MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-274A06
Chromosome	7 (Build37)
Map Location	27,879,026 - 28,004,369
singlet/doublet	doublet
Overlap gene	Cyp2f2, Gm1450, Egln2, Rab4b, Mia1, Snrpa, Itpkc
Upstream gene	Cyp2b13, LOC623532, Cyp2b9, LOC667968, Cyp2a4, Nlrp9c, LOC100043195, Nlrp4a, Nlrp9a, V1re12, EG243881, LOC623830, Cyp2b19, Cyp2g1, LOC100043745, Cyp2a5, EG233005, EG330491, Cyp2a12, LOC100043199
Downstream gene	Adck4, Numbl, Ltbp4, Shkbp1, Spnb4, Blvrb, EG668045, Sertad3, Sertad1, Prx, Hipk4, Pld3, 2310022A10Rik, Akt2, Ttc9b, Map3k10, C030039L03Rik, Zfp60, LOC100043229, LOC100043233, 4933426I21Rik, Zfp59, 4732475C15Rik, Prkcz2, 1700049G17Rik, EG668175, LOC100043771, Zfp780b, C130069I09Rik, LOC100043772, Psmc4, LOC100043774, 9530053A07Rik, Fbl, Dyrk1b
Link	Open Mouse BAC browser

Click to get alignment info.

name	Cyp2b13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13089 MGI:88599
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC623532 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:623532
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	Cyp2b9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13094 MGI:88600
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667968 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667968
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 8 Proteins pseudo : _no_value

name	Cyp2a4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13086 MGI:88596
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nlrp9c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330490 MGI:3028627
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043195 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043195
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Nlrp4a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243880 MGI:2443697
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nlrp9a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233001 MGI:2675292
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	V1re12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171265 MGI:2159634
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG243881 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243881 MGI:3646735
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC623830 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:623830
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Cyp2b19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13090 MGI:107303
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyp2g1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13108 MGI:109612
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043745 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043745
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Cyp2a5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13087 MGI:88597
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG233005 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233005 MGI:3648316
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 34 ESTs, 53 Proteins

name	EG330491 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330491 MGI:3647278
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 66 ESTs, 4 Proteins

name	Cyp2a12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13085 MGI:105055
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043199 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043199
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Cyp2f2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13107 MGI:88608
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm1450 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384724 MGI:2686296
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 82 Proteins

name	Egln2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:112406 MGI:1932287
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rab4b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19342 MGI:105071
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mia1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12587 MGI:109615
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snrpa (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53607 MGI:1855690
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Itpkc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233011 MGI:2442554
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Adck4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76889 MGI:1924139
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Numbl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18223 MGI:894702
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ltbp4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108075 MGI:1321395
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Shkbp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192192 MGI:2385803
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Spnb4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80297 MGI:1890574
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Blvrb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233016 MGI:2385271
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG668045 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668045 MGI:3645709
definition	note : predicted gene, EG668045 pseudo : _no_value

name	Sertad3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170742 MGI:2180697
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sertad1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:55942 MGI:1913438
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prx (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19153 MGI:108176
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Hipk4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233020 MGI:2685008
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pld3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18807 MGI:1333782
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310022A10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66367 MGI:1913617
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Akt2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11652 MGI:104874
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ttc9b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73032 MGI:1920282
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Map3k10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269881 MGI:1346879
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C030039L03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:112415 MGI:2148237
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp60 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22718 MGI:99207
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100043229 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043229
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	LOC100043233 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043233
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	4933426I21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71163 MGI:1918413
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Zfp59 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22717 MGI:99206
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4732475C15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545938 MGI:3584526
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prkcz2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404705 MGI:3029152
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 31 ESTs, 24 Proteins

name	1700049G17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73430 MGI:1920680
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG668175 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668175 MGI:3643781
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 65 ESTs, 1 Protein

name	LOC100043771 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043771
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 16 ESTs, 8 Proteins

name	Zfp780b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:338354 MGI:2444764
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C130069I09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233026 MGI:3036281
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 21 ESTs, 1 Protein

name	LOC100043772 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043772
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 35 ESTs, 1 Protein

name	Psmc4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23996 MGI:1346093
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043774 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043774
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	9530053A07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319482 MGI:2442118
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fbl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14113 MGI:95486
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dyrk1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13549 MGI:1330302
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Cyp2b13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6681104 GeneID:13089 MGI:88599
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 2, subfamily b, polypeptide 13 transcript_id : NM_007813.1

name	Cyp2b9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129801 GeneID:13094 MGI:88600
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 2, subfamily b, polypeptide 9 transcript_id : NM_010000.2

name	Cyp2a4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116268117 GeneID:13086 MGI:88596
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 2, subfamily a, polypeptide 4 transcript_id : NM_009997.2

name	Nlrp9c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110815823 GeneID:330490 MGI:3028627
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NLR family, pyrin domain containing 9C transcript_id : NM_001042612.1

name	Nlrp4a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803250 GeneID:243880 MGI:2443697
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NLR family, pyrin domain containing 4A transcript_id : NM_172896.2

name	Nlrp9a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115299742 GeneID:233001 MGI:2675292
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NLR family, pyrin domain containing 9A transcript_id : NM_001048219.1

name	Nlrp9a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115299751 GeneID:233001 MGI:2675292
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NLR family, pyrin domain containing 9A transcript_id : NM_001048220.1

name	V1re12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717778 GeneID:171265 MGI:2159634
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, E12 transcript_id : NM_134231.1

name	EG243881 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487254 GeneID:243881 MGI:3646735
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG243881 transcript_id : NM_001081148.1

name	Cyp2b19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6681106 GeneID:13090 MGI:107303
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 2, subfamily b, polypeptide 19 transcript_id : NM_007814.1

name	Cyp2g1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7304990 GeneID:13108 MGI:109612
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 2, subfamily g, polypeptide 1 transcript_id : NM_013809.1

name	LOC100043745 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256663 GeneID:100043745
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100043745 transcript_id : XM_001480935.1

name	Cyp2a5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349519 GeneID:13087 MGI:88597
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 2, subfamily a, polypeptide 5 transcript_id : NM_007812.3

name	EG233005 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380058 GeneID:233005 MGI:3648316
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 30 ESTs, 6 Proteins product : predicted gene, EG233005, transcript variant 3 transcript_id : XM_896592.2

name	EG233005 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256665 GeneID:233005 MGI:3648316
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 34 ESTs, 49 Proteins product : predicted gene, EG233005 transcript_id : XM_001480937.1

name	EG233005 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380060 GeneID:233005 MGI:3648316
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 4 Proteins product : predicted gene, EG233005, transcript variant 4 transcript_id : XM_896600.2

name	EG330491 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256473 GeneID:330491 MGI:3647278
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 66 ESTs, 4 Proteins product : predicted gene, EG330491 transcript_id : XM_286199.6

name	Cyp2a12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19526797 GeneID:13085 MGI:105055
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 2, subfamily a, polypeptide 12 transcript_id : NM_133657.1

name	Cyp2f2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124001559 GeneID:13107 MGI:88608
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 2, subfamily f, polypeptide 2 transcript_id : NM_007817.2

name	Gm1450 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256475 GeneID:384724 MGI:2686296
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 82 Proteins product : gene model 1450, (NCBI) transcript_id : XM_357820.4

name	Egln2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893236 GeneID:112406 MGI:1932287
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : EGL nine homolog 2 (C. elegans) transcript_id : NM_053208.3

name	Rab4b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133891837 GeneID:19342 MGI:105071
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB4B, member RAS oncogene family transcript_id : NM_029391.2

name	Mia1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365990 GeneID:12587 MGI:109615
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : melanoma inhibitory activity 1 transcript_id : NM_019394.2

name	Snrpa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114052105 GeneID:53607 MGI:1855690
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small nuclear ribonucleoprotein polypeptide A transcript_id : NM_015782.3

name	Snrpa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114052540 GeneID:53607 MGI:1855690
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small nuclear ribonucleoprotein polypeptide A transcript_id : NM_001046637.1

name	Itpkc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31795579 GeneID:233011 MGI:2442554
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : inositol 1,4,5-trisphosphate 3-kinase C transcript_id : NM_181593.2

name	Adck4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124244099 GeneID:76889 MGI:1924139
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aarF domain containing kinase 4 transcript_id : NM_133770.2

name	Numbl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87042276 GeneID:18223 MGI:894702
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : numb-like transcript_id : NM_010950.2

name	Ltbp4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:32189329 GeneID:108075 MGI:1321395
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : latent transforming growth factor beta binding protein 4 transcript_id : NM_175641.1

name	Shkbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:109659850 GeneID:192192 MGI:2385803
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Sh3kbp1 binding protein 1 transcript_id : NM_138676.2

name	Spnb4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116174792 GeneID:80297 MGI:1890574
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : spectrin beta 4 transcript_id : NM_032610.2

name	Blvrb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893170 GeneID:233016 MGI:2385271
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : biliverdin reductase B (flavin reductase (NADPH)) transcript_id : NM_144923.3

name	Sertad3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254112 GeneID:170742 MGI:2180697
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SERTA domain containing 3 transcript_id : NM_133210.2

name	Sertad1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802555 GeneID:55942 MGI:1913438
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SERTA domain containing 1 transcript_id : NM_018820.4

name	Prx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9506998 GeneID:19153 MGI:108176
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : periaxin transcript_id : NM_019412.1

name	Prx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37674284 GeneID:19153 MGI:108176
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : periaxin transcript_id : NM_198048.1

name	Hipk4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85701817 GeneID:233020 MGI:2685008
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : homeodomain interacting protein kinase 4 transcript_id : NM_001033315.1

name	Pld3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7242180 GeneID:18807 MGI:1333782
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phospholipase D family, member 3 transcript_id : NM_011116.1

name	2310022A10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31541873 GeneID:66367 MGI:1913617
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310022A10 gene transcript_id : NM_175107.3

name	Akt2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27312021 GeneID:11652 MGI:104874
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thymoma viral proto-oncogene 2 transcript_id : NM_007434.2

name	Ttc9b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625932 GeneID:73032 MGI:1920282
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tetratricopeptide repeat domain 9B transcript_id : NM_028417.1

name	Map3k10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486846 GeneID:269881 MGI:1346879
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitogen activated protein kinase kinase kinase 10 transcript_id : NM_001081292.1

name	C030039L03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38259209 GeneID:112415 MGI:2148237
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C030039L03 gene transcript_id : NM_198417.1

name	Zfp60 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86476065 GeneID:22718 MGI:99207
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 60 transcript_id : NM_009560.2

name	Zfp60 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86476063 GeneID:22718 MGI:99207
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 60 transcript_id : NM_029531.2

name	LOC100043229 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256479 GeneID:100043229
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100043229 transcript_id : XM_001479782.1

name	LOC100043233 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256481 GeneID:100043233
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : hypothetical protein LOC100043233 transcript_id : XM_001479790.1

name	4933426I21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256483 GeneID:71163 MGI:1918413
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : RIKEN cDNA 4933426I21 gene transcript_id : XM_622939.4

name	Zfp59 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124269714 GeneID:22717 MGI:99206
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 59 transcript_id : NM_011762.3

name	4732475C15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625612 GeneID:545938 MGI:3584526
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4732475C15 gene transcript_id : NM_001024726.2

name	Prkcz2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380064 GeneID:404705 MGI:3029152
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 31 ESTs, 24 Proteins product : protein kinase C, zeta 2 transcript_id : XM_994291.1

name	1700049G17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:74315968 GeneID:73430 MGI:1920680
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700049G17 gene transcript_id : NM_028538.1

name	EG668175 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380080 GeneID:668175 MGI:3643781
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 65 ESTs, 1 Protein product : predicted gene, EG668175, transcript variant 2 transcript_id : XM_001002407.1

name	LOC100043771 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256667 GeneID:100043771
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 16 ESTs, 8 Proteins product : similar to Josephin domain containing 1 transcript_id : XM_001480984.1

name	Zfp780b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486617 GeneID:338354 MGI:2444764
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 780B transcript_id : NM_001081021.1

name	C130069I09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256671 GeneID:233026 MGI:3036281
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 21 ESTs, 1 Protein product : RIKEN cDNA C130069I09 gene, transcript variant 1 transcript_id : XM_133337.8

name	LOC100043772 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256669 GeneID:100043772
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 35 ESTs, 1 Protein product : similar to crooked legs CG14938-PB transcript_id : XM_001480985.1

name	Psmc4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124248576 GeneID:23996 MGI:1346093
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proteasome (prosome, macropain) 26S subunit, ATPase, 4 transcript_id : NM_011874.2

name	LOC100043774 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256673 GeneID:100043774
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100043774 transcript_id : XM_001480990.1

name	9530053A07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373994 GeneID:319482 MGI:2442118
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9530053A07 gene transcript_id : NM_176924.3

name	Fbl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982372 GeneID:14113 MGI:95486
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fibrillarin transcript_id : NM_007991.2

name	Dyrk1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893198 GeneID:13549 MGI:1330302
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1b transcript_id : NM_001037957.2

name	Dyrk1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753697 GeneID:13549 MGI:1330302
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1b transcript_id : NM_010092.1

name	Cyp2b13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681105 CCDS:CCDS21000.1 GeneID:13089 MGI:88599
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016712 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : cytochrome P450, 2b13, phenobarbitol inducible, type c; phenobarbital inducible, type c product : cytochrome P450, family 2, subfamily b, polypeptide 13 protein_id : NP_031839.1

name	Cyp2b9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753578 CCDS:CCDS21001.1 GeneID:13094 MGI:88600
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016712 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen [Evidence IEA]; GO:0050381 - unspecific monooxygenase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 note : cytochrome P450, 2b9, phenobarbitol inducible, type a; 16alphaoh-a product : cytochrome P450, family 2, subfamily b, polypeptide 9 protein_id : NP_034130.1

name	Cyp2a4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116268118 CCDS:CCDS21002.1 GeneID:13086 MGI:88596
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IDA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016712 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen [Evidence IEA]; GO:0050381 - unspecific monooxygenase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 note : cytochrome P450, 2a4; testosterone 15alpha-hydroxylase product : cytochrome P450, family 2, subfamily a, polypeptide 4 protein_id : NP_034127.2

name	Nlrp9c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110815824 GeneID:330490 MGI:3028627
definition	GO_component : GO:0019028 - viral capsid [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : NACHT, LRR and PYD containing protein 9c protein_id : NP_001036077.1

name	Nlrp4a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370372 CCDS:CCDS21003.1 GeneID:243880 MGI:2443697
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : NACHT/LRR/pyrin domain-containing protein 4 product : NACHT, leucine rich repeat and PYD containing 4A protein_id : NP_766484.1

name	Nlrp9a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115299743 GeneID:233001 MGI:2675292
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; NACHT, LRR and PYD containing protein 9a product : NACHT, LRR and PYD containing protein 9a isoform 1 protein_id : NP_001041684.1

name	Nlrp9a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115299752 GeneID:233001 MGI:2675292
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; NACHT, LRR and PYD containing protein 9a product : NACHT, LRR and PYD containing protein 9a isoform 2 protein_id : NP_001041685.1

name	V1re12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717779 CCDS:CCDS21005.1 GeneID:171265 MGI:2159634
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, E12 protein_id : NP_598992.1

name	EG243881 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487255 GeneID:243881 MGI:3646735
definition	GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016712 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 product : hypothetical protein LOC243881 protein_id : NP_001074617.1

name	Cyp2b19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681107 CCDS:CCDS21006.1 GeneID:13090 MGI:107303
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016712 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen [Evidence IEA]; GO:0050381 - unspecific monooxygenase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 function : mixed function monooxygenase note : cytochrome P450, 2b19 product : cytochrome P450, family 2, subfamily b, polypeptide 19 protein_id : NP_031840.1

name	Cyp2g1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7304991 CCDS:CCDS21007.1 GeneID:13108 MGI:109612
definition	GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016712 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 note : cytochrome P450, 2g1 product : cytochrome P450, family 2, subfamily g, polypeptide 1 protein_id : NP_038837.1

name	LOC100043745 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256664 GeneID:100043745
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480985.1

name	Cyp2a5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75832129 CCDS:CCDS21008.1 GeneID:13087 MGI:88597
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016712 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen [Evidence IEA]; GO:0050381 - unspecific monooxygenase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 note : cytochrome P450, 2a5 product : cytochrome P450, family 2, subfamily a, polypeptide 5 protein_id : NP_031838.2

name	EG233005 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94380059 GeneID:233005 MGI:3648316
definition	codon_start : 1 product : similar to Cytochrome P450, family 2, subfamily a, polypeptide 12 isoform 3 protein_id : XP_901685.2

name	EG233005 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256666 GeneID:233005 MGI:3648316
definition	codon_start : 1 product : similar to Cytochrome P450, family 2, subfamily a, polypeptide 12 protein_id : XP_001480987.1

name	EG233005 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94380061 GeneID:233005 MGI:3648316
definition	codon_start : 1 product : similar to Cytochrome P450, family 2, subfamily a, polypeptide 12 isoform 4 protein_id : XP_901693.2

name	EG330491 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256474 GeneID:330491 MGI:3647278
definition	codon_start : 1 product : similar to Cytochrome P450 2A5 (CYPIIA5) (Coumarin 7-hydroxylase) (P450-15-COH) (P450-IIA3.2) protein_id : XP_286199.6

name	Cyp2a12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526798 CCDS:CCDS21009.1 GeneID:13085 MGI:105055
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016712 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen [Evidence IEA]; GO:0050381 - unspecific monooxygenase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 note : cytochrome P450, 2a12 product : cytochrome P450, family 2, subfamily a, polypeptide 12 protein_id : NP_598418.1

name	Cyp2f2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124001560 CCDS:CCDS21010.1 GeneID:13107 MGI:88608
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016712 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 note : cytochrome P450, 2f2 product : cytochrome P450, family 2, subfamily f, polypeptide 2 protein_id : NP_031843.2

name	Gm1450 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256476 GeneID:384724 MGI:2686296
definition	codon_start : 1 product : similar to cytochrome P450 monooxygenase CYP2T1 protein_id : XP_357820.4

name	Egln2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450783 CCDS:CCDS21011.1 GeneID:112406 MGI:1932287
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0008198 - ferrous iron binding [Evidence ISS]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0031418 - L-ascorbic acid binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016706 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors [Evidence ISS] [Evidence IEA]; GO:0016702 - oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen [Evidence IEA]; GO:0019826 - oxygen sensor activity [Evidence ISS] GO_process : GO:0030520 - estrogen receptor signaling pathway [Evidence ISS]; GO:0045732 - positive regulation of protein catabolism [Evidence ISS]; GO:0019538 - protein metabolism [Evidence IEA]; GO:0001558 - regulation of cell growth [Evidence ISS]; GO:0030503 - regulation of cell redox homeostasis [Evidence ISS]; GO:0001666 - response to hypoxia [Evidence ISS] codon_start : 1 note : immediate early response 4 product : EGL nine homolog 2 protein_id : NP_444438.2

name	Rab4b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313012 CCDS:CCDS21012.1 GeneID:19342 MGI:105071
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : RAB4B, member RAS oncogene family protein_id : NP_083667.1

name	Mia1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9506479 CCDS:CCDS21013.1 GeneID:12587 MGI:109615
definition	GO_component : GO:0005576 - extracellular region [Evidence TAS] GO_function : GO:0008083 - growth factor activity [Evidence IEA] GO_process : GO:0007160 - cell-matrix adhesion [Evidence IMP]; GO:0030198 - extracellular matrix organization and biogenesis [Evidence IMP] codon_start : 1 exception : mismatches in translation function : melanoma-inhibitory-activity note : melanoma-inhibitory-activity; cartilage derived retinoic acid sensitive protein; melanoma inhibatory activity product : melanoma inhibitory activity 1 protein_id : NP_062267.1

name	Snrpa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114052541 GeneID:53607 MGI:1855690
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005681 - spliceosome complex [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 note : protein A of the U1 small nuclear RNA; U1 snRNP product : small nuclear ribonucleoprotein polypeptide A protein_id : NP_001040102.1

name	Snrpa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114052106 CCDS:CCDS21014.1 GeneID:53607 MGI:1855690
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005681 - spliceosome complex [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 note : protein A of the U1 small nuclear RNA; U1 snRNP product : small nuclear ribonucleoprotein polypeptide A protein_id : NP_056597.3

name	Itpkc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31712006 CCDS:CCDS21015.1 GeneID:233011 MGI:2442554
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0008440 - inositol trisphosphate 3-kinase activity [Evidence IDA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : inositol 1,4,5-trisphosphate 3-kinase C protein_id : NP_853624.1

name	Adck4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124244100 GeneID:76889 MGI:1924139
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : aarF domain containing kinase 4 protein_id : NP_598531.2

name	Numbl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:87042277 CCDS:CCDS21016.1 GeneID:18223 MGI:894702
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_process : GO:0007409 - axonogenesis [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0030900 - forebrain development [Evidence IMP]; GO:0007399 - nervous system development [Evidence IMP]; GO:0007405 - neuroblast proliferation [Evidence IGI] codon_start : 1 product : numb-like protein_id : NP_035080.2

name	Ltbp4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32189330 CCDS:CCDS21017.1 GeneID:108075 MGI:1321395
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence ISS] [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] [Evidence ISS]; GO:0005539 - glycosaminoglycan binding [Evidence ISS]; GO:0019838 - growth factor binding [Evidence IEA]; GO:0005178 - integrin binding [Evidence ISS]; GO:0005515 - protein binding [Evidence TAS] GO_process : GO:0007275 - development [Evidence ISS]; GO:0030252 - growth hormone secretion [Evidence ISS]; GO:0046879 - hormone secretion [Evidence IMP]; GO:0006457 - protein folding [Evidence ISS]; GO:0045595 - regulation of cell differentiation [Evidence ISS]; GO:0001558 - regulation of cell growth [Evidence ISS]; GO:0030162 - regulation of proteolysis [Evidence ISS]; GO:0017015 - regulation of transforming growth factor beta receptor signaling pathway [Evidence ISS]; GO:0007179 - transforming growth factor beta receptor signaling pathway [Evidence IMP] codon_start : 1 exception : mismatches in translation product : latent transforming growth factor beta binding protein 4 protein_id : NP_783572.1

name	Shkbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:109659851 CCDS:CCDS21018.1 GeneID:192192 MGI:2385803
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016020 - membrane [Evidence IEA]; GO:0008076 - voltage-gated potassium channel complex [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0005249 - voltage-gated potassium channel activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006813 - potassium ion transport [Evidence IEA] codon_start : 1 note : SETA binding protein 1 product : Sh3kbp1 binding protein 1 protein_id : NP_619617.2

name	Spnb4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116174793 CCDS:CCDS21019.1 GeneID:80297 MGI:1890574
definition	GO_component : GO:0030424 - axon [Evidence IDA]; GO:0043203 - axon hillock [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0016363 - nuclear matrix [Evidence IDA] GO_process : GO:0051016 - barbed-end actin filament capping [Evidence IEA]; GO:0007605 - sensory perception of sound [Evidence IMP]; GO:0019226 - transmission of nerve impulse [Evidence IMP] codon_start : 1 note : beta-spectrin 4; quivering; lumbosacral neuroaxonal dystrophy product : spectrin beta 4 protein_id : NP_115999.2

name	Blvrb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450325 GeneID:233016 MGI:2385271
definition	GO_function : GO:0050662 - coenzyme binding [Evidence IEA]; GO:0042602 - flavin reductase activity [Evidence IEA] GO_process : GO:0044237 - cellular metabolism [Evidence IEA] codon_start : 1 product : biliverdin reductase B (flavin reductase (NADPH)) protein_id : NP_659172.1

name	Sertad3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18875358 CCDS:CCDS21021.1 GeneID:170742 MGI:2180697
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0016563 - transcriptional activator activity [Evidence IDA] GO_process : GO:0030308 - negative regulation of cell growth [Evidence ISS]; GO:0045941 - positive regulation of transcription [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : replication protein-binding trans-activator; replication protein binding trans-activator product : SERTA domain containing 3 protein_id : NP_573473.1

name	Sertad1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9055332 CCDS:CCDS21022.1 GeneID:55942 MGI:1913438
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0016563 - transcriptional activator activity [Evidence IDA] GO_process : GO:0030308 - negative regulation of cell growth [Evidence ISS]; GO:0045941 - positive regulation of transcription [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : PHD zinc finger- and bromodomain-interacting protein 1 product : p34SEI-1 protein_id : NP_061290.1

name	Prx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37674285 CCDS:CCDS21023.1 GeneID:19153 MGI:108176
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] codon_start : 1 exception : mismatches in translation note : isoform L is encoded by transcript variant 1 product : periaxin isoform L protein_id : NP_932165.1

name	Prx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9506999 GeneID:19153 MGI:108176
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] codon_start : 1 note : isoform S is encoded by transcript variant 2 product : periaxin isoform S protein_id : NP_062285.1

name	Hipk4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701818 CCDS:CCDS21024.1 GeneID:233020 MGI:2685008
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 exception : mismatches in translation product : homeodomain interacting protein kinase 4 protein_id : NP_001028487.1

name	Pld3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7242181 CCDS:CCDS21025.1 GeneID:18807 MGI:1333782
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence ISS] GO_function : GO:0004630 - phospholipase D activity [Evidence ISS] codon_start : 1 note : phospholipase D3 product : phospholipase D family, member 3 protein_id : NP_035246.1

name	2310022A10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31541874 CCDS:CCDS21026.1 GeneID:66367 MGI:1913617
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC66367 protein_id : NP_780316.2

name	Akt2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680674 CCDS:CCDS21027.1 GeneID:11652 MGI:104874
definition	GO_component : GO:0030027 - lamellipodium [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0046328 - regulation of JNK cascade [Evidence IDA] codon_start : 1 note : RAC-beta serine/threonine protein kinase; protein kinase B, beta product : thymoma viral proto-oncogene 2 protein_id : NP_031460.1

name	Ttc9b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625933 CCDS:CCDS21028.1 GeneID:73032 MGI:1920282
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 product : tetratricopeptide repeat domain 9B protein_id : NP_082693.1

name	Map3k10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486847 GeneID:269881 MGI:1346879
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IDA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0003714 - transcription corepressor activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0016481 - negative regulation of transcription [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IPI] [Evidence IEA] codon_start : 1 note : MKN28 kinase; mixed lineage kinase 2; serine/threonine kinase; MKN28 derived nonreceptor_type product : mitogen activated protein kinase kinase kinase 10 protein_id : NP_001074761.1

name	C030039L03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38259210 CCDS:CCDS21029.1 GeneID:112415 MGI:2148237
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC112415 protein_id : NP_940809.1

name	Zfp60 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:86476066 CCDS:CCDS21030.1 GeneID:22718 MGI:99207
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : zinc finger protein 60 protein_id : NP_033586.2

name	Zfp60 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:86476064 CCDS:CCDS21030.1 GeneID:22718 MGI:99207
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : zinc finger protein 60 protein_id : NP_083807.2

name	LOC100043229 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256480 GeneID:100043229
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479832.1

name	LOC100043233 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256482 GeneID:100043233
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479840.1

name	4933426I21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256484 GeneID:71163 MGI:1918413
definition	codon_start : 1 product : hypothetical protein LOC71163 protein_id : XP_622939.3

name	Zfp59 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124269715 GeneID:22717 MGI:99206
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : zinc finger protein Mfg-2 product : zinc finger protein 59 protein_id : NP_035892.2

name	4732475C15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625613 GeneID:545938 MGI:3584526
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : hypothetical protein LOC545938 protein_id : NP_001019897.2

name	Prkcz2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94380065 GeneID:404705 MGI:3029152
definition	codon_start : 1 exception : unclassified translation discrepancy note : overriding stop codons product : similar to Protein kinase C, zeta protein_id : XP_999385.1 transl_except : (pos:complement(28668399..28668401),aa:OTHER) transl_except : (pos:complement(28668354..28668356),aa:OTHER) transl_except : (pos:complement(28668324..28668326),aa:OTHER) transl_except : (pos:complement(28668198..28668200),aa:OTHER) transl_except : (pos:complement(28668150..28668152),aa:OTHER) transl_except : (pos:complement(28668063..28668065),aa:OTHER) transl_except : (pos:complement(28667967..28667969),aa:OTHER) transl_except : (pos:complement(28667853..28667855),aa:OTHER) transl_except : (pos:complement(28667829..28667831),aa:OTHER)

name	1700049G17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:74315969 CCDS:CCDS21032.1 GeneID:73430 MGI:1920680
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : hypothetical protein LOC73430 protein_id : NP_082814.1

name	EG668175 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94380081 GeneID:668175 MGI:3643781
definition	codon_start : 1 product : similar to LOC635138 protein isoform 2 protein_id : XP_001002407.1

name	LOC100043771 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256668 GeneID:100043771
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481034.1

name	Zfp780b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486618 GeneID:338354 MGI:2444764
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : zinc finger protein 780B protein_id : NP_001074490.1

name	C130069I09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256672 GeneID:233026 MGI:3036281
definition	codon_start : 1 product : similar to LOC672243 protein isoform 1 protein_id : XP_133337.6

name	LOC100043772 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256670 GeneID:100043772
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481035.1

name	Psmc4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124248577 CCDS:CCDS21034.1 GeneID:23996 MGI:1346093
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005829 - cytosol [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA]; GO:0043234 - protein complex [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0030163 - protein catabolism [Evidence IEA] codon_start : 1 note : CAR interacting protein 21; CAR interacing protein 21 product : proteasome 26S ATPase subunit 4 protein_id : NP_036004.2

name	LOC100043774 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256674 GeneID:100043774
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481040.1

name	9530053A07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28892723 CCDS:CCDS21035.1 GeneID:319482 MGI:2442118
definition	codon_start : 1 product : Fc fragment of IgG binding protein protein_id : NP_795898.1

name	Fbl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982373 CCDS:CCDS21036.1 GeneID:14113 MGI:95486
definition	GO_component : GO:0015030 - Cajal body [Evidence TAS] [Evidence IDA]; GO:0005730 - nucleolus [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0030515 - snoRNA binding [Evidence TAS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006364 - rRNA processing [Evidence TAS]; GO:0016074 - snoRNA metabolism [Evidence IMP] codon_start : 1 product : fibrillarin protein_id : NP_032017.2

name	Dyrk1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83816922 CCDS:CCDS21037.1 GeneID:13549 MGI:1330302
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007520 - myoblast fusion [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 1 product : dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1b isoform b protein_id : NP_001033046.1

name	Dyrk1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753698 GeneID:13549 MGI:1330302
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007520 - myoblast fusion [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 2 product : dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1b isoform a protein_id : NP_034222.1

name	LOC623532 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:623532
definition	number : 10 pseudo : _no_value

name	LOC623532 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:623532
definition	number : 9 pseudo : _no_value

name	LOC623532 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:623532
definition	number : 8 pseudo : _no_value

name	LOC623532 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:623532
definition	number : 7 pseudo : _no_value

name	LOC623532 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:623532
definition	number : 6 pseudo : _no_value

name	LOC623532 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:623532
definition	number : 5 pseudo : _no_value

name	LOC623532 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:623532
definition	number : 4 pseudo : _no_value

name	LOC623532 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:623532
definition	number : 3 pseudo : _no_value

name	LOC623532 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:623532
definition	number : 2 pseudo : _no_value

name	LOC623532 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:623532
definition	number : 1 pseudo : _no_value

name	LOC100043195 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043195
definition	number : 3 pseudo : _no_value

name	LOC100043195 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043195
definition	number : 2 pseudo : _no_value

name	LOC100043195 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043195
definition	number : 1 pseudo : _no_value

name	LOC623830 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:623830
definition	number : 1 pseudo : _no_value

name	LOC623830 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:623830
definition	number : 2 pseudo : _no_value

name	LOC623830 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:623830
definition	number : 3 pseudo : _no_value

name	LOC100043199 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043199
definition	number : 1 pseudo : _no_value

name	LOC667968 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256463 GeneID:667968
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 8 Proteins product : similar to ubiquitin specific peptidase 12 pseudo : _no_value transcript_id : XR_034342.1

clone name	MSMg01-306J03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-377D12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-055G19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-375A16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-406C03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-218K22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-526F04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-148D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351C05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-364N03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-262N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-498B16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-078C09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-164A24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-544H05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-530K01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-437A01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-500C04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-332J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-062D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-539M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-490G19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-535B17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-351C05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-130A24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-333O04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-321D14
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-320K05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-100P06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-535L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-410O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-542K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-212O01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-065P22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-516N01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388P07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-425A10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416H24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-234O17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548C18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-461O16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-443L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-401P08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-468N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-163P10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-463F24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-179P22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-150E04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-473G06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-154D23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-355A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-464B08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-211N11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-382H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-191H06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-214P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-487P24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-527N16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-545D08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-095H12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-269A14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518J06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-508C15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-409K22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-141G06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-409C22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-374O17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-054F10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-456F06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-443O14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-094B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-544B01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-277I23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-265I10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-098K08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-121J12
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-346H11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-129L13
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-346E22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-390N16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-272O24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-083C14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-299D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-364E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-257E10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-066C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056B12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-326A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166G01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192A01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142A11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045L05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108A23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194D07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-236A11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-213H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-349J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287P03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092K13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060O15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-314D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-119N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022C02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-060O15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-223B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154P06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-104D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-090P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-330O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015K05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200G04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-347C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010B02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-033J07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091P09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-337G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053N07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-012E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113O14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132D04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274N11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-074A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-336N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085E03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-079M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077F21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-288A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178C05
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-274A06.b	B6Ng01-274A06.g
ACC	GA075432	GA075433
length	352	1,122
definition	B6Ng01-274A06.b	B6Ng01-274A06.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(28,004,018 - 28,004,369)	(27,879,026 - 27,880,087)
sequence	acaaagatccacctgtctctgccctctgagtgctgggatcaaaggctgct gcactatcatgcttggctaggccttgtctgtgggttgagtctcagctttg gagtgggtgggtactgcttcacatcctacttacttatgggtgactccttg ggattcagttccttccccacatattactgcccttgcaggattttttgttt gtttgtttgtttttgtggggttttttttgtttgtttgttttttttttttc ttgaaacagggtttctctgtgtagccctggctgtcctggaactcactctg tagaccatgctgaccttgaactcataaatttgcctgcctctgcctcccaa gt	gaattccccagtaaggggctggaggtgtggctcagtggtaaggaccctgc ctagaatcccccaggggggagatggaggcataactcattagtagaggacc tgtctagagtcttccagtgatgggcttgggcatggctcagtggttgacta catgactggtgtactgaataattttataccaatttgacacaagctacagt cactggagaggacagaacctcaattgagaaaatgcctcaatcagaccaga caataggcaggtctcaaggacattatcttgattagtgatgatggggtaga gcccaacccatagtgggtggtgcaatccttgggctggtagtcctaggttc tataagaaagcagactgagcaaggcacagggagcaagccagtaagcagca cccctccatgacctctgcatcagcatctacctccaggatcctggagttcc tatttgagttcctgtcctgacttccttccatgctgaacagtaatgtggaa gtgtaagccaaataaaccctttcctcctcaagttgctttggtcatggtgt ctcacctcaatcccccagtgaggagcatgagagcctaagacactggcatg tgtaaggccttggcctccattccagcatcacaagaaggaagaagaagagg gggcagaagcagaacctagcacataaaaatatagccctaaattatgtaag acaaaacatagaagttttaaaggattcacaaaatctactatcataagagg agatttaaacattagtgactgatacttaaaacagatcaaaaggctctcac tccttctcctgcttgccgtgtgggactgagtaactgctagatccttgggc ttccattcacagctactactgaaccattgtggggaattggactacagact tcttctaaaagtgggaacatcacttggccttgtatgtgccctggagtctt attttccatacttcatggaacttaatacacttgtgactacttagaaaaga atcttaagaaagtcaaagttcgttttcaggatgattgtgtcttttaaatg tctaagtatcctagcaattggatggaccttgtagggcatcattcttagtg aggctacacattccataggaac
quality values	Open. Hide. 27 43 24 62 62 62 41 37 62 39 23 62 62 62 62 49 38 62 62 62 62 62 62 62 62 56 56 43 37 48 59 59 59 62 62 62 62 49 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 62 62 62 62 62 62 62 54 62 59 59 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 59 59 62 62 62 62 59 59 56 54 54 59 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 54 42 49 62 62 59 59 62 59 62 56 54 50 40 49 34 33 38 49 21 30 43 34 34 34 49 39 13 38 23 13 18 13 18 18 34 27 13 25 18 28 18 31 27 23 18 6 10 10 10 13 21 18 24 19 15 18 27 34 25 22 22 16 18 31 36 34 27 24 16 27 18 27 34 50 35 32 23 33 34 34 34 23 32 18 16 13 16 18 12 15	Open. Hide. 49 44 39 44 62 62 62 62 59 59 34 43 39 28 28 49 34 33 40 59 62 62 59 59 59 62 62 62 62 59 62 62 59 59 59 62 62 62 62 62 62 62 62 59 49 62 62 62 62 62 62 62 62 59 59 62 62 62 62 54 62 62 62 62 62 54 54 62 62 59 59 59 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 59 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 54 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 42 42 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 37 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 54 58 58 58 58 58 58 58 54 41 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 54 58 58 54 58 52 58 58 58 58 58 58 58 58 54 54 54 58 58 58 47 58 58 58 58 58 58 58 54 52 58 58 58 42 58 58 50 58 51 51 58 58 50 58 54 58 58 54 58 58 50 46 47 46 58 58 58 58 54 51 58 58 49 58 53 53 58 35 38 12 58 58 58 41 41 51 54 54 50 49 41 58 58 51 41 41 53 58 51 51 58 53 51 52 58 51 58 54 48 58 58 58 32 58 49 40 58 51 32 58 19 58 58 58 58 52 53 41 58 50 37 58 41 40 58 50 39 51 52 52 37 54 53 53 50 51 32 58 58 58 53 53 39 51 49 45 54 54 49 47 29 54 37 40 52 33 21 49 45 49 49 42 47 32 35 54 54 51 53 42 50 44 41 54 54 35 54 49 54 32 24 54 54 35 51 31 25 44 44 33 52 37 54 54 37 38 52 40 40 53 41 39 39 53 35 53 37 38 27 44 25 54 33 22 28 15 54 31 22 46 31 40 31 51 43 45 39 32 47 32 29 31 42 42 31 34 41 52 31 21 53 49 32 32 31 32 32 32 31 25 46 49 31 36 42 27 43 33 29 32 30 42 45 31 42 33 32 45 32 31 41 33 42 31 24 23 31 19 40 27 31 51 25 25 33 46 45 32 31 31 42 24 30 25 21 32 31 43 31 32 31 21 25 26 16 46 31 38 33 48 43 28 31 32 26 33 33 31 42 33 28 31 25 26 31 31 27 43 33 36 29 27 27 44 21 30 43 32 39 21 28 28 36 46 46 28 29 31 18 35 30 27 31 23 25 25 31 22 24 32 22 15 31 20 22 33 31 31 35 44 48 33 23 25 28 41 24 35 22 20 21 31 34 32 28 25 18 19 36 7 11 33 15 26 17 23 21 14 7 7 17 36 12 4 11 10 6 6 18 10 7 9 21 25 40 48 19 22 33 10 18 20 24 12 21 11 17 21 11 7 22 13 29 14 16 19 15 7 7 5 29 13 29 21 28 20 18 14 13 15 15 24 25 16 5 6 6 47 21 20 8 9 20 12 20 27 21 14 16 15 24 40 27 17 22 27 24 11 4 5 4 7 21 6 14 32 16 8 8 9 22 9 19 13 7 21 21 19 4 6 15 18 14 7 29 27 22 11 20 13 4 6 7 14 23 8 14 9 12 5 13 9 17 6 18 10 3 3 3 4 6 24 8 23 12 13 14 7 8 16 4 7 2 2 2 13 28 15 12 13 23 16 12 10 6 14 5 8 15 5 4 8 18 6 3 3 2 14 6 4 9 4 3 3 1 2 2 3 3 3 3 2 3 5

Alignment Information

BAC End 1

BAC End 2

seq1: chr7_28004018_28004369
seq2: B6Ng01-274A06.b_50_401 (reverse)

seq1  ACTTGGGAGGCAGAGGCAGGCAAATTTCTGAGTTCAAGGTCAGCCTGGTC  50
      ||||||||||||||||||||||||||| |||||||||||||||| |||||
seq2  ACTTGGGAGGCAGAGGCAGGCAAATTTATGAGTTCAAGGTCAGCATGGTC  50

seq1  TACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGAAACCCTGTTTC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGAAACCCTGTTTC  100

seq1  AAGAAAAAAAAAAAACAAACAAACAAAAAAAACCCCACAAAAACAAACAA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGAAAAAAAAAAAACAAACAAACAAAAAAAACCCCACAAAAACAAACAA  150

seq1  ACAAACAAAAAATCCTGCAAGGGCAGTAATATGTGGGGAAGGAACTGAAT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAAACAAAAAATCCTGCAAGGGCAGTAATATGTGGGGAAGGAACTGAAT  200

seq1  CCCAAGGAGTCACCCATAAGTAAGTAGGATGTGAAGCAGTACCCACCCAC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCAAGGAGTCACCCATAAGTAAGTAGGATGTGAAGCAGTACCCACCCAC  250

seq1  TCCAAAGCTGAGACTCAACCCACAGACAAGGCCTAGCCAAGCATGATAGT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCAAAGCTGAGACTCAACCCACAGACAAGGCCTAGCCAAGCATGATAGT  300

seq1  GCAGCAGCCTTTGATCCCAGCACTCAGAGGGCAGAGACAGGTGGATCTTT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAGCAGCCTTTGATCCCAGCACTCAGAGGGCAGAGACAGGTGGATCTTT  350

seq1  GT  352
      ||
seq2  GT  352

seq1: chr7_27879026_27880087
seq2: B6Ng01-274A06.g_128_1187

seq1  AGGGGGGAGATGGAGGCATAACTCATTAGTAGAGGACCTGTCTAGAGTCT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGGGGGAGATGGAGGCATAACTCATTAGTAGAGGACCTGTCTAGAGTCT  50

seq1  TCCAGTGATGGGCTTGGGCATGGCTCAGTGGTTGACTACATGACTGGTGT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCAGTGATGGGCTTGGGCATGGCTCAGTGGTTGACTACATGACTGGTGT  100

seq1  ACTGAATAATTTTATACCAATTTGACACAAGCTACAGTCACTGGAGAGGA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGAATAATTTTATACCAATTTGACACAAGCTACAGTCACTGGAGAGGA  150

seq1  CAGAACCTCAATTGAGAAAATGCCTCAATCAGACCAGACAATAGGCAGGT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGAACCTCAATTGAGAAAATGCCTCAATCAGACCAGACAATAGGCAGGT  200

seq1  CTCAAGGACATTATCTTGATTAGTGATGATGGGGTAGAGCCCAACCCATA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCAAGGACATTATCTTGATTAGTGATGATGGGGTAGAGCCCAACCCATA  250

seq1  GTGGGTGGTGCAATCCTTGGGCTGGTAGTCCTAGGTTCTATAAGAAAGCA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGGGTGGTGCAATCCTTGGGCTGGTAGTCCTAGGTTCTATAAGAAAGCA  300

seq1  GACTGAGCAAGGCACAGGGAGCAAGCCAGTAAGCAGCACCCCTCCATGAC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACTGAGCAAGGCACAGGGAGCAAGCCAGTAAGCAGCACCCCTCCATGAC  350

seq1  CTCTGCATCAGCATCTACCTCCAGGATCCTGGAGTTCCTATTTGAGTTCC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTGCATCAGCATCTACCTCCAGGATCCTGGAGTTCCTATTTGAGTTCC  400

seq1  TGTCCTGACTTCCTTCCATGCTGAACAGTAATGTGGAAGTGTAAGCCAAA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTCCTGACTTCCTTCCATGCTGAACAGTAATGTGGAAGTGTAAGCCAAA  450

seq1  TAAACCCTTTCCTCCTCAAGTTGCTTTGGTCATGGTGTCTCACCTCAATC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAACCCTTTCCTCCTCAAGTTGCTTTGGTCATGGTGTCTCACCTCAATC  500

seq1  CCCCAGTGAGGAGCATGAGAGCCTAAGACACTGGCATGTGTAAGGCCTTG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCCAGTGAGGAGCATGAGAGCCTAAGACACTGGCATGTGTAAGGCCTTG  550

seq1  GCCTCCATTCCAGCATCACAAGAAGGAAGAAGAAGAGGGGGCAGAAGCAG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCTCCATTCCAGCATCACAAGAAGGAAGAAGAAGAGGGGGCAGAAGCAG  600

seq1  AACCTAGCACATAAAAATATAGCCCTAAATTATGTAAGACAAAACATAGA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACCTAGCACATAAAAATATAGCCCTAAATTATGTAAGACAAAACATAGA  650

seq1  AGTTTTAAAGGATTCACAAAATCTACTATCATAAGAGGAGATTTAAACAT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTTTAAAGGATTCACAAAATCTACTATCATAAGAGGAGATTTAAACAT  700

seq1  TAGTGACTGATACTTAAAACAGATCAAAAGGCTCTCACTCCTTCTCCTGC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGTGACTGATACTTAAAACAGATCAAAAGGCTCTCACTCCTTCTCCTGC  750

seq1  TTGCCGTGTGGGACTGAGTAACTGCTAGATCCTTGGGCTTCCATTCACAG  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGCCGTGTGGGACTGAGTAACTGCTAGATCCTTGGGCTTCCATTCACAG  800

seq1  CTACTACTGAACCATTGTGGGGAATTGGACTACAGACTTCTTCTAAAAGT  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTACTACTGAACCATTGTGGGGAATTGGACTACAGACTTCTTCTAAAAGT  850

seq1  GGGAACATCACTTGG-CTTGTATGTGCCCTGGAGTCT--ATTTCCATACT  897
      ||||||||||||||| |||||||||||||||||||||   ||||||||||
seq2  GGGAACATCACTTGGCCTTGTATGTGCCCTGGAGTCTTATTTTCCATACT  900

seq1  TCAT-GAACTTAATACAACTTGTGACTACTTAGAAAAGAATCTTAAGAAA  946
      |||| ||||||||||| |||||||||||||||||||||||||||||||||
seq2  TCATGGAACTTAATAC-ACTTGTGACTACTTAGAAAAGAATCTTAAGAAA  949

seq1  GTCAAAGTTCG-TTTCAGGATGAATTTGTGTCTTTTAAAATGTCTAAGTT  995
      ||||||||||| |||||||||||  ||||||||||| |||||||||||| 
seq2  GTCAAAGTTCGTTTTCAGGATGA--TTGTGTCTTTT-AAATGTCTAAGT-  995

seq1  ATTCCTAGCCAAATGGATGGACC-TGGAGGGCATCATCCTTAGTGAGGTA  1044
        |||||| ||| |||||||||| || |||||||||| ||||||||||  
seq2  -ATCCTAG-CAATTGGATGGACCTTGTAGGGCATCATTCTTAGTGAGGCT  1043

seq1  ACACATTCACAAAGGAAC  1062
      |||||||| || ||||||
seq2  ACACATTC-CATAGGAAC  1060

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information