MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-270B13
Chromosome	7 (Build37)
Map Location	19,584,970 - 19,585,437
singlet/doublet	singlet
Overlap gene	P42pop
Upstream gene	Ceacam13, LOC384560, Ceacam12, Igfl3, LOC671190, Mill1, Psg18, LOC546936, Psg28, LOC666831, EG574429, EG232930, Psg25, EG545925, Psg23, Psg21, EG434540, BC050099, LOC666863, Sycp1-ps1, Psg19, Psg17, Mill2, Pglyrp1, C530028I08Rik, Nova2, Nanos2
Downstream gene	Irf2bp1, Foxa3, Sympk, Rshl1, Dmwd, Dmpk, Six5, EG243866, Fbxo46, Qpctl, Snrpd2, Gipr, Eml2, Gpr4, Opa3, Vasp, C79127, Rtn2, Fosb, D830036C21Rik, Ercc1, Cd3eap, Ppp1r13l, Ercc2, Klc3, Ckm, Mark4, 4933417E01Rik, Bloc1s3, Trappc6a, Nkpd1, BC024868, Gemin7, Zfp296, Sfrs16, Relb, Clptm1, Apoc2, Apoc4, Apoc1, Apoe, Tomm40, Pvrl2, Bcam, Cblc, Bcl3, Ceacam16, Ceacam19, Pvr, 2210010C17Rik, EG243872, Ceacam20
Link	Open Mouse BAC browser

Click to get alignment info.

name	Ceacam13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69785 MGI:1917035
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC384560 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:384560
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Ceacam12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67315 MGI:1914565
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Igfl3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232925 MGI:2685426
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC671190 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:671190
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 15 Proteins pseudo : _no_value

name	Mill1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:266815 MGI:2179988
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Psg18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26438 MGI:1347251
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC546936 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546936
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 21 Proteins pseudo : _no_value

name	Psg28 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:114871 MGI:1891360
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666831 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666831
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins pseudo : _no_value

name	EG574429 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:574429 MGI:3643750
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG232930 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232930 MGI:3648786
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 2 Proteins

name	Psg25 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:114868 MGI:1891357
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG545925 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545925 MGI:3649013
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Psg23 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56868 MGI:1891355
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Psg21 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72242 MGI:1891353
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG434540 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434540 MGI:3648784
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 23 Proteins

name	BC050099 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243862 MGI:2681855
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666863 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666863
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Sycp1-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20958 MGI:1098279
definition	gene_synonym : Sycp1-rs note : synaptonemal complex protein 1, pseudogene 1 pseudo : _no_value

name	Psg19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26439 MGI:1347252
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Psg17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26437 MGI:1347250
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mill2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243864 MGI:2179989
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Pglyrp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21946 MGI:1345092
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C530028I08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232933 MGI:2685005
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nova2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384569 MGI:104296
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nanos2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:378430 MGI:2676627
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	P42pop (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232934 MGI:2446472
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Irf2bp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:272359 MGI:2442159
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Foxa3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15377 MGI:1347477
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sympk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68188 MGI:1915438
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 mRNAs, 217 ESTs, 2 Proteins

name	Rshl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83434 MGI:1927643
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dmwd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13401 MGI:94907
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dmpk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13400 MGI:94906
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Six5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20475 MGI:106220
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG243866 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243866 MGI:3647482
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Fbxo46 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243867 MGI:2444918
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Qpctl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67369 MGI:1914619
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snrpd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107686 MGI:98345
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gipr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381853 MGI:1352753
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eml2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72205 MGI:1919455
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 87 ESTs, 13 Proteins

name	Gpr4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319197 MGI:2441992
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Opa3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:403187 MGI:2686271
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vasp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22323 MGI:109268
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C79127 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232941 MGI:2142330
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rtn2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20167 MGI:107612
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Fosb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14282 MGI:95575
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D830036C21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330479 MGI:2685688
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Ercc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13870 MGI:95412
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd3eap (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70333 MGI:1917583
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppp1r13l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:333654 MGI:3525053
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ercc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13871 MGI:95413
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232943 MGI:1277971
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ckm (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12715 MGI:88413
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mark4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232944 MGI:1920955
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4933417E01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74463 MGI:1921713
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bloc1s3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232946 MGI:2678952
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trappc6a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67091 MGI:1914341
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nkpd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69547 MGI:1916797
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 1 EST, 2 Proteins

name	BC024868 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232947 MGI:2687042
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gemin7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69731 MGI:1916981
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp296 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:63872 MGI:1926956
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sfrs16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53609 MGI:1855695
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Relb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19698 MGI:103289
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Clptm1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56457 MGI:1927155
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Apoc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11813 MGI:88054
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Apoc4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11425 MGI:87878
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Apoc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11812 MGI:88053
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Apoe (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11816 MGI:88057
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tomm40 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53333 MGI:1858259
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pvrl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19294 MGI:97822
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bcam (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57278 MGI:1929940
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cblc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80794 MGI:1931457
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bcl3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12051 MGI:88140
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ceacam16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330483 MGI:2685615
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ceacam19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319930 MGI:2443001
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pvr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52118 MGI:107741
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2210010C17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70080 MGI:1917330
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG243872 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243872 MGI:3644288
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 476 ESTs, 12 Proteins

name	Ceacam20 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71601 MGI:1918851
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ceacam13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348500 GeneID:69785 MGI:1917035
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CEA-related cell adhesion molecule 13 transcript_id : NM_028171.2

name	Ceacam13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352676 GeneID:69785 MGI:1917035
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CEA-related cell adhesion molecule 13 transcript_id : NM_027210.2

name	Ceacam12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13385587 GeneID:67315 MGI:1914565
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CEA-related cell adhesion molecule 12 transcript_id : NM_026087.1

name	Igfl3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50979275 GeneID:232925 MGI:2685426
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : IGF-like family member 3 transcript_id : NM_001003393.1

name	Mill1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142360553 GeneID:266815 MGI:2179988
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MHC I like leukocyte 1 transcript_id : NM_153749.3

name	Psg18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755189 GeneID:26438 MGI:1347251
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pregnancy specific glycoprotein 18 transcript_id : NM_011963.1

name	Psg28 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70778834 GeneID:114871 MGI:1891360
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pregnancy-specific glycoprotein 28 transcript_id : NM_054063.3

name	EG574429 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71274189 GeneID:574429 MGI:3643750
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG574429 transcript_id : NM_001029893.1

name	EG232930 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256317 GeneID:232930 MGI:3648786
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 2 Proteins product : predicted gene, EG232930 transcript_id : XM_894409.3

name	Psg25 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:75832036 GeneID:114868 MGI:1891357
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pregnancy-specific glycoprotein 25 transcript_id : NM_054060.1

name	EG545925 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:81230477 GeneID:545925 MGI:3649013
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG545925 transcript_id : NM_001037168.1

name	Psg23 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350159 GeneID:56868 MGI:1891355
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pregnancy-specific glycoprotein 23 transcript_id : NM_020261.3

name	Psg21 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365864 GeneID:72242 MGI:1891353
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pregnancy-specific glycoprotein 21 transcript_id : NM_027403.3

name	EG434540 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256554 GeneID:434540 MGI:3648784
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins product : predicted gene, EG434540 transcript_id : XM_486384.3

name	BC050099 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:52138531 GeneID:243862 MGI:2681855
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC050099 transcript_id : NM_001004152.1

name	Psg19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755191 GeneID:26439 MGI:1347252
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pregnancy specific glycoprotein 19 transcript_id : NM_011964.1

name	Psg17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114796627 GeneID:26437 MGI:1347250
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pregnancy specific glycoprotein 17 transcript_id : NM_007677.2

name	Mill2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:52693918 GeneID:243864 MGI:2179989
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MHC I like leukocyte 2 transcript_id : NM_153761.2

name	Mill2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24415385 GeneID:243864 MGI:2179989
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MHC I like leukocyte 2 transcript_id : NM_153760.1

name	Pglyrp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130401 GeneID:21946 MGI:1345092
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peptidoglycan recognition protein 1 transcript_id : NM_009402.2

name	C530028I08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142363777 GeneID:232933 MGI:2685005
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C530028I08 gene transcript_id : NM_001033314.2

name	Nova2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71274145 GeneID:384569 MGI:104296
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neuro-oncological ventral antigen 2 transcript_id : NM_001029877.1

name	Nanos2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34610230 GeneID:378430 MGI:2676627
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nanos homolog 2 (Drosophila) transcript_id : NM_194064.1

name	P42pop (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142381397 GeneID:232934 MGI:2446472
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Myb protein P42POP transcript_id : NM_145579.2

name	Irf2bp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:32129220 GeneID:272359 MGI:2442159
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interferon regulatory factor 2 binding protein 1 transcript_id : NM_178757.3

name	Foxa3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130865 GeneID:15377 MGI:1347477
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : forkhead box A3 transcript_id : NM_008260.2

name	Sympk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256562 GeneID:68188 MGI:1915438
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 mRNAs, 217 ESTs, 2 Proteins product : symplekin transcript_id : XM_485873.4

name	Rshl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13752582 GeneID:83434 MGI:1927643
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : radial spokehead-like 1 transcript_id : NM_031255.1

name	Dmwd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31044424 GeneID:13401 MGI:94907
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dystrophia myotonica-containing WD repeat motif transcript_id : NM_010058.1

name	Dmpk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:14192944 GeneID:13400 MGI:94906
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dystrophia myotonica-protein kinase transcript_id : NM_032418.1

name	Six5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:73532775 GeneID:20475 MGI:106220
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sine oculis-related homeobox 5 homolog (Drosophila) transcript_id : NM_011383.1

name	EG243866 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379512 GeneID:243866 MGI:3647482
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG243866 transcript_id : XM_485874.4

name	Fbxo46 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31342111 GeneID:243867 MGI:2444918
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box protein 46 transcript_id : NM_175530.2

name	Qpctl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129858 GeneID:67369 MGI:1914619
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutaminyl-peptide cyclotransferase-like transcript_id : NM_026111.3

name	Snrpd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037144 GeneID:107686 MGI:98345
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small nuclear ribonucleoprotein D2 transcript_id : NM_026943.1

name	Gipr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124249102 GeneID:381853 MGI:1352753
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gastric inhibitory polypeptide receptor transcript_id : NM_001080815.1

name	Eml2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379500 GeneID:72205 MGI:1919455
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 80 ESTs, 2 Proteins product : echinoderm microtubule associated protein like 2, transcript variant 3 transcript_id : XM_895770.2

name	Eml2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379501 GeneID:72205 MGI:1919455
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 75 ESTs, 11 Proteins product : echinoderm microtubule associated protein like 2, transcript variant 4 transcript_id : XM_895785.2

name	Eml2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379502 GeneID:72205 MGI:1919455
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 76 ESTs, 4 Proteins product : echinoderm microtubule associated protein like 2, transcript variant 1 transcript_id : XM_133217.8

name	Eml2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256568 GeneID:72205 MGI:1919455
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 66 ESTs, 2 Proteins product : echinoderm microtubule associated protein like 2 transcript_id : XM_001480295.1

name	Gpr4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142358081 GeneID:319197 MGI:2441992
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 4 transcript_id : NM_175668.3

name	Opa3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801352 GeneID:403187 MGI:2686271
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : optic atrophy 3 (human) transcript_id : NM_207525.3

name	Vasp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33469092 GeneID:22323 MGI:109268
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vasodilator-stimulated phosphoprotein transcript_id : NM_009499.1

name	C79127 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142355065 GeneID:232941 MGI:2142330
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence C79127 transcript_id : NM_177691.3

name	Rtn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129806 GeneID:20167 MGI:107612
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : reticulon 2 (Z-band associated protein) transcript_id : NM_013648.5

name	Rtn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372064 GeneID:20167 MGI:107612
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : reticulon 2 (Z-band associated protein) transcript_id : NM_001025364.2

name	Fosb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110350004 GeneID:14282 MGI:95575
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FBJ osteosarcoma oncogene B transcript_id : NM_008036.2

name	D830036C21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379514 GeneID:330479 MGI:2685688
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : RIKEN cDNA D830036C21 gene transcript_id : XM_987344.1

name	Ercc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679678 GeneID:13870 MGI:95412
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : excision repair cross-complementing rodent repair deficiency, complementation group 1 transcript_id : NM_007948.1

name	Cd3eap (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22003859 GeneID:70333 MGI:1917583
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD3E antigen, epsilon polypeptide associated protein transcript_id : NM_145822.1

name	Ppp1r13l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142371718 GeneID:333654 MGI:3525053
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 1, regulatory (inhibitor) subunit 13 like transcript_id : NM_001010836.3

name	Ercc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142361454 GeneID:13871 MGI:95413
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : excision repair cross-complementing rodent repair deficiency, complementation group 2 transcript_id : NM_007949.3

name	Klc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142380743 GeneID:232943 MGI:1277971
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kinesin light chain 3 transcript_id : NM_146182.2

name	Ckm (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131179 GeneID:12715 MGI:88413
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : creatine kinase, muscle transcript_id : NM_007710.2

name	Mark4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:26986590 GeneID:232944 MGI:1920955
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MAP/microtubule affinity-regulating kinase 4 transcript_id : NM_172279.1

name	4933417E01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256079 GeneID:74463 MGI:1921713
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933417E01 gene transcript_id : XM_001471751.1

name	Bloc1s3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:55742806 GeneID:232946 MGI:2678952
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : biogenesis of lysosome-related organelles complex-1, subunit 3 transcript_id : NM_177692.3

name	Trappc6a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802534 GeneID:67091 MGI:1914341
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : trafficking protein particle complex 6A transcript_id : NM_025960.3

name	Nkpd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256329 GeneID:69547 MGI:1916797
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 1 EST, 2 Proteins product : NTPase, KAP family P-loop domain containing 1 transcript_id : XM_133219.7

name	BC024868 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350554 GeneID:232947 MGI:2687042
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC024868 transcript_id : NM_199149.2

name	Gemin7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801804 GeneID:69731 MGI:1916981
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gem (nuclear organelle) associated protein 7 transcript_id : NM_027189.2

name	Zfp296 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:11967932 GeneID:63872 MGI:1926956
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 296 transcript_id : NM_022409.1

name	Sfrs16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:109134356 GeneID:53609 MGI:1855695
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : splicing factor, arginine/serine-rich 16 (suppressor-of-white-apricot homolog, Drosophila) transcript_id : NM_016680.4

name	Relb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982052 GeneID:19698 MGI:103289
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : avian reticuloendotheliosis viral (v-rel) oncogene related B transcript_id : NM_009046.2

name	Clptm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:103472024 GeneID:56457 MGI:1927155
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cleft lip and palate associated transmembrane protein 1 transcript_id : NM_019649.2

name	Apoc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981900 GeneID:11813 MGI:88054
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : apolipoprotein C-II transcript_id : NM_009695.2

name	Apoc4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982517 GeneID:11425 MGI:87878
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : apolipoprotein C-IV transcript_id : NM_007385.2

name	Apoc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802164 GeneID:11812 MGI:88053
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : apolipoprotein C-I transcript_id : NM_007469.3

name	Apoe (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981894 GeneID:11816 MGI:88057
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : apolipoprotein E transcript_id : NM_009696.2

name	Tomm40 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:8394479 GeneID:53333 MGI:1858259
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : translocase of outer mitochondrial membrane 40 homolog (yeast) transcript_id : NM_016871.1

name	Pvrl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982076 GeneID:19294 MGI:97822
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : poliovirus receptor-related 2 transcript_id : NM_008990.2

name	Bcam (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119226187 GeneID:57278 MGI:1929940
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : basal cell adhesion molecule transcript_id : NM_020486.2

name	Cblc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802419 GeneID:80794 MGI:1931457
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Casitas B-lineage lymphoma c transcript_id : NM_023224.4

name	Bcl3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:15809013 GeneID:12051 MGI:88140
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : B-cell leukemia/lymphoma 3 transcript_id : NM_033601.1

name	Ceacam16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126432549 GeneID:330483 MGI:2685615
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CEA-related cell adhesion molecule 16 transcript_id : NM_001033419.2

name	Ceacam19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369101 GeneID:319930 MGI:2443001
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CEA-related cell adhesion molecule 19 transcript_id : NM_177036.3

name	Pvr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:28076964 GeneID:52118 MGI:107741
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : poliovirus receptor transcript_id : NM_027514.1

name	2210010C17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387586 GeneID:70080 MGI:1917330
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2210010C17 gene transcript_id : NM_027308.2

name	EG243872 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256570 GeneID:243872 MGI:3644288
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 476 ESTs, 12 Proteins product : predicted gene, EG243872 transcript_id : XM_620604.4

name	Ceacam20 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037244 GeneID:71601 MGI:1918851
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CEA-related cell adhesion molecule 20 transcript_id : NM_027839.1

name	Ceacam13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312412 GeneID:69785 MGI:1917035
definition	codon_start : 1 note : Ceacam13-C1; Ceacam13-C2 product : CEA-related cell adhesion molecule 13 protein_id : NP_081486.1

name	Ceacam13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312340 CCDS:CCDS20866.1 GeneID:69785 MGI:1917035
definition	codon_start : 1 note : Ceacam13-C1; Ceacam13-C2 product : CEA-related cell adhesion molecule 13 protein_id : NP_082447.1

name	Ceacam12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385588 CCDS:CCDS20867.1 GeneID:67315 MGI:1914565
definition	GO_process : GO:0007565 - pregnancy [Evidence IEA] codon_start : 1 exception : mismatches in translation note : Ceacam12-C1; Ceacam12-C3 product : CEA-related cell adhesion molecule 12 protein_id : NP_080363.1

name	Igfl3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50979276 GeneID:232925 MGI:2685426
definition	codon_start : 1 note : insulin growth factor-like product : gene model 580 protein_id : NP_001003393.1

name	Mill1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31559897 CCDS:CCDS20868.1 GeneID:266815 MGI:2179988
definition	GO_component : GO:0042612 - MHC class I protein complex [Evidence IEA] GO_process : GO:0019882 - antigen processing and presentation [Evidence IEA] codon_start : 1 exception : mismatches in translation note : MHC I-like leukocyte 1; MHC class I-like located near the LRC, 1 product : MHC I like leukocyte 1 protein_id : NP_715630.2

name	Psg18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755190 CCDS:CCDS20869.1 GeneID:26438 MGI:1347251
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_process : GO:0009691 - cytokinin biosynthesis [Evidence TAS]; GO:0007565 - pregnancy [Evidence IEA] codon_start : 1 exception : mismatches in translation note : carcinoembryonic antigen 3 product : pregnancy specific glycoprotein 18 protein_id : NP_036093.1

name	Psg28 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70778835 CCDS:CCDS20870.1 GeneID:114871 MGI:1891360
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_process : GO:0007565 - pregnancy [Evidence IEA] codon_start : 1 exception : mismatches in translation product : pregnancy-specific glycoprotein 28 protein_id : NP_473404.2

name	EG574429 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71274190 CCDS:CCDS20871.1 GeneID:574429 MGI:3643750
definition	codon_start : 1 product : hypothetical protein LOC574429 protein_id : NP_001025064.1

name	EG232930 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256318 GeneID:232930 MGI:3648786
definition	codon_start : 1 product : similar to myotubularin related protein 2 protein_id : XP_899502.3

name	Psg25 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75832037 CCDS:CCDS20872.1 GeneID:114868 MGI:1891357
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_process : GO:0007565 - pregnancy [Evidence IEA] codon_start : 1 product : pregnancy-specific glycoprotein 25 protein_id : NP_473401.1

name	EG545925 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:81230478 CCDS:CCDS20873.1 GeneID:545925 MGI:3649013
definition	codon_start : 1 product : hypothetical protein LOC545925 protein_id : NP_001032245.1

name	Psg23 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19549329 CCDS:CCDS20874.1 GeneID:56868 MGI:1891355
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_process : GO:0007565 - pregnancy [Evidence IEA] codon_start : 1 product : pregnancy-specific glycoprotein 23 protein_id : NP_064657.2

name	Psg21 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22758148 CCDS:CCDS20875.1 GeneID:72242 MGI:1891353
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_process : GO:0007565 - pregnancy [Evidence IEA] codon_start : 1 note : pregnancy-specific glrcoprotein 21 product : pregnancy-specific glycoprotein 21 protein_id : NP_081679.2

name	EG434540 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256555 GeneID:434540 MGI:3648784
definition	codon_start : 1 product : similar to pregnancy-specific glycoprotein 21 protein_id : XP_486384.3

name	BC050099 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:52138532 CCDS:CCDS20876.1 GeneID:243862 MGI:2681855
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] codon_start : 1 product : hypothetical protein LOC243862 protein_id : NP_001004152.1

name	Psg19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755192 CCDS:CCDS20877.1 GeneID:26439 MGI:1347252
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_process : GO:0007565 - pregnancy [Evidence IEA] codon_start : 1 exception : mismatches in translation note : carcinoembryonic antigen 4 product : pregnancy specific glycoprotein 19 protein_id : NP_036094.1

name	Psg17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679495 CCDS:CCDS20878.1 GeneID:26437 MGI:1347250
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006955 - immune response [Evidence IDA]; GO:0007565 - pregnancy [Evidence TAS] codon_start : 1 note : carcinoembryonic antigen 2 product : pregnancy specific glycoprotein 17 protein_id : NP_031703.1

name	Mill2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:52693919 CCDS:CCDS20880.1 GeneID:243864 MGI:2179989
definition	GO_component : GO:0042612 - MHC class I protein complex [Evidence IEA] GO_function : GO:0030106 - MHC class I receptor activity [Evidence IEA] GO_process : GO:0019882 - antigen processing and presentation [Evidence IEA] codon_start : 1 note : long form is encoded by transcript variant 1; MHC I-like leukocyte 2; MHC class I-like located near the LRC, 2 product : MHC I like leukocyte 2 long form protein_id : NP_715642.2

name	Mill2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24415386 CCDS:CCDS20879.1 GeneID:243864 MGI:2179989
definition	GO_component : GO:0042612 - MHC class I protein complex [Evidence IEA] GO_function : GO:0030106 - MHC class I receptor activity [Evidence IEA] GO_process : GO:0019882 - antigen processing and presentation [Evidence IEA] codon_start : 1 note : short form is encoded by transcript variant 2; MHC I-like leukocyte 2; MHC class I-like located near the LRC, 2 product : MHC I like leukocyte 2 short form protein_id : NP_715641.1

name	Pglyrp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679293 CCDS:CCDS20881.1 GeneID:21946 MGI:1345092
definition	GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0008745 - N-acetylmuramoyl-L-alanine amidase activity [Evidence IEA]; GO:0016019 - peptidoglycan receptor activity [Evidence ISS]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0042742 - defense response to bacterium [Evidence IEA]; GO:0006955 - immune response [Evidence IEA]; GO:0009253 - peptidoglycan catabolism [Evidence IEA]; GO:0051707 - response to other organism [Evidence IEA] codon_start : 1 note : tumor necrosis factor super family 3-like product : peptidoglycan recognition protein 1 protein_id : NP_033428.1

name	C530028I08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75677484 GeneID:232933 MGI:2685005
definition	codon_start : 1 product : hypothetical protein LOC232933 protein_id : NP_001028486.1

name	Nova2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71274146 CCDS:CCDS20882.1 GeneID:384569 MGI:104296
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003723 - RNA binding [Evidence IDA] codon_start : 1 product : neuro-oncological ventral antigen 2 protein_id : NP_001025048.1

name	Nanos2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34610231 CCDS:CCDS20883.1 GeneID:378430 MGI:2676627
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0003723 - RNA binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0006417 - regulation of protein biosynthesis [Evidence IEA]; GO:0006445 - regulation of translation [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IMP] codon_start : 1 exception : mismatches in translation product : nanos homolog 2 protein_id : NP_918953.1

name	P42pop (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704164 GeneID:232934 MGI:2446472
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0042803 - protein homodimerization activity [Evidence IPI]; GO:0003700 - transcription factor activity [Evidence IDA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0007076 - mitotic chromosome condensation [Evidence IEA]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence IGI]; GO:0007283 - spermatogenesis [Evidence IEA] codon_start : 1 note : partner of profilin product : Myb protein P42POP protein_id : NP_663554.1

name	Irf2bp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982348 CCDS:CCDS20885.1 GeneID:272359 MGI:2442159
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0003714 - transcription corepressor activity [Evidence ISS]; GO:0008134 - transcription factor binding [Evidence ISS] GO_process : GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence ISS] codon_start : 1 product : interferon regulatory factor 2 binding protein 1 protein_id : NP_848872.2

name	Foxa3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679831 CCDS:CCDS20886.1 GeneID:15377 MGI:1347477
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IMP] GO_process : GO:0001678 - cell glucose homeostasis [Evidence IMP]; GO:0009267 - cellular response to starvation [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IMP]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : hepatocyte nuclear factor 3 gamma (winged helix transcription factor) product : forkhead box A3 protein_id : NP_032286.1

name	Sympk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256563 GeneID:68188 MGI:1915438
definition	codon_start : 1 product : symplekin protein_id : XP_485873.2

name	Rshl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13752583 CCDS:CCDS20887.1 GeneID:83434 MGI:1927643
definition	GO_component : GO:0005929 - cilium [Evidence ISS] codon_start : 1 exception : mismatches in translation product : radial spokehead-like 1 protein_id : NP_112545.1

name	Dmwd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31044425 CCDS:CCDS20888.1 GeneID:13401 MGI:94907
definition	codon_start : 1 exception : mismatches in translation note : dystrophia myotonica linked gene, N9 product : dystrophia myotonica-containing WD repeat motif protein_id : NP_034188.1

name	Dmpk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:14192945 GeneID:13400 MGI:94906
definition	GO_function : GO:0005524 - ATP binding [Evidence ISS] [Evidence IEA]; GO:0042802 - identical protein binding [Evidence ISS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence ISS] [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] [Evidence ISS]; GO:0008016 - regulation of heart contraction [Evidence IDA]; GO:0051056 - regulation of small GTPase mediated signal transduction [Evidence ISS] citation : [PUBMED 1302022] citation : [PUBMED 8499920] codon_start : 1 note : dystrophia myotonica kinase, B15 product : dystrophia myotonica-protein kinase protein_id : NP_115794.1

name	Six5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:73532776 CCDS:CCDS20889.1 GeneID:20475 MGI:106220
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : sine oculis-related homeobox 5 homolog protein_id : NP_035513.1

name	EG243866 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94379513 GeneID:243866 MGI:3647482
definition	codon_start : 1 product : similar to hCG1645909 protein_id : XP_485874.4

name	Fbxo46 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425304 CCDS:CCDS20890.1 GeneID:243867 MGI:2444918
definition	GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : F-box only protein 34-like product : F-box protein 46 protein_id : NP_780739.1

name	Qpctl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560195 CCDS:CCDS20891.1 GeneID:67369 MGI:1914619
definition	GO_function : GO:0008233 - peptidase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : glutaminyl-peptide cyclotransferase-like protein_id : NP_080387.2

name	Snrpd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037145 CCDS:CCDS20892.1 GeneID:107686 MGI:98345
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005681 - spliceosome complex [Evidence IEA] GO_process : GO:0016071 - mRNA metabolism [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 product : small nuclear ribonucleoprotein D2 protein_id : NP_081219.1

name	Gipr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124249103 GeneID:381853 MGI:1352753
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0016519 - gastric inhibitory peptide receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence TAS] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007218 - neuropeptide signaling pathway [Evidence TAS] codon_start : 1 note : glucose-dependent insulinotropic polypeptide receptor product : gastric inhibitory polypeptide receptor protein_id : NP_001074284.1

name	Eml2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82904015 GeneID:72205 MGI:1919455
definition	codon_start : 1 product : echinoderm microtubule associated protein like 2 isoform 3 protein_id : XP_900863.1

name	Eml2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82904019 GeneID:72205 MGI:1919455
definition	codon_start : 1 product : echinoderm microtubule associated protein like 2 isoform 4 protein_id : XP_900878.1

name	Eml2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256569 GeneID:72205 MGI:1919455
definition	codon_start : 1 product : echinoderm microtubule associated protein like 2 protein_id : XP_001480345.1

name	Eml2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82904017 GeneID:72205 MGI:1919455
definition	codon_start : 1 product : echinoderm microtubule associated protein like 2 isoform 1 protein_id : XP_133217.5

name	Gpr4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28316758 CCDS:CCDS20893.1 GeneID:319197 MGI:2441992
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : G protein-coupled receptor GPR4 product : G protein-coupled receptor 4 protein_id : NP_783599.1

name	Opa3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625722 CCDS:CCDS20894.1 GeneID:403187 MGI:2686271
definition	codon_start : 1 product : OPA3 protein protein_id : NP_997408.2

name	Vasp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33469093 GeneID:22323 MGI:109268
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0030175 - filopodium [Evidence IDA]; GO:0005925 - focal adhesion [Evidence IDA]; GO:0030027 - lamellipodium [Evidence IDA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence IGI]; GO:0007411 - axon guidance [Evidence IGI]; GO:0001843 - neural tube closure [Evidence IGI] codon_start : 1 exception : mismatches in translation product : vasodilator-stimulated phosphoprotein protein_id : NP_033525.1

name	C79127 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244132 CCDS:CCDS20895.1 GeneID:232941 MGI:2142330
definition	GO_function : GO:0003824 - catalytic activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC232941 protein_id : NP_808359.1

name	Rtn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305449 CCDS:CCDS20896.1 GeneID:20167 MGI:107612
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence IEA] [Evidence ND] codon_start : 1 note : isoform B is encoded by transcript variant B; NSP-like 1 product : reticulon 2 isoform B protein_id : NP_038676.1

name	Rtn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70778920 GeneID:20167 MGI:107612
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence IEA] [Evidence ND] codon_start : 1 note : isoform C is encoded by transcript variant C; NSP-like 1 product : reticulon 2 isoform C protein_id : NP_001020535.1

name	Fosb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679827 CCDS:CCDS20897.1 GeneID:14282 MGI:95575
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA] GO_process : GO:0050875 - cellular physiological process [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA] codon_start : 1 product : FBJ osteosarcoma oncogene B protein_id : NP_032062.1

name	D830036C21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94379515 GeneID:330479 MGI:2685688
definition	codon_start : 1 product : hypothetical protein protein_id : XP_992438.1

name	Ercc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679679 CCDS:CCDS20898.1 GeneID:13870 MGI:95412
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0000109 - nucleotide-excision repair complex [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003684 - damaged DNA binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0004519 - endonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA] GO_process : GO:0006281 - DNA repair [Evidence IEA]; GO:0006289 - nucleotide-excision repair [Evidence ISS]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 exception : mismatches in translation note : excision repair 1 product : excision repair cross-complementing rodent repair deficiency, complementation group 1 protein_id : NP_031974.1

name	Cd3eap (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22003860 GeneID:70333 MGI:1917583
definition	GO_component : GO:0005736 - DNA-directed RNA polymerase I complex [Evidence IDA]; GO:0005730 - nucleolus [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0009303 - rRNA transcription [Evidence IDA] codon_start : 1 note : CD3 epsilon associated protein; antisense to Ercc1 product : RNA polymerase I-associated factor PAF49 protein_id : NP_665821.1

name	Ppp1r13l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58082069 CCDS:CCDS20899.1 GeneID:333654 MGI:3525053
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : NFkB interacting protein 1 protein_id : NP_001010836.1

name	Ercc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542614 CCDS:CCDS20900.1 GeneID:13871 MGI:95413
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IEA]; GO:0005675 - transcription factor TFIIH complex [Evidence ISS] GO_function : GO:0043139 - 5' to 3' DNA helicase activity [Evidence ISS]; GO:0005524 - ATP binding [Evidence IEA]; GO:0004003 - ATP-dependent DNA helicase activity [Evidence IEA]; GO:0008026 - ATP-dependent helicase activity [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016818 - hydrolase activity, acting on acid anhydrides, in phosphorus-containing anhydrides [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0007568 - aging [Evidence IMP]; GO:0006281 - DNA repair [Evidence IMP]; GO:0006917 - induction of apoptosis [Evidence ISS]; GO:0006139 - nucleobase, nucleoside, nucleotide and nucleic acid metabolism [Evidence IEA]; GO:0006289 - nucleotide-excision repair [Evidence IMP]; GO:0009791 - post-embryonic development [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA]; GO:0006979 - response to oxidative stress [Evidence IMP]; GO:0006350 - transcription [Evidence IEA]; GO:0006366 - transcription from RNA polymerase II promoter [Evidence ISS]; GO:0006283 - transcription-coupled nucleotide-excision repair [Evidence ISS] codon_start : 1 note : excision repair 2 product : excision repair cross-complementing rodent repair deficiency, complementation group 2 protein_id : NP_031975.2

name	Klc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122725 CCDS:CCDS20901.1 GeneID:232943 MGI:1277971
definition	GO_component : GO:0035253 - ciliary rootlet [Evidence IPI] [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0009434 - flagellum (sensu Eukaryota) [Evidence IDA]; GO:0005871 - kinesin complex [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA]; GO:0043005 - neuron projection [Evidence IDA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0008808 - cardiolipin synthase activity [Evidence IMP]; GO:0019894 - kinesin binding [Evidence IDA]; GO:0008017 - microtubule binding [Evidence IDA]; GO:0003777 - microtubule motor activity [Evidence IEA]; GO:0003774 - motor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0042073 - intraflagellar transport [Evidence TAS] codon_start : 1 product : kinesin light chain 3 protein_id : NP_666294.1

name	Ckm (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671762 CCDS:CCDS20902.1 GeneID:12715 MGI:88413
definition	GO_function : GO:0004111 - creatine kinase activity [Evidence TAS] [Evidence IDA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016772 - transferase activity, transferring phosphorus-containing groups [Evidence IEA] GO_process : GO:0046314 - phosphocreatine biosynthesis [Evidence IDA]; GO:0006603 - phosphocreatine metabolism [Evidence TAS] codon_start : 1 product : creatine kinase, muscle protein_id : NP_031736.1

name	Mark4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26986591 CCDS:CCDS20903.1 GeneID:232944 MGI:1920955
definition	GO_component : GO:0005813 - centrosome [Evidence ISS]; GO:0043005 - neuron projection [Evidence ISS] GO_function : GO:0005524 - ATP binding [Evidence IEA] [Evidence ISS]; GO:0043015 - gamma-tubulin binding [Evidence ISS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0008017 - microtubule binding [Evidence ISS]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence ISS] [Evidence IEA]; GO:0050321 - tau-protein kinase activity [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA]; GO:0043130 - ubiquitin binding [Evidence ISS] GO_process : GO:0001578 - microtubule bundle formation [Evidence ISS]; GO:0007399 - nervous system development [Evidence ISS]; GO:0043068 - positive regulation of programmed cell death [Evidence ISS]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] [Evidence ISS] codon_start : 1 note : MAP/microtubule affinity-regulating kinase 4L; MARK4 serine/threonine protein kinase product : MAP/microtubule affinity-regulating kinase 4 protein_id : NP_758483.1

name	4933417E01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256080 GeneID:74463 MGI:1921713
definition	codon_start : 1 product : hypothetical protein LOC74463 protein_id : XP_001471801.1

name	Bloc1s3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:55742807 CCDS:CCDS20904.1 GeneID:232946 MGI:2678952
definition	GO_component : GO:0005829 - cytosol [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0048066 - pigmentation during development [Evidence IMP] codon_start : 1 note : Bloc1 subunit 3; Bloc-1 complex component product : reduced pigmentation protein protein_id : NP_808360.2

name	Trappc6a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981104 CCDS:CCDS20905.1 GeneID:67091 MGI:1914341
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] GO_process : GO:0006888 - ER to Golgi vesicle-mediated transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : trafficking protein particle complex 6A protein_id : NP_080236.2

name	Nkpd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256330 GeneID:69547 MGI:1916797
definition	codon_start : 1 product : NTPase, KAP family P-loop domain containing 1 protein_id : XP_133219.7

name	BC024868 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40255285 CCDS:CCDS20906.1 GeneID:232947 MGI:2687042
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC232947 protein_id : NP_954600.1

name	Gemin7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312380 CCDS:CCDS20907.1 GeneID:69731 MGI:1916981
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0016604 - nuclear body [Evidence ISS]; GO:0005654 - nucleoplasm [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA]; GO:0005681 - spliceosome complex [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence ISS] [Evidence IPI] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA]; GO:0000387 - spliceosomal snRNP biogenesis [Evidence ISS] codon_start : 1 product : gem (nuclear organelle) associated protein 7 protein_id : NP_081465.1

name	Zfp296 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11967933 GeneID:63872 MGI:1926956
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 function : unknown product : zinc finger protein 296 protein_id : NP_071854.1

name	Sfrs16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:109134357 GeneID:53609 MGI:1855695
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 note : isoform L is encoded by transcript variant L; Clk4 associating SR-related protein; suppressor of white apricot homolog 2 product : splicing factor, arginine/serine-rich 16 isoform L protein_id : NP_057889.3

name	Relb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982053 GeneID:19698 MGI:103289
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0019882 - antigen processing and presentation [Evidence IMP]; GO:0050875 - cellular physiological process [Evidence IEA]; GO:0043011 - myeloid dendritic cell differentiation [Evidence IMP]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0042088 - T-helper 1 type immune response [Evidence IMP]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : transcription factor relB product : avian reticuloendotheliosis viral (v-rel) oncogene related B protein_id : NP_033072.2

name	Clptm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:103472025 GeneID:56457 MGI:1927155
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA] codon_start : 1 note : thymic epithelial cell surface antigen product : cleft lip and palate associated transmembrane protein 1 protein_id : NP_062623.2

name	Apoc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753100 GeneID:11813 MGI:88054
definition	GO_component : GO:0042627 - chylomicron [Evidence IEA] GO_function : GO:0008047 - enzyme activator activity [Evidence IEA]; GO:0005319 - lipid transporter activity [Evidence IEA] GO_process : GO:0016042 - lipid catabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0006869 - lipid transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : apolipoprotein C-II protein_id : NP_033825.1

name	Apoc4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671501 CCDS:CCDS20910.1 GeneID:11425 MGI:87878
definition	GO_process : GO:0006869 - lipid transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : apolipoprotein C2 linked product : apolipoprotein C-IV protein_id : NP_031411.1

name	Apoc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680704 GeneID:11812 MGI:88053
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005319 - lipid transporter activity [Evidence IEA] GO_process : GO:0006869 - lipid transport [Evidence IEA]; GO:0042157 - lipoprotein metabolism [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : apolipoprotein C1 product : apolipoprotein C-I protein_id : NP_031495.1

name	Apoe (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753102 CCDS:CCDS20912.1 GeneID:11816 MGI:88057
definition	GO_component : GO:0042627 - chylomicron [Evidence IEA]; GO:0005737 - cytoplasm [Evidence ISS]; GO:0005576 - extracellular region [Evidence IEA] [Evidence ISS] GO_function : GO:0016209 - antioxidant activity [Evidence ISS]; GO:0001540 - beta-amyloid binding [Evidence ISS]; GO:0008201 - heparin binding [Evidence ISS] [Evidence IEA]; GO:0008289 - lipid binding [Evidence IEA]; GO:0005319 - lipid transporter activity [Evidence IEA]; GO:0008034 - lipoprotein binding [Evidence IDA]; GO:0050750 - low-density lipoprotein receptor binding [Evidence ISS]; GO:0048156 - tau protein binding [Evidence ISS] GO_process : GO:0006874 - calcium ion homeostasis [Evidence IDA]; GO:0006707 - cholesterol catabolism [Evidence IMP]; GO:0042632 - cholesterol homeostasis [Evidence IMP] [Evidence ISS]; GO:0008203 - cholesterol metabolism [Evidence IMP]; GO:0008015 - circulation [Evidence ISS]; GO:0007010 - cytoskeleton organization and biogenesis [Evidence ISS]; GO:0006917 - induction of apoptosis [Evidence ISS]; GO:0046907 - intracellular transport [Evidence ISS]; GO:0007611 - learning and/or memory [Evidence ISS]; GO:0006869 - lipid transport [Evidence ISS] [Evidence IEA]; GO:0042157 - lipoprotein metabolism [Evidence ISS] [Evidence IEA]; GO:0030516 - regulation of axon extension [Evidence ISS]; GO:0048168 - regulation of neuronal synaptic plasticity [Evidence ISS]; GO:0006979 - response to oxidative stress [Evidence IMP]; GO:0000302 - response to reactive oxygen species [Evidence ISS]; GO:0007271 - synaptic transmission, cholinergic [Evidence ISS]; GO:0006810 - transport [Evidence IEA]; GO:0042311 - vasodilation [Evidence IMP] codon_start : 1 exception : mismatches in translation product : apolipoprotein E protein_id : NP_033826.1

name	Tomm40 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8394480 GeneID:53333 MGI:1858259
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005741 - mitochondrial outer membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0019867 - outer membrane [Evidence IEA] GO_function : GO:0008308 - voltage-gated ion-selective channel activity [Evidence IEA] GO_process : GO:0006820 - anion transport [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : mitochondrial outer membrane protein; mitochondrial outer membrane protein 35; haymaker protein product : translocase of outer mitochondrial membrane 40 homolog protein_id : NP_058567.1

name	Pvrl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982077 CCDS:CCDS20913.1 GeneID:19294 MGI:97822
definition	GO_component : GO:0005911 - intercellular junction [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0042803 - protein homodimerization activity [Evidence IDA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0007156 - homophilic cell adhesion [Evidence IDA] codon_start : 1 exception : mismatches in translation note : poliovirus sensitivity product : poliovirus receptor-related 2 protein_id : NP_033016.2

name	Bcam (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10048460 GeneID:57278 MGI:1929940
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005055 - laminin receptor activity [Evidence IDA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IDA] codon_start : 1 note : lutheran glycoprotein; Lutheran blood group; Auberger b antigen product : basal cell adhesion molecule protein_id : NP_065232.1

name	Cblc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981243 GeneID:80794 MGI:1931457
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0000151 - ubiquitin ligase complex [Evidence ISS] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] [Evidence ISS]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0004842 - ubiquitin-protein ligase activity [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007166 - cell surface receptor linked signal transduction [Evidence IEA]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence ISS] codon_start : 1 exception : mismatches in translation product : Casitas B-lineage lymphoma c protein_id : NP_075713.2

name	Bcl3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15809014 CCDS:CCDS20914.1 GeneID:12051 MGI:88140
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : B-cell leukemia/lymphoma 3 protein_id : NP_291079.1

name	Ceacam16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126432550 GeneID:330483 MGI:2685615
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : CEA-related cell adhesion molecule 16 protein_id : NP_001028591.2

name	Ceacam19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28892919 CCDS:CCDS20915.1 GeneID:319930 MGI:2443001
definition	codon_start : 1 product : carcinoembryonic antigen-like 1 protein_id : NP_796010.1

name	Pvr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28076965 CCDS:CCDS20916.1 GeneID:52118 MGI:107741
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0016477 - cell migration [Evidence IDA]; GO:0016337 - cell-cell adhesion [Evidence IDA] codon_start : 1 note : tumor-associated antigen 1 product : poliovirus receptor protein_id : NP_081790.1

name	2210010C17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625759 GeneID:70080 MGI:1917330
definition	codon_start : 1 product : hypothetical protein LOC70080 protein_id : NP_081584.1

name	EG243872 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82904025 GeneID:243872 MGI:3644288
definition	codon_start : 1 product : hypothetical protein protein_id : XP_620604.2

name	Ceacam20 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037245 CCDS:CCDS20919.1 GeneID:71601 MGI:1918851
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 exception : mismatches in translation product : CEA-related cell adhesion molecule 20 protein_id : NP_082115.1

name	LOC384560 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:384560
definition	number : 1 pseudo : _no_value

name	LOC384560 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:384560
definition	number : 2 pseudo : _no_value

name	LOC666831 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666831
definition	number : 4 pseudo : _no_value

name	LOC666831 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666831
definition	number : 3 pseudo : _no_value

name	LOC666831 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666831
definition	number : 2 pseudo : _no_value

name	LOC666831 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666831
definition	number : 1 pseudo : _no_value

name	LOC666863 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666863
definition	number : 1 pseudo : _no_value

name	LOC666863 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666863
definition	number : 2 pseudo : _no_value

name	LOC666863 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666863
definition	number : 3 pseudo : _no_value

name	LOC666863 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666863
definition	number : 4 pseudo : _no_value

name	LOC666863 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666863
definition	number : 5 pseudo : _no_value

name	LOC671190 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256303 GeneID:671190
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 15 Proteins product : similar to eukaryotic translation elongation factor 1 alpha 1 pseudo : _no_value transcript_id : XR_034015.1

name	LOC546936 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256304 GeneID:546936
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 21 Proteins product : similar to myotubularin related protein 2 pseudo : _no_value transcript_id : XR_034021.1

clone name	MSMg01-277F15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-345I19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-510L11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-505H03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-346L06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-065K10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-086P04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-177O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-312A11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-415J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-144I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-480N20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-149J24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-155K16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-291B02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-531K21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-433E07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-144J18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-173G06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-090M03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-458E06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-479B22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-150B16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-499P02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-472C18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-397J07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-370M08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-087E24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-492B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-087G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-451I07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-408J15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-476M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-133K09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-525F12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-364A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-063L03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-460N14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416M13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-204F19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-521N09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-416P23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-447J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-303L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-483D14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-537P03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-445J13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-398D24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-299L23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-536E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-381I09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-094M05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-078P16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-109K20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-455I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-149L22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-177H16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416I20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-076L20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-294N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-153M01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-344C14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-096P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-164P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381B04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-459J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-413D13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-293N21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-525J08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-330P13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-146E23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-066P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-494O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-318L21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-293A11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-385H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-225I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216I16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340E21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-173M04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-063G03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054N08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-038H10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116G17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058B10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-029N17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-011I04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093J12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-198H24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-270A14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232E13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-192C24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093O07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-044H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-057P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202H02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-061K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-076O03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-141D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-055M15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095H13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089G02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-286N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-270B13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072F02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-312N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025C07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117D09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-312D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213F12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-098D20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-190H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079M23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-041C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193J18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-118M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261C24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235O09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-039L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100O22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-288H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059K17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-041M01
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-270B13.b	B6Ng01-270B13.g
ACC	GA072527	GA072528
length	1,213	462
definition	B6Ng01-270B13.b	B6Ng01-270B13.g
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattcaagtgtctctgcccactgccctctaggttctggttccaggcgca cagccctgcctggcttctgaggtgggcgctggggatctgagctcaggtcg gcatgtttgcagagcaggcattttgccaactaaaccagcagttcccaacc tgcgggtcacagccccttggggtcttataacagatatcctgcttatcaga tatttacattatgattcataacagtaacaaaattagagttatgaagtagc aaggaaatcatttcatggttgggggtcaccacaacatgacgaactgtatt aaagggtctcagcattaggaaccactggactaagccatcttcctatagtg ttcttgttattattattattttttaaattttaaagtctgtgtgtctatgt gtatgtgcagagctaaaggagttggaggctaggaaagggtgttggaggcc aggaaagggtgtcagattccctggagctacagtcacagatggttgtgagt cacttgacatgggagatgggaaccaaagtcaggccctttgcaagagcagc aagcgctcttaatgtttgagccatccctccagccggtccgagtcatgtca aagactaggaaggaagctcaggcagggacgggctaggcagggctaggcag cagcctttgctcacactgaactgaggcaattctgtccagattacccatgc ttgctgggcatggattacaccactcagttgtccgagccatcacagtcact gctggctgcctaaactactgtcccccacctacctccaggactcacccttt atctccttcaggtttggctcagaaattgcctctaggaagcctttgatcca agcccatagcttctacccaacagaacacaaactctcaaccctcattagtt tttctccttagcatgtatcgcactgcccactgtactaaccattttgctta ttaagtgtgccgtctgcctctccttattgacgtgaaagcttgaaggcaga catttccctgtgtctcactgtgtagtacagcttgctcaaactggggaacc tcctgctcagtctctcaggacggcaaatgacagatgtgcactacatggct agcttggctgggcatgccatgtcggttcatgtctggagtttggctctgag accgttaccacgccatcagcccttgggggaccaaggcccacacagggttt ctcatgagggttc	ctatctctgccagatgtcccgcctcttctcccctcctttgctgtaagccc ttagtttttttcttaaaccaataggaaggtgagagagggagagcttacaa aataggatgcaggtgatgagcaattagacaggatgtcgggcctgtaaatc agatgcccgcctggtacagatatcagcagatgaatagtacaccaccagtc tttacacagtgcataaaaggatcacccccaacacagtttaatgcatccgc tcctcggcattcaaagactgacttcatgagcgttccctggcatgttctat ctaggtggtattactagtgtgttcctttttgagatatggtcttgctttat agcctaggttcgcctgcagctccagaatacaagtatttcaaacaaatgcc tcgatagtggcctagcgtgtgtgtctgtgtgtgtgtgtgtgtgtgtgtgt gtgtgtgtgtgt
quality values	Open. Hide. 62 41 27 31 62 37 33 47 62 62 62 62 62 62 62 62 62 62 62 44 43 59 62 62 62 62 62 62 62 59 62 49 59 46 32 48 46 43 42 34 38 49 54 38 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 62 59 59 62 62 54 54 54 62 62 62 59 59 62 62 54 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 59 62 62 62 59 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 42 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 54 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 49 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 49 62 62 62 62 62 58 54 46 38 38 58 58 58 58 58 54 58 51 58 58 58 58 58 58 58 58 52 46 46 54 54 58 58 58 54 58 54 58 54 58 58 54 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 48 58 54 58 41 58 52 58 53 58 58 43 48 58 51 58 58 58 58 38 58 58 51 58 58 58 54 58 58 58 50 58 42 58 58 47 58 58 49 41 58 58 54 50 58 58 53 58 33 58 51 53 47 58 58 39 48 41 58 58 58 58 53 35 58 54 43 37 58 58 49 58 48 41 58 52 58 51 58 53 53 58 58 51 58 51 51 52 58 53 50 51 50 38 41 58 58 51 41 51 58 44 18 51 37 54 39 41 58 53 53 58 50 50 39 32 50 46 31 42 42 44 39 39 40 53 54 54 54 40 51 38 45 53 54 54 41 45 45 49 54 35 41 39 38 50 39 41 49 49 50 53 42 32 45 54 53 53 34 37 54 37 54 26 54 51 31 40 43 38 47 53 53 52 45 42 42 37 41 37 37 47 44 40 42 52 33 32 37 39 54 40 47 33 31 52 34 47 31 30 40 40 40 29 30 33 32 42 39 29 32 36 34 42 31 32 40 40 28 53 36 40 32 40 52 40 53 52 32 34 31 35 25 31 41 45 30 26 11 31 25 51 45 32 45 33 29 31 30 10 46 46 27 31 46 31 27 31 30 36 39 30 18 26 31 42 32 31 28 32 46 31 30 33 42 23 30 30 30 34 31 46 22 24 30 31 32 43 33 30 31 32 38 25 37 40 23 41 30 31 18 33 32 22 27 31 29 48 37 26 31 29 31 31 31 27 32 33 31 34 31 30 26 25 30 33 43 48 46 46 30 31 28 31 31 21 31 31 30 31 26 25 35 31 32 32 31 31 31 29 22 30 31 26 47 31 29 29 26 34 21 31 31 33 13 18 31 30 32 37 44 43 17 25 19 19 13 29 17 23 21 30 31 21 21 12 25 33 31 24 27 34 32 32 20 15 14 11 13 18 25 12 12 14 12 17 28 21 32 9 21 23 29 48 33 17 29 17 18 30 20 25 17 15 17 31 22 20 8 20 34 48 33 21 40 22 17 11 8 11 22 22 11 13 26 22 14 11 12 23 14 25 20 18 27 10 20 12 23 14 12 11 11 3 10 24 40 25 26 18 18 40 40 17 12 9 11 9 13 9 17 6 4 6 3 8 24 20 19 9 24 7 11 24 8 21 10 23 20 11 14 15 16 27 14 13 16 16 16 9 7 18 9 20 16 10 16 9 15 6 7 21 7 7 15 17 4 4 14 11 21 9 8 7 15 11 6 7 22 8 11 15 13 15 5 6 22 5 4 1 2 5 16 7 6 3 1 3 5 5 17 7 9 9 16 6 14 30 16 5 6 3 2 3 5 7 14 4 7 6 5 3 1 4 11 17 6 4 4 5 8 15 9 16 8 21 5 3 6 20 4 6 8 17 26 23 4 16 7 7 6 6 3 3 4 14 7 5 5 5 5 5 24 28 9 10 12 9 11 11 6 6 4 8 8 9 8 11 3 1 2	Open. Hide. 62 62 62 62 62 41 40 28 28 28 23 23 30 33 31 43 43 34 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 54 32 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 54 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 54 54 62 62 62 59 62 62 62 62 59 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 62 62 62 62 62 46 62 62 58 58 49 49 58 58 58 58 58 58 58 58 49 49 58 58 58 58 58 54 58 58 58 58 29 12

Alignment Information

BAC End 1

BAC End 2

seq1: chr7_19584970_19585437
seq2: B6Ng01-270B13.g_68_535

seq1  GAATTCCTATCTCTGCCAGATGTCCCGCCTCTTCTCCCCTCCTTTGCTGT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCTATCTCTGCCAGATGTCCCGCCTCTTCTCCCCTCCTTTGCTGT  50

seq1  AAGCCCTTAGTTTTTTTCTTAAACCAATAGGAAGGTGAGAGAGGGAGAGC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGCCCTTAGTTTTTTTCTTAAACCAATAGGAAGGTGAGAGAGGGAGAGC  100

seq1  TTACAAAATAGGATGCAGGTGATGAGCAATTAGACAGGATGTCGGGCCTG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTACAAAATAGGATGCAGGTGATGAGCAATTAGACAGGATGTCGGGCCTG  150

seq1  TAAATCAGATGCCCGCCTGGTACAGATATCAGCAGATGAATAGTACACCA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAATCAGATGCCCGCCTGGTACAGATATCAGCAGATGAATAGTACACCA  200

seq1  CCAGTCTTTACACAGTGCATAAAAGGATCACCCCCAACACAGTTTAATGC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGTCTTTACACAGTGCATAAAAGGATCACCCCCAACACAGTTTAATGC  250

seq1  ATCCGCTCCTCGGCATTCAAAGACTGACTTCATGAGCGTTCCCTGGCATG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCCGCTCCTCGGCATTCAAAGACTGACTTCATGAGCGTTCCCTGGCATG  300

seq1  TTCTATCTAGGTGGTATTACTAGTGTGTTCCTTTTTGAGATATGGTCTTG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTATCTAGGTGGTATTACTAGTGTGTTCCTTTTTGAGATATGGTCTTG  350

seq1  CTTTATAGCCTAGGTTCGCCTGCAGCTCCAGAATACAAGTATTTCAAACA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTATAGCCTAGGTTCGCCTGCAGCTCCAGAATACAAGTATTTCAAACA  400

seq1  AATGCCTCGATAGTGGCCTAGCGTGTGTGTCTGTGTGTGTGTGTGTGTGT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATGCCTCGATAGTGGCCTAGCGTGTGTGTCTGTGTGTGTGTGTGTGTGT  450

seq1  GTGTGTGTGTGTGTGTGT  468
      ||||||||||||||||||
seq2  GTGTGTGTGTGTGTGTGT  468

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information