO:0015520 - tetracycline:hydrogen antiporter activity [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006820 - anion transport [Evidence TAS]; GO:0006811 - ion transport [Evidence IEA]; GO:0015904 - tetracycline transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : organic cationic transporter-like 2; solute carrier family 22 (organic cation transporter), member 1-like product : solute carrier family 22 (organic cation transporter), member 18 protein_id : NP_001036225.1

name	Slc22a18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112363088 CCDS:CCDS22041.1 GeneID:18400 MGI:1336884
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008514 - organic anion transporter activity [Evidence TAS]; GO:0015293 - symporter activity [Evidence IEA]; GO:0015520 - tetracycline:hydrogen antiporter activity [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006820 - anion transport [Evidence TAS]; GO:0006811 - ion transport [Evidence IEA]; GO:0015904 - tetracycline transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : organic cationic transporter-like 2; solute carrier family 22 (organic cation transporter), member 1-like product : solute carrier family 22 (organic cation transporter), member 18 protein_id : NP_032793.2

name	Phlda2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678447 CCDS:CCDS22042.1 GeneID:22113 MGI:1202307
definition	GO_component : GO:0005737 - cytoplasm [Evidence TAS] GO_process : GO:0009887 - organ morphogenesis [Evidence IMP] codon_start : 1 note : tumor-suppressing subchromosomal transferable fragment 3 product : pleckstrin homology-like domain, family A, member 2 protein_id : NP_033460.1

name	Nap1l4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679012 GeneID:17955 MGI:1316687
definition	codon_start : 1 note : nucleosome assembly protein 1 like 4 product : nucleosome assembly protein 1-like 4 protein_id : NP_032698.1

name	Cars (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980754 GeneID:27267 MGI:1351477
definition	GO_function : GO:0004812 - aminoacyl-tRNA ligase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006418 - tRNA aminoacylation for protein translation [Evidence IEA] codon_start : 1 exception : mismatches in translation product : cysteinyl-tRNA synthetase protein_id : NP_038770.2

name	Tnfrsf26 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28316748 GeneID:244237 MGI:2651928
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : TNF receptor homolog 3; tumor necrosis factor receptor superfamily, member 24 product : tumor necrosis factor receptor superfamily, member 26 protein_id : NP_783580.1

name	Tnfrsf22 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50838796 CCDS:CCDS22043.1 GeneID:79202 MGI:1930270
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence NAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IDA] [Evidence IEA]; GO:0045569 - TRAIL binding [Evidence IDA] GO_process : GO:0042981 - regulation of apoptosis [Evidence IDA] codon_start : 1 note : tumor necrosis factor receptor superfamily, member 1a-like 2 product : tumor necrosis factor receptor superfamily, member 22 protein_id : NP_076169.2

name	Tnfrsf23 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28269699 CCDS:CCDS22044.1 GeneID:79201 MGI:1930269
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : decoy TRAIL receptor 1; tumor necrosis factor receptor superfamily, member 1a-like 1 product : tumor necrosis factor receptor superfamily, member 23 protein_id : NP_077252.2

name	Osbpl5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15011889 GeneID:79196 MGI:1930265
definition	GO_component : GO:0005829 - cytosol [Evidence ISS] GO_function : GO:0008142 - oxysterol binding [Evidence ISS] GO_process : GO:0008203 - cholesterol metabolism [Evidence ISS]; GO:0030301 - cholesterol transport [Evidence ISS]; GO:0006893 - Golgi to plasma membrane transport [Evidence ISS]; GO:0006869 - lipid transport [Evidence IEA]; GO:0008202 - steroid metabolism [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : oxysterol-binding protein-related protein 5; OSBP-related protein 5; oxysterol binding protein 2; oxysterol binding protein homolog 1 product : oxysterol-binding protein-like protein 5 protein_id : NP_077251.1

name	Mrgprg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:45237191 CCDS:CCDS22045.1 GeneID:381974 MGI:3033145
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : G protein-coupled receptor MrgG product : MAS-related GPR, member G protein_id : NP_987077.1

name	Mrgpre (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425312 CCDS:CCDS22046.1 GeneID:244238 MGI:2441884
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : G protein-coupled receptor MrgE protein_id : NP_780743.1

name	Nadsyn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313534 CCDS:CCDS22047.1 GeneID:78914 MGI:1926164
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016810 - hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0003952 - NAD+ synthase (glutamine-hydrolyzing) activity [Evidence ISS] [Evidence IEA]; GO:0008795 - NAD+ synthase activity [Evidence ISS]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0009435 - NAD biosynthesis [Evidence ISS] [Evidence IEA]; GO:0006807 - nitrogen compound metabolism [Evidence IEA] codon_start : 1 note : NH3-dependent NAD+ synthetase-like protein product : NAD synthetase 1 protein_id : NP_084497.1

name	Dhcr7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681179 CCDS:CCDS22048.1 GeneID:13360 MGI:1298378
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0047598 - 7-dehydrocholesterol reductase activity [Evidence IDA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0001568 - blood vessel development [Evidence IMP]; GO:0030154 - cell differentiation [Evidence IMP]; GO:0006695 - cholesterol biosynthesis [Evidence IEA]; GO:0008610 - lipid biosynthesis [Evidence IEA]; GO:0030324 - lung development [Evidence IMP]; GO:0042127 - regulation of cell proliferation [Evidence IMP]; GO:0006694 - steroid biosynthesis [Evidence IEA]; GO:0016126 - sterol biosynthesis [Evidence IMP] codon_start : 1 product : 7-dehydrocholesterol reductase protein_id : NP_031882.1

name	Gm498 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82915635 GeneID:244239 MGI:2685344
definition	codon_start : 1 product : similar to actin-12 protein_id : XP_146165.5

name	LOC672428 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672428
definition	number : 2 pseudo : _no_value

name	LOC672428 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672428
definition	number : 1 pseudo : _no_value

name	LOC100043629 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043629
definition	number : 1 pseudo : _no_value

name	LOC100039800 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149258289 GeneID:100039800
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 2 Proteins product : similar to keratin associated protein 5-1 pseudo : _no_value transcript_id : XR_031268.1

name	LOC270015 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149258307 GeneID:270015
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 ESTs, 7 Proteins product : similar to ribosomal protein L27a-like pseudo : _no_value transcript_id : XR_034843.1

name	Nctc1 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:73476373 GeneID:330677 MGI:1306816
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : non-coding transcript 1 transcript_id : NR_002452.1

name	H19 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:41462403 GeneID:14955 MGI:95891
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : H19 fetal liver mRNA transcript_id : NR_001592.1

name	Igf2as (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:84872152 GeneID:111975 MGI:1195257
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : insulin-like growth factor 2, antisense transcript_id : NR_002855.1

name	EG624121 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149258310 GeneID:624121 MGI:3648397
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG624121 transcript_id : XR_035463.1

clone name	MSMg01-170A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309F24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290G22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-501N18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-185C20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-422P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-431E13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-477I16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-131F18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-426I12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-442P18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-386L23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-438M11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-466M24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-272D22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-116I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-303P23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-545K20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-412K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-508H06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-300B02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-300F07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387M04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-275D07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-183L16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-524B19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-217H15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-395H20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-433L06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-382K24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-468P05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-146J09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-317K17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-346M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-367G06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-379L13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-434L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-371A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-289A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-410J06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-453H05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-061I04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-170M13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-274C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-080F17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-136M01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-458D02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-290M05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-171K10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-264K03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-060L11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-129J17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-121N04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-532O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-395G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462J03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-403H15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-358C03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-088B16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-145M11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-468N09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-487C17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372L14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-400H12
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-402J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-305E22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-330I15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-478K16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-328D19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-079I12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-188F02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-336N21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-395A16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-161M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-160L18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-341G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-459B15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-360I11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-470M20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-455H01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-322C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-436I05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-428M19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-252E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194D13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-213N19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-044B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295N23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039O06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-026D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026G19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194O20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-098J11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-311P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287I13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-195D18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221G22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216C08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-315G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-145N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313P17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-274F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326P11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-072J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332H16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-272F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-314B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113J12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-097A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222E14
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-216C08.b	B6Ng01-216C08.g
ACC	GA032911	GA032912
length	1,207	856
definition	B6Ng01-216C08.b	B6Ng01-216C08.g
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattccaggatacaatgagtagacaaaacctagggataataggagtaga ggagaatgaagattttcaacttaaagggtcagcaaatatcttcaacaaaa ttatagaagaaaacttcccaaacctaaagtaagagatgcccatgaacata caagaaccctacaaaactccaaatagactggaccagaaaagaaattcctc ccaacacataataatcagaacaacaaatgcactaaatatagaatattaaa agtagtaagggaaaaaggtcaagtgacatataaaggcaggcctattagaa ttacatcagacttctcaccagagactatgaaagccagaaatcctggacag atgttatacagatcctaagaaaacacaaatgccagcccaggctgctatac ccagcaaaattctcaattaccatagatggaaaaaccaaaatattccatga taagaccaaattcacacaatgtctttcctcatatccagcccttcaaagga taataaagggaaaacaacaacacaagtacagaaaccacaccctagaaaaa gcaagaaagtaatccttcaacaaacctaatagaagatagccacaagaaca gaatcccaagtttaacaacaaaaataacaagaagcaacaattacttttct ttaatttctcttaacatcaatagactcaattccccaataaaaagacatag actaatagactggctacacaaacaggacacaacattttgctgctgacagg aaacccacctcagggacaaagacagacactacctcagagtgaaaggctgg aaaacaattttccaagcaaatggtcagaagaaacaagctggagtagtcat tttaatatcgaacaaactactttccaacccaaagttatcaaaaaagacaa ggaggggcacatcatactcatcaaaggcaaaatctaccaagatgaactct caattctgaatatgctccaaatacaaggacatccacattaattaagaaac tttagtaagccctaagcacatatgcacctcacacaatatagtgggagacg ttaacacccccactgcaccatgggacagattctggtacagaaactaatag agacccatgaacacctacgaaatatgaacatggaattaatgaattctacg gaccttattcctaaataagaaattacctctttctcagaccacaatggtat acttcct	gaattctgtggcagatggtggtagctccctggaagggggcccttcagtat ttgctagaactgaatctatcagcataagccaagtgccaacagccctcctg cctagaagtgcttttcatgcttagatggggcctcaggggtatgtgtggct ttctagagacctgagcaagatcttaggcagctttaccacaggtctcaact tcagactaaagtaagcactatgtaagactaaagtaagttctgatacctca ctagcactggcttggtgctggtgagggaatgacagggtatcatttgcaga gacagcctggtcaccagttaaccctcacacaactttgttaaattgtgtat aactgtggccccatggggtggttcctggtgccttattgggctgctggtct cccctctgaacacatccttcccactgtgttcttaagagactgtccttgga gcagtcacaaaagggagctcacaaaaggctgtttgaatgtgtctgacata catgcacactgcacacacttgcacacaaccctcagtattctcagccggtt accagcttggcatcttggaagaggagagtgtgggtgggtgtggcctatgg gtaaggagtggcggaatgacagcatgcctagctcctttctattctgcata tggactggctcagaaggaaacttttcttcacaaatgactgtccagccttt ctcccacagagcaaagcacagtgggttcttggtgcacctagtgagatgac tttcagatacagtgtgcgtgggagggaggataagatatcagggccaaagg atgctgtgacaagcccaatgttttgtccctaccgaccctggggtcctttc agggag
quality values	Open. Hide. 49 29 34 34 58 58 35 18 58 58 38 27 43 62 27 62 62 62 62 62 62 62 62 54 62 51 62 62 62 62 62 42 39 22 34 34 16 44 51 56 50 43 38 62 62 62 62 62 62 62 62 62 62 62 62 54 59 62 62 62 62 59 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 62 54 38 59 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 49 54 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 54 62 62 62 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 52 58 49 49 58 54 49 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 54 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 52 58 58 58 54 58 52 58 58 58 58 58 58 58 58 58 58 58 58 58 58 51 54 58 51 58 58 47 58 51 53 58 58 50 58 58 58 58 58 58 58 58 58 58 58 58 52 51 34 58 58 51 46 52 58 47 58 51 58 51 51 58 58 58 58 50 51 50 43 40 50 51 49 58 51 52 50 39 28 50 58 37 58 58 58 54 52 47 58 54 50 58 54 58 58 52 53 41 51 58 37 46 50 51 49 52 41 58 58 32 50 50 58 35 31 52 52 58 58 37 50 52 42 52 47 42 42 42 51 53 39 39 49 41 51 53 37 54 41 31 51 47 51 39 28 17 44 41 49 38 34 54 54 54 54 53 49 40 31 53 51 51 44 45 52 52 53 47 45 45 47 40 40 54 44 34 47 37 44 40 53 29 54 35 44 42 45 54 45 45 45 44 25 53 54 40 44 54 49 47 36 32 47 36 29 37 32 34 31 29 29 51 32 52 47 27 46 52 34 32 51 45 39 25 5 33 33 14 22 32 49 32 32 32 32 27 34 31 26 30 43 31 31 37 32 31 30 28 18 46 22 31 32 30 51 34 30 51 22 30 33 27 31 51 46 34 28 29 34 31 51 51 34 31 23 30 29 31 30 30 46 32 27 36 46 25 31 22 28 46 39 19 46 46 43 31 27 26 31 31 26 22 38 27 24 31 36 27 31 36 31 31 46 46 42 27 31 31 38 31 24 31 32 27 21 44 46 39 21 31 32 33 31 47 36 32 36 18 21 24 33 19 17 38 30 38 25 22 24 31 25 20 48 48 46 47 31 22 30 16 30 15 24 16 31 22 47 47 33 21 28 22 24 31 31 27 31 27 30 33 21 16 37 33 32 44 14 18 22 5 17 43 44 21 22 30 30 32 27 25 11 21 21 36 21 30 25 30 29 23 17 19 32 23 7 10 5 10 25 19 23 18 20 23 32 34 29 32 15 16 25 48 9 13 18 20 14 8 25 17 25 23 15 24 25 34 23 24 19 32 22 18 8 19 10 25 14 16 17 43 11 18 23 48 32 23 19 18 22 30 16 14 27 16 9 11 26 20 28 14 17 15 12 6 12 8 8 12 20 7 22 19 17 15 6 9 21 11 7 17 9 18 13 13 26 47 28 21 11 28 10 14 20 26 19 19 10 5 7 29 23 29 7 7 6 26 16 11 6 4 3 16 4 9 27 7 14 8 4 12 22 17 19 13 6 16 17 9 13 7 5 10 7 23 17 13 10 19 9 6 4 6 6 4 5 5 4 6 4 10 10 3 4 6 4 6 7 19 18 9 5 10 10 7 5 2 8 7 17 8 5 5 1 8 15 6 4 25 24 15 15 6 4 8 5 4 4 5 13 5 8 5 6 8 4 3 5 3 4 7 5 11 14 10 7 17 9 4 6 4 3 2 6 5 5 13 5 7 16 24 8 19 24 10 4 4 7 23 6 2 3 2 4 5 8 5 9 15 2 1 2 4 8 8 4 9 2 2 2	Open. Hide. 62 49 51 47 62 62 47 47 62 62 44 29 25 18 33 28 28 28 34 38 29 36 50 56 59 62 62 62 62 62 59 62 59 62 59 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 54 59 49 59 50 56 56 56 56 56 59 56 56 56 59 59 59 50 62 59 59 59 59 51 59 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 56 62 59 59 62 62 62 62 59 59 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 59 62 62 54 62 59 50 59 59 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 56 62 59 59 62 62 62 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 59 43 43 59 59 59 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 51 54 62 62 62 62 62 62 62 62 62 62 62 51 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 56 47 49 62 62 62 62 62 62 62 62 62 62 62 54 56 62 62 62 62 62 62 62 62 62 62 62 56 56 46 47 62 56 62 56 62 43 62 62 62 62 62 62 56 47 39 62 56 62 62 62 62 43 62 56 56 62 62 62 62 52 62 47 33 62 33 62 54 38 62 54 62 54 42 62 62 46 45 62 62 62 62 62 47 34 31 19 20 38 46 62 52 52 40 52 52 62 42 58 52 32 52 54 43 37 48 36 45 34 41 54 26 30 9 11 13 29 37 52 20 27 33 16 9 28 30 52 54 15 52 13 23 19 35 34 52 38 35 26 21 21 12 17 30 41 52 46 26 20 26 28 22 40 38 35 24 39 19 12 22 28 27 37 22 11 42 30 32 38 18 26 35 25 22 31 33 20 39 42 52 39 39 54 24 25 31 18 19 27 26 8 48 48 35 39 18 33 42 10 22 21 10 34 24 23 25 9 7 9 19 39 46 19 19 7 20 33 46 25 39 37 23 47 30 34 16 31 33 19 25 33 9 13 16 6 10 18 13 41 32 21 32 39 32 36 6 32 26 16 36 13 36 30 17 23 15 23 12 46 29 29 26 24 31 15 20 7 19 15 32 32 13 22 18 10 28 18 23 13 9 9 6 6 11 33 19 10 19 22 21 8 6 13 21 18 19 17 19 18 7 14 21 10 13 13 5 19 23 16 6 5 9 10 8 6 7 9 13 13 12 17 18 22 16 9 18 12 11 9 8 13 25 25 23 13 15 9 9 17 10 14 13 10 9 17 13 6 6 7

Alignment Information

BAC End 1

BAC End 2

seq1: chr7_150285503_150286355
seq2: B6Ng01-216C08.g_68_923

seq1  GAATTCTGTGGCAGATGGTGGTAGCTCCCTGGAAGGGGGCCCTTCAGTAT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTGTGGCAGATGGTGGTAGCTCCCTGGAAGGGGGCCCTTCAGTAT  50

seq1  TTGCTAGAACTGAATCTATCAGCATAAGCCAAGTGCCAACAGCCCTCCTG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGCTAGAACTGAATCTATCAGCATAAGCCAAGTGCCAACAGCCCTCCTG  100

seq1  CCTAGAAGTGCTTTTCATGCTTAGATGGGGCCTCAGGGGTATGTGTGGCT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTAGAAGTGCTTTTCATGCTTAGATGGGGCCTCAGGGGTATGTGTGGCT  150

seq1  TTCTAGAGACCTGAGCAAGATCTTAGGCAGCTTTACCACAGGTCTCAACT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTAGAGACCTGAGCAAGATCTTAGGCAGCTTTACCACAGGTCTCAACT  200

seq1  TCAGACTAAAGTAAGCACTATGTAAGACTAAAGTAAGTTCTGATACCTCA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGACTAAAGTAAGCACTATGTAAGACTAAAGTAAGTTCTGATACCTCA  250

seq1  CTAGCACTGGCTTGGTGCTGGTGAGGGAATGACAGGGTATCATTTGCAGA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAGCACTGGCTTGGTGCTGGTGAGGGAATGACAGGGTATCATTTGCAGA  300

seq1  GACAGCCTGGTCACCAGTTAACCCTCACACAACTTTGTTAAATTGTGTAT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACAGCCTGGTCACCAGTTAACCCTCACACAACTTTGTTAAATTGTGTAT  350

seq1  AACTGTGGCCCCATGGGGTGGTTCCTGGTGCCTTATTGGGCTGCTGGTCT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACTGTGGCCCCATGGGGTGGTTCCTGGTGCCTTATTGGGCTGCTGGTCT  400

seq1  CCCCTCTGAACACATCCTTCCCACTGTGTTCTTAAGAGACTGTCCTTGGA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCCTCTGAACACATCCTTCCCACTGTGTTCTTAAGAGACTGTCCTTGGA  450

seq1  GCAGTCACAAAAGGGAGCTCACAAAAGGCTGTTTGAATGTGTCTGACATA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAGTCACAAAAGGGAGCTCACAAAAGGCTGTTTGAATGTGTCTGACATA  500

seq1  CATGCACACTGCACACACTTGCACACAACCCTCAGTATTCTCAGCCGGTT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGCACACTGCACACACTTGCACACAACCCTCAGTATTCTCAGCCGGTT  550

seq1  ACCAGCTTGGCATCTTGGAAGAGGAGAGTGTGGGTGGGTGTGGCCTATGG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCAGCTTGGCATCTTGGAAGAGGAGAGTGTGGGTGGGTGTGGCCTATGG  600

seq1  GTAAGGAGTGGCGGAATGACAGCATGCCTAGCTCC-TTCTATTCTGCATA  649
      ||||||||||||||||||||||||||||||||||| ||||||||||||||
seq2  GTAAGGAGTGGCGGAATGACAGCATGCCTAGCTCCTTTCTATTCTGCATA  650

seq1  TGGACTGGCTCAGAAGGAAAC-TTTCTTCACAAATGACTGTCCAGCC-TT  697
      ||||||||||||||||||||| ||||||||||||||||||||||||| ||
seq2  TGGACTGGCTCAGAAGGAAACTTTTCTTCACAAATGACTGTCCAGCCTTT  700

seq1  CTCCCACAGAGCAGAGCACAGTGGGTTCTTGGTGCACCTAGTGAGATGAC  747
      ||||||||||||| ||||||||||||||||||||||||||||||||||||
seq2  CTCCCACAGAGCAAAGCACAGTGGGTTCTTGGTGCACCTAGTGAGATGAC  750

seq1  -TTCAGATACAGTGTGCGTGGGAGGGAGGATAAGATATCAGGGCCAAAGG  796
       |||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCAGATACAGTGTGCGTGGGAGGGAGGATAAGATATCAGGGCCAAAGG  800

seq1  ATGCTG-GACAAGCCCAATTGTTTTTGTCCTACCGACTCTGGGGTCCCTT  845
      |||||| ||||||||||| ||||||   ||||||||| ||||||||| ||
seq2  ATGCTGTGACAAGCCCAA-TGTTTTGTCCCTACCGACCCTGGGGTCCTTT  849

seq1  CATGGGAG  853
      || |||||
seq2  CA-GGGAG  856

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information