MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-296N17
Chromosome	7 (Build37)
Map Location	128,016,877 - 128,136,634
singlet/doublet	doublet
Overlap gene	Eef2k, Polr3e, Cdr2, 4933427G17Rik
Upstream gene	Dcun1d3, LOC100043399, LOC100043396, Lyrm1, Dnahc3, Tmem159, Zp2, Anks4b, Crym, Abca14, Abca15, Abca16, LOC668429, LOC546994, LOC100042914, E130201H02Rik, LOC637957, Uqcrc2, 4930408O21Rik, BC030336, E030013G06Rik, EG436008, LOC100043426
Downstream gene	EG668548, Mettl9, LOC668456, Igsf6, Otoa, LOC668556, Hs3st2, Usp31, Scnn1g, Scnn1b, Cog7, Gga2
Link	Open Mouse BAC browser

Click to get alignment info.

name	Dcun1d3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233805 MGI:2679003
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043399 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043399
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC100043396 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043396
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Lyrm1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73919 MGI:1921169
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dnahc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381917 MGI:2683040
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 16 Proteins

name	Tmem159 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233806 MGI:1925752
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22787 MGI:99214
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Anks4b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72074 MGI:1919324
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Crym (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12971 MGI:102675
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abca14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67928 MGI:2388708
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abca15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320631 MGI:2388709
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abca16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233810 MGI:2388711
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668429 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668429
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 29 ESTs, 4 Proteins pseudo : _no_value

name	LOC546994 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546994
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 4 Proteins

name	LOC100042914 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042914
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	E130201H02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78552 MGI:1925802
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 7 ESTs, 13 Proteins

name	LOC637957 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:637957
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	Uqcrc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67003 MGI:1914253
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930408O21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67983 MGI:1915233
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	BC030336 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233812 MGI:2446240
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 68 ESTs, 2 Proteins

name	E030013G06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233813 MGI:3041229
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG436008 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:436008 MGI:3645276
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC100043426 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043426
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Eef2k (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13631 MGI:1195261
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Polr3e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26939 MGI:1349452
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12585 MGI:1100885
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4933427G17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74466 MGI:1921716
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 2 Proteins

name	EG668548 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668548 MGI:3648545
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 23 mRNAs, 1964 ESTs, 55 Proteins

name	Mettl9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59052 MGI:1914862
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668456 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668456
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 7 Proteins pseudo : _no_value

name	Igsf6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80719 MGI:1891393
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Otoa (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:246190 MGI:2149209
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668556 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668556
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Hs3st2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:195646 MGI:1333802
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Usp31 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76179 MGI:1923429
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 103 ESTs, 4 Proteins

name	Scnn1g (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20278 MGI:104695
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Scnn1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20277 MGI:104696
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cog7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233824 MGI:2685013
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gga2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74105 MGI:1921355
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dcun1d3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802226 GeneID:233805 MGI:2679003
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DCN1, defective in cullin neddylation 1, domain containing 3 (S. cerevisiae) transcript_id : NM_173408.2

name	LOC100043399 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257767 GeneID:100043399
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100043399 transcript_id : XM_001479787.1

name	LOC100043396 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257765 GeneID:100043396
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : hypothetical protein LOC100043396 transcript_id : XM_001479781.1

name	Lyrm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377746 GeneID:73919 MGI:1921169
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LYR motif containing 1 transcript_id : NM_029610.2

name	Dnahc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380999 GeneID:381917 MGI:2683040
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 16 Proteins product : dynein, axonemal, heavy chain 3 transcript_id : XM_355934.5

name	Tmem159 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21704177 GeneID:233806 MGI:1925752
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 159 transcript_id : NM_145586.1

name	Zp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142357661 GeneID:22787 MGI:99214
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zona pellucida glycoprotein 2 transcript_id : NM_011775.5

name	Anks4b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21312471 GeneID:72074 MGI:1919324
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat and sterile alpha motif domain containing 4B transcript_id : NM_028085.1

name	Crym (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7710011 GeneID:12971 MGI:102675
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : crystallin, mu transcript_id : NM_016669.1

name	Abca14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83745125 GeneID:67928 MGI:2388708
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP-binding cassette, sub-family A (ABC1), member 14 transcript_id : NM_026458.3

name	Abca15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46358377 GeneID:320631 MGI:2388709
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP-binding cassette, sub-family A (ABC1), member 15 transcript_id : NM_177213.3

name	Abca16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46369472 GeneID:233810 MGI:2388711
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP-binding cassette, sub-family A (ABC1), member 16 transcript_id : NM_207130.1

name	LOC546994 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257697 GeneID:546994
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 4 Proteins product : similar to Ankyrin repeat domain-containing protein 26 transcript_id : XM_001479054.1

name	E130201H02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257699 GeneID:78552 MGI:1925802
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 7 ESTs, 13 Proteins product : RIKEN cDNA E130201H02 gene transcript_id : XM_001479067.1

name	LOC637957 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257701 GeneID:637957
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to Ankyrin repeat domain-containing protein 26 transcript_id : XM_913790.3

name	Uqcrc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:92373414 GeneID:67003 MGI:1914253
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquinol cytochrome c reductase core protein 2 transcript_id : NM_025899.2

name	4930408O21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803541 GeneID:67983 MGI:1915233
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930408O21 gene transcript_id : NM_001040136.2

name	4930408O21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922700 GeneID:67983 MGI:1915233
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930408O21 gene transcript_id : NM_001040137.2

name	BC030336 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380955 GeneID:233812 MGI:2446240
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 68 ESTs, 2 Proteins product : cDNA sequence BC030336, transcript variant 1 transcript_id : XM_133786.9

name	E030013G06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117320532 GeneID:233813 MGI:3041229
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA E030013G06 gene transcript_id : NM_177697.3

name	EG436008 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257703 GeneID:436008 MGI:3645276
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : predicted gene, EG436008 transcript_id : XM_488079.5

name	LOC100043426 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257770 GeneID:100043426
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : hypothetical protein LOC100043426 transcript_id : XM_001479877.1

name	Eef2k (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131082 GeneID:13631 MGI:1195261
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic elongation factor-2 kinase transcript_id : NM_007908.3

name	Polr3e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981263 GeneID:26939 MGI:1349452
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polymerase (RNA) III (DNA directed) polypeptide E transcript_id : NM_025298.2

name	Cdr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6671729 GeneID:12585 MGI:1100885
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cerebellar degeneration-related 2 transcript_id : NM_007672.1

name	4933427G17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380961 GeneID:74466 MGI:1921716
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 2 Proteins product : RIKEN cDNA 4933427G17 gene, transcript variant 1 transcript_id : XM_133717.5

name	EG668548 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257772 GeneID:668548 MGI:3648545
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 23 mRNAs, 1964 ESTs, 55 Proteins product : predicted gene, EG668548 transcript_id : XM_001002180.2

name	Mettl9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328258 GeneID:59052 MGI:1914862
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : methyltransferase like 9 transcript_id : NM_021554.2

name	Igsf6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13540502 GeneID:80719 MGI:1891393
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : immunoglobulin superfamily, member 6 transcript_id : NM_030691.1

name	Otoa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21314861 GeneID:246190 MGI:2149209
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : otoancorin transcript_id : NM_139310.1

name	Hs3st2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486752 GeneID:195646 MGI:1333802
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : heparan sulfate (glucosamine) 3-O-sulfotransferase 2 transcript_id : NM_001081327.1

name	Usp31 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380970 GeneID:76179 MGI:1923429
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 103 ESTs, 4 Proteins product : ubiquitin specific peptidase 31 transcript_id : XM_357781.4

name	Scnn1g (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130196 GeneID:20278 MGI:104695
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sodium channel, nonvoltage-gated 1 gamma transcript_id : NM_011326.2

name	Scnn1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755411 GeneID:20277 MGI:104696
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sodium channel, nonvoltage-gated 1 beta transcript_id : NM_011325.1

name	Cog7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802214 GeneID:233824 MGI:2685013
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : component of oligomeric golgi complex 7 transcript_id : NM_001033318.3

name	Gga2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:131890064 GeneID:74105 MGI:1921355
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : golgi associated, gamma adaptin ear containing, ARF binding protein 2 transcript_id : NM_028758.2

name	LOC100043399 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257768 GeneID:100043399
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479837.1

name	LOC100043396 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257766 GeneID:100043396
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479831.1

name	Lyrm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313200 CCDS:CCDS21790.1 GeneID:73919 MGI:1921169
definition	codon_start : 1 product : LYR motif containing 1 protein_id : NP_083886.1

name	Dnahc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94381000 GeneID:381917 MGI:2683040
definition	codon_start : 1 note : overriding stop codons product : similar to axonemal heavy chain dynein type 3 protein_id : XP_355934.5 transl_except : (pos:complement(127221285..127221287),aa:OTHER)

name	Tmem159 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704178 CCDS:CCDS21791.1 GeneID:233806 MGI:1925752
definition	codon_start : 1 product : promethin protein_id : NP_663561.1

name	Zp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6756081 CCDS:CCDS21792.1 GeneID:22787 MGI:99214
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007339 - binding of sperm to zona pellucida [Evidence IDA]; GO:0007338 - fertilization (sensu Metazoa) [Evidence IEA] codon_start : 1 product : zona pellucida glycoprotein 2 protein_id : NP_035905.1

name	Anks4b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312472 CCDS:CCDS21793.1 GeneID:72074 MGI:1919324
definition	GO_component : GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] codon_start : 1 exception : mismatches in translation product : harmonin-interacting ankyrin-repeat containing protein_id : NP_082361.1

name	Crym (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7710012 CCDS:CCDS21794.1 GeneID:12971 MGI:102675
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0005212 - structural constituent of eye lens [Evidence IEA] GO_process : GO:0007423 - sensory organ development [Evidence IEA] codon_start : 1 product : crystallin, mu protein_id : NP_057878.1

name	Abca14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83745126 GeneID:67928 MGI:2388708
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016887 - ATPase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : ATP-binding cassette transporter sub-family A member 14 product : ATP-binding cassette, sub-family A (ABC1), member 14 protein_id : NP_080734.2

name	Abca15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46358378 GeneID:320631 MGI:2388709
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016887 - ATPase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 product : ATP-binding cassette transporter sub-family A member 15 protein_id : NP_796187.2

name	Abca16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46369473 GeneID:233810 MGI:2388711
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016887 - ATPase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : ATP-binding cassette transporter sub-family A member 16 protein_id : NP_997013.1

name	LOC546994 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257698 GeneID:546994
definition	codon_start : 1 product : similar to Ankyrin repeat domain-containing protein 26 protein_id : XP_001479104.1

name	E130201H02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257700 GeneID:78552 MGI:1925802
definition	codon_start : 1 product : hypothetical protein LOC78552 protein_id : XP_001479117.1

name	LOC637957 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257702 GeneID:637957
definition	codon_start : 1 product : similar to Ankyrin repeat domain-containing protein 26 protein_id : XP_918883.3

name	Uqcrc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22267442 CCDS:CCDS21795.1 GeneID:67003 MGI:1914253
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005746 - mitochondrial electron transport chain [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0004222 - metalloendopeptidase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0008121 - ubiquinol-cytochrome-c reductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : ubiquinol cytochrome c reductase core protein 2 protein_id : NP_080175.1

name	4930408O21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:92373388 GeneID:67983 MGI:1915233
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : hypothetical protein LOC67983 isoform 1 protein_id : NP_001035226.1

name	4930408O21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:92373125 GeneID:67983 MGI:1915233
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : hypothetical protein LOC67983 isoform 2 protein_id : NP_001035227.1

name	BC030336 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82907481 GeneID:233812 MGI:2446240
definition	codon_start : 1 product : hypothetical protein LOC233812 isoform 1 protein_id : XP_133786.6

name	E030013G06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117320533 GeneID:233813 MGI:3041229
definition	codon_start : 1 product : hypothetical protein LOC233813 protein_id : NP_808365.2

name	EG436008 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257704 GeneID:436008 MGI:3645276
definition	codon_start : 1 product : similar to NAD(P) dependent steroid dehydrogenase-like protein_id : XP_488079.5

name	LOC100043426 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257771 GeneID:100043426
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479927.1

name	Eef2k (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681275 CCDS:CCDS21796.1 GeneID:13631 MGI:1195261
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005488 - binding [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0003746 - translation elongation factor activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 product : eukaryotic elongation factor-2 kinase protein_id : NP_031934.1

name	Polr3e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981264 CCDS:CCDS21797.1 GeneID:26939 MGI:1349452
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003899 - DNA-directed RNA polymerase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : sex-lethal interactor homolog protein_id : NP_079574.2

name	Cdr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671730 CCDS:CCDS21798.1 GeneID:12585 MGI:1100885
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : cerebellar degeneration-related 2 protein_id : NP_031698.1

name	4933427G17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20843381 GeneID:74466 MGI:1921716
definition	codon_start : 1 product : hypothetical protein LOC74466 isoform 1 protein_id : XP_133717.1

name	EG668548 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257773 GeneID:668548 MGI:3648545
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001002180.2

name	Mettl9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328259 CCDS:CCDS21800.1 GeneID:59052 MGI:1914862
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 function : unknown product : methyltransferase like 9 protein_id : NP_067529.2

name	Igsf6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13540503 CCDS:CCDS21801.1 GeneID:80719 MGI:1891393
definition	codon_start : 1 function : cell surface receptor product : immunoglobulin superfamily, member 6 protein_id : NP_109616.1

name	Otoa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21314862 GeneID:246190 MGI:2149209
definition	GO_component : GO:0016324 - apical plasma membrane [Evidence IDA]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : otoancorin protein_id : NP_647471.1

name	Hs3st2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486753 GeneID:195646 MGI:1333802
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0008146 - sulfotransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : heparan sulfate D-glucosaminyl 3-O-sulfotransferase 2 protein_id : NP_001074796.1

name	Usp31 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82907597 GeneID:76179 MGI:1923429
definition	codon_start : 1 product : ubiquitin specific protease 31 protein_id : XP_357781.3

name	Scnn1g (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755414 CCDS:CCDS21803.1 GeneID:20278 MGI:104695
definition	GO_component : GO:0016021 - integral to membrane [Evidence IDA] [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015280 - amiloride-sensitive sodium channel activity [Evidence IDA] [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0005272 - sodium channel activity [Evidence IEA]; GO:0031402 - sodium ion binding [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0006814 - sodium ion transport [Evidence IDA] [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : ENaC gamma product : sodium channel, nonvoltage-gated 1 gamma protein_id : NP_035456.1

name	Scnn1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755412 CCDS:CCDS21804.1 GeneID:20277 MGI:104696
definition	GO_component : GO:0016021 - integral to membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015280 - amiloride-sensitive sodium channel activity [Evidence IDA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0005272 - sodium channel activity [Evidence IEA]; GO:0031402 - sodium ion binding [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0006814 - sodium ion transport [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : ENaC beta product : sodium channel, nonvoltage-gated 1 beta protein_id : NP_035455.1

name	Cog7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625631 CCDS:CCDS21805.1 GeneID:233824 MGI:2685013
definition	GO_component : GO:0005794 - Golgi apparatus [Evidence ISS] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : component of oligomeric golgi complex 7 protein_id : NP_001028490.2

name	Gga2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037347 GeneID:74105 MGI:1921355
definition	GO_component : GO:0030130 - clathrin coat of trans-Golgi network vesicle [Evidence IEA]; GO:0005802 - Golgi trans face [Evidence ISS]; GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0030306 - ADP-ribosylation factor binding [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0006461 - protein complex assembly [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : golgi associated, gamma adaptin ear containing, ARF binding protein 2 protein_id : NP_083034.1

name	LOC100042914 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042914
definition	number : 1 pseudo : _no_value

name	LOC100042914 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042914
definition	number : 2 pseudo : _no_value

name	LOC100042914 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042914
definition	number : 3 pseudo : _no_value

name	LOC100042914 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042914
definition	number : 4 pseudo : _no_value

name	LOC100042914 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042914
definition	number : 5 pseudo : _no_value

name	LOC668556 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668556
definition	number : 2 pseudo : _no_value

name	LOC668556 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668556
definition	number : 1 pseudo : _no_value

name	LOC668429 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149257769 GeneID:668429
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 29 ESTs, 4 Proteins product : similar to SEC14 and spectrin domains 1 pseudo : _no_value transcript_id : XR_034414.1

name	LOC668456 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149257774 GeneID:668456
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 7 Proteins product : similar to ribosomal protein L32 pseudo : _no_value transcript_id : XR_034452.1

clone name	MSMg01-202P17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-383D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-446L23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-050O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-161N20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-534A19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-212K13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-337M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-096E13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134D13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529B10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-430I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-496L12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-162J11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-111C20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-483A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-315O10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-322I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-473M13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-538E15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-327J05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-431F24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-161G19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-405A21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-106D23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-362K23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-353O13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-517C08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-339E09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052C19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354N23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-454J01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-438F17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-430I02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-353N23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-390B08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-206N21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392F07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340C11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-279F06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-298J07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-045F19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-110O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-203H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-320L24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-328P06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-523J20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-296A11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296A11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-067C17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-138O04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-120G11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-342P19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-236B09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-531P01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-545I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-509C01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-414A09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-267G10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-324N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-468P08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-540H12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-052N03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-533N16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-534O08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-270N09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-131G07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-513D02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-452D18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-445F02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-541K23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-481E05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-420I08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-173L08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-514P11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467N24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-419M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-122K23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-074E17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-342H04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-179H06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-443O21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-451E23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-316N02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-146B04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-124A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-399M01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-135D18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-158M05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-430K21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-328N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-177N15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-189F17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-520N15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-447L07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-021H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089A05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-281H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079H20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093A24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306A07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-273I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295I08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302P17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-301E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055F18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-320K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172K05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174I20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-096M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086H17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-027O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123C04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-176H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178A01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-195H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279L03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006J02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006P03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-104E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290N05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-143B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026H23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-048K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311N06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-286M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082O07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-061A11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016K13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233O07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198K01
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-296N17.b	B6Ng01-296N17.g
ACC	GA092361	GA092362
length	1,101	613
definition	B6Ng01-296N17.b	B6Ng01-296N17.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(128,135,534 - 128,136,634)	(128,016,877 - 128,017,487)
sequence	gaattcatgccaatcctcctgcctcaacctcctgggtaccatcagatctg tcttgttctttcttttctccttccattttctcagtctcttgagatgaatt ccactgtgcagtcagcctcagaaaagggaaaccatgcccaatgattaaag tgggttacagccatttagtcaaacattgacaactctcagctcatgaaagt atcatttatctagaaatgaagaatacattaaaacagctttgtatttcata tgttcttgtgggggattgaggaggaaggctgttgaattctgttggccata tttaggaaaagactatttactggctgaatatttagcttagtgggagcact aactacgcaaggccctaggtctaatccacagtactatgagagagcgaaag agtgagagagcaagaaagagagaaagagagagctattatttgacaaagaa cttgtatccggaatatacaaagtatttctgcaactcaatatatgaaggtt gactaatacaccaattaaaaagttgacaaaataattgaataaatgatgta ccaatacatctttaaatgactgaataaagcaaaaatatacattcaaagga agccatttacttcttccacagctttgcttatgcttatattcaaagccaaa tatttaaaactttgggctgtggagatggcttggcaccaaacctaaccacc tgagatcaatccctgggacctacatgagtagagagagaaatggggcctct aagctgtcttctgaccaccacagaccaccctgacacacacaaatatacac aatagtctaggcacagggctctcaatgtcagtttgctctacttagcaagt tccaggccagccaggactgtacagtgagacctatctcaaaacacacacat gcacacacacacacaaagtaagtaaataaaaaattttagaatacattttt taaaatgggcatgctgcttggctctcaacatgctcgtccgttgtcacttt tcatttgctctcccatcgtttctgtggagccctgtacagtgactggctct gactgtttgttttctatggagccctgtacatgactgggcctctgactctt a	gaattccatctcgaggacatcgccacagaacatgctactcggcacaggtc agcagtttgtcccaggggctttgaggagtccttgcgggagattggggtag ggggggacttggggtcctgcttctggtcaaagaaaaggaactaatatagc accccaatttcagattcttacagcctgtgggattgttagaagtagagaga tccaaccagttaagtctgtgtagacgttcaaaattggaagtaatctgaag tgtgaaaaacttttgattctaaatgttttagatggggagagggaggcagg gaaggtgcatctaggttccgtttgaagttggttgagaggtgggcagcttc tcagggcaagtcaggggtccacgttccttctgaactgtgacaccatcatc ccaacacttgtccttgcaaacaccagtagagacagacagtatcaagcagg ttttgacccctggtccaggtagcaacctcacttttcctttggctagcact cttgccctctccatcattcctgctctatccttcaaggagatggctgcaga gcctcctgtgtgcctccttcctactcaggaagcccacctctcagtgtggg gaaggatatgtca
quality values	Open. Hide. 62 47 24 22 62 41 30 47 49 62 37 25 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 59 56 51 38 34 43 49 46 33 31 44 62 59 59 62 42 54 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 59 59 62 62 54 54 49 62 62 59 62 62 62 62 62 62 62 62 54 54 59 59 62 62 62 62 62 62 59 62 59 59 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 54 42 54 62 62 62 49 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 54 54 54 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 54 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 62 62 62 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 54 58 58 58 58 38 42 58 58 58 58 58 58 58 58 58 58 52 58 52 54 58 58 43 52 58 49 58 58 58 58 58 58 58 54 58 58 58 54 54 54 54 54 43 46 54 58 54 58 58 58 58 58 58 54 52 46 58 51 46 54 51 51 54 54 54 52 58 51 52 53 52 49 49 50 58 58 51 51 49 48 51 51 51 53 54 49 51 49 51 53 58 51 58 41 33 58 58 51 44 25 28 46 50 54 39 34 58 47 50 51 51 49 50 58 54 51 58 58 58 51 51 58 50 52 58 58 39 39 33 54 58 50 51 40 58 33 50 39 47 51 37 50 30 42 50 41 37 43 25 42 29 44 43 46 51 51 25 41 39 38 37 44 51 40 50 49 50 38 22 18 26 14 42 45 42 53 39 52 39 38 24 51 52 41 54 39 54 39 50 40 41 54 44 37 27 27 27 51 49 52 53 52 49 33 47 31 42 41 47 37 40 52 53 32 41 44 35 31 47 38 52 45 40 40 45 26 22 26 51 52 36 42 42 33 31 31 27 32 47 40 47 40 40 21 53 53 53 34 41 31 51 31 53 30 47 33 40 31 32 37 35 33 25 40 32 25 32 32 37 49 40 31 33 28 31 31 36 32 34 33 25 26 31 38 51 51 33 31 29 30 32 31 32 33 44 30 31 28 30 21 43 42 36 33 31 31 31 31 43 31 31 25 28 43 41 28 29 27 11 15 31 31 18 26 41 31 37 20 37 42 34 25 13 30 27 34 31 27 35 32 35 46 46 35 27 21 28 22 31 27 31 23 38 38 32 27 39 25 32 23 31 25 22 16 32 21 31 8 41 30 28 26 31 31 34 29 24 44 27 26 18 41 41 43 41 24 29 44 44 18 19 19 25 29 10 18 24 24 38 47 43 43 44 32 28 44 44 31 24 24 44 21 18 32 31 33 32 21 21 30 22 18 22 27 24 23 22 13 14 14 25 21 13 18 33 30 13 20 11 18 25 12 22 11 14 4 4 4 15 18 18 26 19 25 17 20 21 29 21 20 11 6 6 6 9 40 18 11 21 20 5 9 24 11 23 8 27 9 27 10 21 15 22 11 12 5 8 8 11 18 11 10 9 19 28 27 20 21 25 5 8 8 5 7 24 20 20 6 5 27 8 23 5 26 26 11 9 3 4 14 22 5 6 3 3 20 12 12 10 7 12 12 4 7 7 5 14 16 11 16 24 9 8 10 10 12 11 8 9 10 14 4 20 4	Open. Hide. 62 59 43 59 62 62 47 43 62 62 56 35 23 28 28 32 46 28 27 40 32 54 62 59 59 62 62 59 59 62 62 62 62 62 62 54 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 56 48 48 43 48 49 43 62 62 62 62 62 62 62 59 59 62 62 59 59 62 62 62 62 62 62 62 62 62 54 54 54 59 59 62 62 62 54 54 62 62 62 62 62 62 62 62 62 54 54 62 62 54 49 49 49 56 59 59 62 62 56 62 62 62 62 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 59 62 59 59 56 56 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 56 54 62 59 59 62 62 56 56 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 56 59 59 59 59 59 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 56 62 62 62 62 59 46 59 43 35 43 62 59 59 62 51 59 43 51 51 43 56 46 50 36 38 56 46 50 59 46 40 50 56 51 56 59 59 48 48 56 59 62 46 36 36 48 23 50 30 38 38 56 43 38 50 43 43 38 56 30 30 30 18 10 18 38 45 36 46 13 12 12 13 10 12 59 46 43 28 46 44 43 51 51 51 49 51 18 18 18 12 18 13 56 46 44 46 28 14 11 17 13 13 18 34 18 36 34 23 46 50 56 40 38 29 16 16 15 11 18 23 34 19 24 16 23 21 16 28 24 28 30 23 34 28 23 15 16 24 11 34 18 30 44 30 39 46 51 34 51 51 26 30 14 12 17 14 30 34 20 59 39 30 22 35 56 59 44 43 45 51 44 44 43 31 37 35 25 17 16 20 20 19 41 39 32 56 56 47 56 35 51 51 56 62 42 42 32 32 26 14 38 56 39 51 42 37 36 18 31 43 39 34 11 31 39 38 22 36 42 56 31 39 42 51 27 19 32 40 39 30 33 37 32 37 22 39 24 37 34 33 38 19 24 27 21 15 22 16 9 21 21 20 33 22 38 42 39 17 12 40 24 26 28 19 27 38 31 32 22 27 21 24 18 18 22 16 20 22 19 19 13 27 20 20 27 14 13 10 27 20 25 22 25 29 13 13 12 17 17 13 16 14 17 6 17 28 17 22 14 17 11 14 32 23 28 28 13 22 14 29 22 17 18

Alignment Information

BAC End 1

BAC End 2

seq1: chr7_128135534_128136634
seq2: B6Ng01-296N17.b_49_1149 (reverse)

seq1  TAAGAGTCAGA-GCCCAGTCAATGTACAGGGCTCCATAG-AAACAAACAG  48
      ||||||||||| |||||||| |||||||||||||||||| ||||||||||
seq2  TAAGAGTCAGAGGCCCAGTC-ATGTACAGGGCTCCATAGAAAACAAACAG  49

seq1  TCAGAGCCCAGTCACTGTACAGGGCTCCACAGAAACGATGGGAGAGCAAA  98
      |||||| |||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGAG-CCAGTCACTGTACAGGGCTCCACAGAAACGATGGGAGAGCAAA  98

seq1  TGAAAAGTGAACAACGGACGAGCATGTTGAGAGCCAAGCAGCATG-CCAT  147
      ||||||||| ||||||||||||||||||||||||||||||||||| ||||
seq2  TGAAAAGTG-ACAACGGACGAGCATGTTGAGAGCCAAGCAGCATGCCCAT  147

seq1  TTTAAAAAATGTATTCTAAAATTTTTTATTTACTTACTTTGTGTGTGTGT  197
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTAAAAAATGTATTCTAAAATTTTTTATTTACTTACTTTGTGTGTGTGT  197

seq1  GTGCATGTGTGTGTTTTGAGATAGGTCTCACTGTACAGTCCTGGCTGGCC  247
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGCATGTGTGTGTTTTGAGATAGGTCTCACTGTACAGTCCTGGCTGGCC  247

seq1  TGGAACTTGCTAAGTAGAGCAAACTGACATTGAGAGCCCTGTGCCTAGAC  297
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGAACTTGCTAAGTAGAGCAAACTGACATTGAGAGCCCTGTGCCTAGAC  297

seq1  TATTGTGTATATTTGTGTGTGTCAGGGTGGTCTGTGGTGGTCAGAAGACA  347
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTGTGTATATTTGTGTGTGTCAGGGTGGTCTGTGGTGGTCAGAAGACA  347

seq1  GCTTAGAGGCCCCATTTCTCTCTCTACTCATGTAGGTCCCAGGGATTGAT  397
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTTAGAGGCCCCATTTCTCTCTCTACTCATGTAGGTCCCAGGGATTGAT  397

seq1  CTCAGGTGGTTAGGTTTGGTGCCAAGCCATCTCCACAGCCCAAAGTTTTA  447
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCAGGTGGTTAGGTTTGGTGCCAAGCCATCTCCACAGCCCAAAGTTTTA  447

seq1  AATATTTGGCTTTGAATATAAGCATAAGCAAAGCTGTGGAAGAAGTAAAT  497
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATATTTGGCTTTGAATATAAGCATAAGCAAAGCTGTGGAAGAAGTAAAT  497

seq1  GGCTTCCTTTGAATGTATATTTTTGCTTTATTCAGTCATTTAAAGATGTA  547
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCTTCCTTTGAATGTATATTTTTGCTTTATTCAGTCATTTAAAGATGTA  547

seq1  TTGGTACATCATTTATTCAATTATTTTGTCAACTTTTTAATTGGTGTATT  597
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGGTACATCATTTATTCAATTATTTTGTCAACTTTTTAATTGGTGTATT  597

seq1  AGTCAACCTTCATATATTGAGTTGCAGAAATACTTTGTATATTCCGGATA  647
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTCAACCTTCATATATTGAGTTGCAGAAATACTTTGTATATTCCGGATA  647

seq1  CAAGTTCTTTGTCAAATAATAGCTCTCTCTTTCTCTCTTTCTTGCTCTCT  697
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAGTTCTTTGTCAAATAATAGCTCTCTCTTTCTCTCTTTCTTGCTCTCT  697

seq1  CACTCTTTCGCTCTCTCATAGTACTGTGGATTAGACCTAGGGCCTTGCGT  747
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACTCTTTCGCTCTCTCATAGTACTGTGGATTAGACCTAGGGCCTTGCGT  747

seq1  AGTTAGTGCTCCCACTAAGCTAAATATTCAGCCAGTAAATAGTCTTTTCC  797
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTAGTGCTCCCACTAAGCTAAATATTCAGCCAGTAAATAGTCTTTTCC  797

seq1  TAAATATGGCCAACAGAATTCAACAGCCTTCCTCCTCAATCCCCCACAAG  847
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAATATGGCCAACAGAATTCAACAGCCTTCCTCCTCAATCCCCCACAAG  847

seq1  AACATATGAAATACAAAGCTGTTTTAATGTATTCTTCATTTCTAGATAAA  897
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACATATGAAATACAAAGCTGTTTTAATGTATTCTTCATTTCTAGATAAA  897

seq1  TGATACTTTCATGAGCTGAGAGTTGTCAATGTTTGACTAAATGGCTGTAA  947
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGATACTTTCATGAGCTGAGAGTTGTCAATGTTTGACTAAATGGCTGTAA  947

seq1  CCCACTTTAATCATTGGGCATGGTTTCCCTTTTCTGAGGCTGACTGCACA  997
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCACTTTAATCATTGGGCATGGTTTCCCTTTTCTGAGGCTGACTGCACA  997

seq1  GTGGAATTCATCTCAAGAGACTGAGAAAATGGAAGGAGAAAAGAAAGAAC  1047
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGGAATTCATCTCAAGAGACTGAGAAAATGGAAGGAGAAAAGAAAGAAC  1047

seq1  AAGACAGATCTGATGGTACCCAGGAGGTTGAGGCAGGAGGATTGGCATGA  1097
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGACAGATCTGATGGTACCCAGGAGGTTGAGGCAGGAGGATTGGCATGA  1097

seq1  ATTC  1101
      ||||
seq2  ATTC  1101

seq1: chr7_128016877_128017487
seq2: B6Ng01-296N17.g_69_681

seq1  GAATTCCATCTCGAGGACATCGCCACAGAACATGCTACTCGGCACAGGTC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCATCTCGAGGACATCGCCACAGAACATGCTACTCGGCACAGGTC  50

seq1  AGCAGTTTGTCCCAGGGGCTTTGAGGAGTCCTTGCGGGAGATTGGGGTAG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCAGTTTGTCCCAGGGGCTTTGAGGAGTCCTTGCGGGAGATTGGGGTAG  100

seq1  GGGGGGACTTGGGGTCCTGCTTCTGGTCAAAGAAAAGGAACTAATATAGC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGGGGACTTGGGGTCCTGCTTCTGGTCAAAGAAAAGGAACTAATATAGC  150

seq1  ACCCCAATTTCAGATTCTTACAGCCTGTGGGATTGTTAGAAGTAGAGAGA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCCCAATTTCAGATTCTTACAGCCTGTGGGATTGTTAGAAGTAGAGAGA  200

seq1  TCCAACCAGTTAAGTCTGTGTAGACGTTCAAAATTGGAAGTAATCTGAAG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCAACCAGTTAAGTCTGTGTAGACGTTCAAAATTGGAAGTAATCTGAAG  250

seq1  TGTGAAAAACTTTTGATTCTAAATGTTTTAGATGGGGAGAGGGAGGCAGG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGAAAAACTTTTGATTCTAAATGTTTTAGATGGGGAGAGGGAGGCAGG  300

seq1  GAAGGTGCATCTAGGTTCCGTTTGAAGTTGGTTGAGAGGTGGGCAGCTTC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAGGTGCATCTAGGTTCCGTTTGAAGTTGGTTGAGAGGTGGGCAGCTTC  350

seq1  TCAGGGCAAGTCAGGGGTCCACGTTCCTTCTGAACTGTGACACCATCATC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGGGCAAGTCAGGGGTCCACGTTCCTTCTGAACTGTGACACCATCATC  400

seq1  CCAACACTTGTCCTTGCAAACACCAGTAGAGACAGACAGTATCAAGCAGG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAACACTTGTCCTTGCAAACACCAGTAGAGACAGACAGTATCAAGCAGG  450

seq1  TTTTGACCCCTGGTCCAGGTAGCAACCTCACTTTTCC-TTGGCTAGCACT  499
      ||||||||||||||||||||||||||||||||||||| ||||||||||||
seq2  TTTTGACCCCTGGTCCAGGTAGCAACCTCACTTTTCCTTTGGCTAGCACT  500

seq1  C-TGCCCTCTCCATCATTCCTGCTCTATCCTTCAAGGAGATGGCTGCAGA  548
      | ||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTGCCCTCTCCATCATTCCTGCTCTATCCTTCAAGGAGATGGCTGCAGA  550

seq1  GCCTCCTGTGTGCCTCCTTCCTACTCAGGAAGCCCACCTCTCAGTGTGGG  598
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCTCCTGTGTGCCTCCTTCCTACTCAGGAAGCCCACCTCTCAGTGTGGG  600

seq1  GAAGGATAGGTCA  611
      |||||||| ||||
seq2  GAAGGATATGTCA  613

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information