MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-320D22
Chromosome	7 (Build37)
Map Location	105,856,231 - 105,959,481
singlet/doublet	doublet
Overlap gene	Prkrir
Upstream gene	Clns1a, Aqp11, LOC100040594, Pak1, Gdpd4, Myo7a, Capn5, Omp, B3gnt6, Phca, Tsku, LOC100040269, Gucy2d, LOC100040721, EG434215, A630091E08Rik, 2210018M11Rik, LOC100040769
Downstream gene	Wnt11, LOC666978, Uvrag, EG666529, Dgat2, Mogat2, Mtap6, Serpinh1, Gdpd5, 2810406K13Rik, Rps3, Rnu15-b, EG449630, Arrb1, EG245190, Slco2b1, Olfr520, Olfr521
Link	Open Mouse BAC browser

Click to get alignment info.

name	Clns1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12729 MGI:109638
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aqp11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66333 MGI:1913583
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040594 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040594
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins pseudo : _no_value

name	Pak1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18479 MGI:1339975
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gdpd4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233537 MGI:3606573
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Myo7a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17921 MGI:104510
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Capn5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12337 MGI:1100859
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Omp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18378 MGI:97436
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	B3gnt6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:272411 MGI:3039603
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Phca (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66190 MGI:1913440
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tsku (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244152 MGI:2443855
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040269 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040269
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Gucy2d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14918 MGI:106030
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins

name	LOC100040721 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040721
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 13 ESTs, 2 Proteins pseudo : _no_value

name	EG434215 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434215 MGI:3647721
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 3 Proteins

name	A630091E08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233544 MGI:2442837
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 4 ESTs

name	2210018M11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233545 MGI:1924203
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040769 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040769
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Prkrir (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72981 MGI:1920231
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wnt11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22411 MGI:101948
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666978 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666978
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Uvrag (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78610 MGI:1925860
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG666529 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666529 MGI:3647698
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Dgat2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67800 MGI:1915050
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mogat2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233549 MGI:2663253
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mtap6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17760 MGI:1201690
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Serpinh1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12406 MGI:88283
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gdpd5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233552 MGI:2686926
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2810406K13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72184 MGI:1919434
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs, 27 Proteins

name	Rps3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27050 MGI:1350917
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnu15-b (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:449631
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG449630 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:449630 MGI:3645887
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arrb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109689 MGI:99473
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	EG245190 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245190 MGI:3646425
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 18 ESTs, 5 Proteins

name	Slco2b1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:101488 MGI:1351872
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr520 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259066 MGI:3030354
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr521 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258353 MGI:3030355
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Clns1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19263323 GeneID:12729 MGI:109638
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chloride channel, nucleotide-sensitive, 1A transcript_id : NM_023671.1

name	Aqp11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384133 GeneID:66333 MGI:1913583
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aquaporin 11 transcript_id : NM_175105.3

name	Pak1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112181193 GeneID:18479 MGI:1339975
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : p21 (CDKN1A)-activated kinase 1 transcript_id : NM_011035.2

name	Gdpd4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31343271 GeneID:233537 MGI:3606573
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glycerophosphodiester phosphodiesterase domain containing 4 transcript_id : NM_177696.2

name	Myo7a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115511009 GeneID:17921 MGI:104510
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myosin VIIa transcript_id : NM_008663.2

name	Capn5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131211 GeneID:12337 MGI:1100859
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calpain 5 transcript_id : NM_007602.3

name	Omp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:55926142 GeneID:18378 MGI:97436
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory marker protein transcript_id : NM_011010.2

name	B3gnt6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487188 GeneID:272411 MGI:3039603
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 (core 3 synthase) transcript_id : NM_001081167.1

name	Phca (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84794580 GeneID:66190 MGI:1913440
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phytoceramidase, alkaline transcript_id : NM_025408.2

name	Tsku (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922721 GeneID:244152 MGI:2443855
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tsukushin transcript_id : NM_001024619.2

name	LOC100040269 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257593 GeneID:100040269
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to Ubtf protein transcript_id : XM_001474384.1

name	Gucy2d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257595 GeneID:14918 MGI:106030
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins product : guanylate cyclase 2d transcript_id : XM_001474410.1

name	EG434215 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380875 GeneID:434215 MGI:3647721
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 3 Proteins product : predicted gene, EG434215 transcript_id : XM_485967.3

name	2210018M11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124249083 GeneID:233545 MGI:1924203
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2210018M11 gene transcript_id : NM_172280.2

name	LOC100040769 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257613 GeneID:100040769
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100040769 transcript_id : XM_001474991.1

name	Prkrir (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33469018 GeneID:72981 MGI:1920231
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor) transcript_id : NM_028410.1

name	Wnt11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678588 GeneID:22411 MGI:101948
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : wingless-related MMTV integration site 11 transcript_id : NM_009519.1

name	Uvrag (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982283 GeneID:78610 MGI:1925860
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UV radiation resistance associated gene transcript_id : NM_178635.2

name	EG666529 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257616 GeneID:666529 MGI:3647698
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : predicted gene, EG666529, transcript variant 1 transcript_id : XM_001475155.1

name	EG666529 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380843 GeneID:666529 MGI:3647698
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG666529, transcript variant 2 transcript_id : XM_990504.1

name	Dgat2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129808 GeneID:67800 MGI:1915050
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : diacylglycerol O-acyltransferase 2 transcript_id : NM_026384.3

name	Mogat2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328427 GeneID:233549 MGI:2663253
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : monoacylglycerol O-acyltransferase 2 transcript_id : NM_177448.3

name	Mtap6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113204612 GeneID:17760 MGI:1201690
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : microtubule-associated protein 6 transcript_id : NM_010837.3

name	Mtap6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114520591 GeneID:17760 MGI:1201690
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : microtubule-associated protein 6 transcript_id : NM_001048167.1

name	Mtap6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114520593 GeneID:17760 MGI:1201690
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : microtubule-associated protein 6 transcript_id : NM_001043355.2

name	Serpinh1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753303 GeneID:12406 MGI:88283
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade H, member 1 transcript_id : NM_009825.1

name	Gdpd5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:52345430 GeneID:233552 MGI:2686926
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glycerophosphodiester phosphodiesterase domain containing 5 transcript_id : NM_201352.2

name	2810406K13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380877 GeneID:72184 MGI:1919434
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs, 27 Proteins product : RIKEN cDNA 2810406K13 gene, transcript variant 1 transcript_id : XM_133597.5

name	Rps3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115270974 GeneID:27050 MGI:1350917
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein S3 transcript_id : NM_012052.2

name	Arrb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:79750059 GeneID:109689 MGI:99473
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : arrestin, beta 1 transcript_id : NM_177231.2

name	Arrb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:79750060 GeneID:109689 MGI:99473
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : arrestin, beta 1 transcript_id : NM_178220.3

name	EG245190 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380878 GeneID:245190 MGI:3646425
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 18 ESTs, 5 Proteins product : predicted gene, EG245190 transcript_id : XM_486328.4

name	Slco2b1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378388 GeneID:101488 MGI:1351872
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier organic anion transporter family, member 2b1 transcript_id : NM_175316.3

name	Olfr520 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128832 GeneID:259066 MGI:3030354
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 520 transcript_id : NM_147063.1

name	Olfr521 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129586 GeneID:258353 MGI:3030355
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 521 transcript_id : NM_146356.1

name	Clns1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19263324 CCDS:CCDS21462.1 GeneID:12729 MGI:109638
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006821 - chloride transport [Evidence IEA]; GO:0006884 - regulation of cell volume [Evidence IEA] codon_start : 1 note : chloride channel current inducer; chloride channel regulator product : chloride channel, nucleotide-sensitive, 1A protein_id : NP_076160.1

name	Aqp11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30039716 CCDS:CCDS21463.1 GeneID:66333 MGI:1913583
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0019867 - outer membrane [Evidence IEA] GO_function : GO:0008233 - peptidase activity [Evidence IEA]; GO:0015288 - porin activity [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : aquaporin 11 protein_id : NP_780314.1

name	Pak1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112181194 CCDS:CCDS21464.1 GeneID:18479 MGI:1339975
definition	GO_component : GO:0030424 - axon [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0005925 - focal adhesion [Evidence TAS]; GO:0030426 - growth cone [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IDA] [Evidence TAS]; GO:0004674 - protein serine/threonine kinase activity [Evidence ISS] [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0016358 - dendrite development [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : activated protein kinase alpha; Cdc42/Rac effector kinase product : p21 (CDKN1A)-activated kinase 1 protein_id : NP_035165.2

name	Gdpd4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244142 GeneID:233537 MGI:3606573
definition	GO_function : GO:0008889 - glycerophosphodiester phosphodiesterase activity [Evidence IEA] GO_process : GO:0006071 - glycerol metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : glycerophosphodiester phosphodiesterase domain containing 4 protein_id : NP_808364.1

name	Myo7a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115511010 GeneID:17921 MGI:104510
definition	GO_component : GO:0016324 - apical plasma membrane [Evidence IDA]; GO:0005929 - cilium [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA] [Evidence ISS]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0042470 - melanosome [Evidence IDA]; GO:0005902 - microvillus [Evidence ISS]; GO:0016459 - myosin [Evidence IEA]; GO:0045202 - synapse [Evidence IDA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0005488 - binding [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0003774 - motor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0042491 - auditory receptor cell differentiation [Evidence IMP]; GO:0030030 - cell projection organization and biogenesis [Evidence IMP]; GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA]; GO:0035315 - hair cell differentiation [Evidence IMP]; GO:0048839 - inner ear development [Evidence IMP]; GO:0042472 - inner ear morphogenesis [Evidence IMP]; GO:0006909 - phagocytosis [Evidence IMP]; GO:0001845 - phagolysosome formation [Evidence IMP]; GO:0051875 - pigment granule localization [Evidence IMP]; GO:0051904 - pigment granule transport [Evidence IMP]; GO:0048563 - post-embryonic organ morphogenesis [Evidence IMP]; GO:0035058 - sensory cilium biogenesis [Evidence IMP]; GO:0007600 - sensory perception [Evidence IMP]; GO:0050953 - sensory perception of light stimulus [Evidence IMP]; GO:0007605 - sensory perception of sound [Evidence ISS] [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA]; GO:0007601 - visual perception [Evidence IMP] codon_start : 1 note : shaker 1; motor protein product : myosin VIIa protein_id : NP_032689.2

name	Capn5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680846 CCDS:CCDS21465.1 GeneID:12337 MGI:1100859
definition	GO_function : GO:0004198 - calpain activity [Evidence IEA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] codon_start : 1 product : calpain 5 protein_id : NP_031628.1

name	Omp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754936 CCDS:CCDS21466.1 GeneID:18378 MGI:97436
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005829 - cytosol [Evidence TAS]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence ISS]; GO:0004871 - signal transducer activity [Evidence IMP] GO_process : GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IMP] codon_start : 1 product : olfactory marker protein protein_id : NP_035140.1

name	B3gnt6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487189 GeneID:272411 MGI:3039603
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008378 - galactosyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0006486 - protein amino acid glycosylation [Evidence IEA] codon_start : 1 product : UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 (core 3 synthase) protein_id : NP_001074636.1

name	Phca (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84794581 CCDS:CCDS21468.1 GeneID:66190 MGI:1913440
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005789 - endoplasmic reticulum membrane [Evidence IEA]; GO:0000139 - Golgi membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016811 - hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in linear amides [Evidence IEA] GO_process : GO:0006672 - ceramide metabolism [Evidence IEA] codon_start : 1 product : phytoceramidase, alkaline protein_id : NP_079684.2

name	Tsku (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67972425 CCDS:CCDS21469.1 GeneID:244152 MGI:2443855
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : leucine rich repeat containing 54 product : tsukushi protein_id : NP_001019790.1

name	LOC100040269 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257594 GeneID:100040269
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474434.1

name	Gucy2d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257596 GeneID:14918 MGI:106030
definition	codon_start : 1 product : guanylate cyclase 2d protein_id : XP_001474460.1

name	EG434215 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94380876 GeneID:434215 MGI:3647721
definition	codon_start : 1 product : hypothetical protein protein_id : XP_485967.3

name	2210018M11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124249084 GeneID:233545 MGI:1924203
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0006281 - DNA repair [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : EMSY protein protein_id : NP_758484.2

name	LOC100040769 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257614 GeneID:100040769
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475041.1

name	Prkrir (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33469019 CCDS:CCDS21474.1 GeneID:72981 MGI:1920231
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0046983 - protein dimerization activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : interferon-inducible, double stranded RNA dependent inhibitor, protein-kinase protein_id : NP_082686.1

name	Wnt11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678589 CCDS:CCDS21475.1 GeneID:22411 MGI:101948
definition	GO_function : GO:0005102 - receptor binding [Evidence TAS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007267 - cell-cell signaling [Evidence TAS]; GO:0007275 - development [Evidence IEA]; GO:0007223 - frizzled-2 signaling pathway [Evidence IEA]; GO:0009887 - organ morphogenesis [Evidence TAS]; GO:0007165 - signal transduction [Evidence TAS]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 product : wingless-related MMTV integration site 11 protein_id : NP_033545.1

name	Uvrag (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982284 CCDS:CCDS21476.1 GeneID:78610 MGI:1925860
definition	codon_start : 1 exception : mismatches in translation product : UV radiation resistance associated protein_id : NP_848750.2

name	EG666529 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94380844 GeneID:666529 MGI:3647698
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_995598.1

name	EG666529 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257617 GeneID:666529 MGI:3647698
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001475205.1

name	Dgat2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16975490 CCDS:CCDS21477.1 GeneID:67800 MGI:1915050
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence ISS] [Evidence IDA] GO_function : GO:0003846 - 2-acylglycerol O-acyltransferase activity [Evidence IDA]; GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0004144 - diacylglycerol O-acyltransferase activity [Evidence IDA] [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006071 - glycerol metabolism [Evidence IEA]; GO:0008610 - lipid biosynthesis [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0019432 - triacylglycerol biosynthesis [Evidence ISS] [Evidence IMP] [Evidence IDA] codon_start : 1 note : diacylglycerol acyltransferase 2 product : diacylglycerol O-acyltransferase 2 protein_id : NP_080660.1

name	Mogat2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28974982 CCDS:CCDS21478.1 GeneID:233549 MGI:2663253
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence ISS] [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003846 - 2-acylglycerol O-acyltransferase activity [Evidence ISS] [Evidence IDA]; GO:0016407 - acetyltransferase activity [Evidence IDA]; GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006651 - diacylglycerol biosynthesis [Evidence IDA]; GO:0006071 - glycerol metabolism [Evidence IEA]; GO:0050892 - intestinal absorption [Evidence IDA]; GO:0008610 - lipid biosynthesis [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IDA]; GO:0046462 - monoacylglycerol metabolism [Evidence ISS]; GO:0019432 - triacylglycerol biosynthesis [Evidence IDA] codon_start : 1 note : acyl CoA:monoacylglycerol acyltransferase 2; mannoside acetylglucosaminyltransferase 1-like product : monoacylglycerol O-acyltransferase 2 protein_id : NP_803231.1

name	Mtap6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113204613 CCDS:CCDS21479.1 GeneID:17760 MGI:1201690
definition	GO_component : GO:0005875 - microtubule associated complex [Evidence IEA] GO_function : GO:0005519 - cytoskeletal regulatory protein binding [Evidence IEA] GO_process : GO:0007017 - microtubule-based process [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : microtubule-associated protein 6 isoform 1 protein_id : NP_034967.2

name	Mtap6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114520592 GeneID:17760 MGI:1201690
definition	GO_component : GO:0005875 - microtubule associated complex [Evidence IEA] GO_function : GO:0005519 - cytoskeletal regulatory protein binding [Evidence IEA] GO_process : GO:0007017 - microtubule-based process [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : microtubule-associated protein 6 isoform 2 protein_id : NP_001041632.1

name	Mtap6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114520594 GeneID:17760 MGI:1201690
definition	GO_component : GO:0005875 - microtubule associated complex [Evidence IEA] GO_function : GO:0005519 - cytoskeletal regulatory protein binding [Evidence IEA] GO_process : GO:0007017 - microtubule-based process [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3 product : microtubule-associated protein 6 isoform 3 protein_id : NP_001036820.2

name	Serpinh1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753304 CCDS:CCDS21480.1 GeneID:12406 MGI:88283
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA]; GO:0051082 - unfolded protein binding [Evidence IDA] GO_process : GO:0006457 - protein folding [Evidence IEA]; GO:0009408 - response to heat [Evidence IEA]; GO:0006986 - response to unfolded protein [Evidence IEA] codon_start : 1 exception : mismatches in translation note : collagen binding protein 1; serine (or cysteine) proteinase inhibitor, clade H (heat shock protein 47), member 1; serine (or cysteine) proteinase inhibitor, clade H (heat shock protein 47), member 2; beta enolase repressor factor 1; serine (or cysteine) proteinase inhibitor, clade H, member 2 product : serine (or cysteine) proteinase inhibitor, clade H, member 1 protein_id : NP_033955.1

name	Gdpd5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:52345431 CCDS:CCDS21481.1 GeneID:233552 MGI:2686926
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0008889 - glycerophosphodiester phosphodiesterase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006071 - glycerol metabolism [Evidence IEA] codon_start : 1 product : glycerophosphodiester phosphodiesterase domain containing 5 protein_id : NP_958740.2

name	2810406K13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82907178 GeneID:72184 MGI:1919434
definition	codon_start : 1 product : hypothetical protein LOC72184 isoform 1 protein_id : XP_133597.3

name	Rps3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755372 GeneID:27050 MGI:1350917
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0015935 - small ribosomal subunit [Evidence IEA] GO_function : GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 product : ribosomal protein S3 protein_id : NP_036182.1

name	Arrb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30089716 GeneID:109689 MGI:99473
definition	GO_component : GO:0005622 - intracellular [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008277 - regulation of G-protein coupled receptor protein signaling pathway [Evidence IMP]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007600 - sensory perception [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform A is encoded by transcript variant a; arrestin, beta 1, isoform B; beta-arrestin1 product : arrestin, beta 1 isoform A protein_id : NP_796205.1

name	Arrb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30089688 CCDS:CCDS21484.1 GeneID:109689 MGI:99473
definition	GO_component : GO:0005622 - intracellular [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008277 - regulation of G-protein coupled receptor protein signaling pathway [Evidence IMP]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007600 - sensory perception [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform B is encoded by transcript variant b; arrestin, beta 1, isoform B; beta-arrestin1 product : arrestin, beta 1 isoform B protein_id : NP_835738.1

name	EG245190 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51829389 GeneID:245190 MGI:3646425
definition	codon_start : 1 product : similar to hCG1820409 protein_id : XP_486328.1

name	Slco2b1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789421 CCDS:CCDS21485.1 GeneID:101488 MGI:1351872
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA] codon_start : 1 note : solute carrier family 21 (organic anion transporter), member 9 product : solute carrier organic anion transporter family, member 2b1 protein_id : NP_780525.1

name	Olfr520 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128833 CCDS:CCDS21486.1 GeneID:259066 MGI:3030354
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-2411789-2412739; olfactory receptor MOR101-1 product : olfactory receptor 520 protein_id : NP_667274.1

name	Olfr521 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129587 CCDS:CCDS21487.1 GeneID:258353 MGI:3030355
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-2443810-2444775; olfactory receptor MOR101-2 product : olfactory receptor 521 protein_id : NP_666468.1

name	LOC666978 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666978
definition	number : 3 pseudo : _no_value

name	LOC666978 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666978
definition	number : 2 pseudo : _no_value

name	LOC666978 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666978
definition	number : 1 pseudo : _no_value

name	LOC100040594 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149257607 GeneID:100040594
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : similar to hCG23490 pseudo : _no_value transcript_id : XR_031892.1

name	LOC100040721 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149257611 GeneID:100040721
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 13 ESTs, 2 Proteins product : similar to LSM6 homolog, U6 small nuclear RNA associated pseudo : _no_value transcript_id : XR_031994.1

name	A630091E08Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149257612 GeneID:233544 MGI:2442837
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 4 ESTs product : RIKEN cDNA A630091E08 gene transcript_id : XR_035257.1

name	Rnu15-b (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:54111254 GeneID:449631
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA, U15b small nucleolar transcript_id : NR_002173.1

name	EG449630 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:54111252 GeneID:449630 MGI:3645887
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG449630 transcript_id : NR_002172.1

clone name	MSMg01-358I24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-445A14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-052O18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-486G09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-524I09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-356P23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-425P05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-277I03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-331D11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-066N14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-064J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-145L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-116C16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-193L06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-439B17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-445K16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-153E23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-158M19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-394A05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-452O13
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-093I11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-407L08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-180D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-118B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-494P13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-492L11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-176C04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-423I12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-085O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-279D06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-393K16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-437M24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-111L12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-408F21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-474D15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-539K20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-489N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-420J11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-121D18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-405E02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449G16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-213G04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-305F06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-541H04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-510E17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-431M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-339O17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-546P16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-351J07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-414D24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-356O11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-195E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-482G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-066G04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-158A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134A05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-057M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-084K17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-098G07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-117O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-329K10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-380N07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-444O14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-338H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-468F02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-491E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-358A05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-271B16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-128J13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-085C03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-263G09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-121G13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-448A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-337K02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-102O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-116O04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-105M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-333C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-358G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-297B24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-494M04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-455K23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-363N02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-433A13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-473A02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-164P06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-175E16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-426F08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-464B10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-055A05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-541M01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159A16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-358M14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-377J11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-150C14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-376K04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-449K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159N01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-315N21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-081C18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-508I23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-512P20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-502M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-211I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-140L24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-536O09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-362K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-177N16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352F02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-055L12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-493A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-205K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094G01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160P07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163E10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-107J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115C16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-112I24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109L18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331K07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-204D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-338J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274G24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325K16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-217F13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-338J03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-155M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-058D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157B13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-076G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190J15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172C18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-202O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288A23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322E17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-334F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104G17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-218L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228K22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316A05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240L15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324C18
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-320D22.b	B6Ng01-320D22.g
ACC	GA109664	GA109665
length	1,100	699
definition	B6Ng01-320D22.b	B6Ng01-320D22.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(105,856,231 - 105,857,521)	(105,958,791 - 105,959,481)
sequence	gaattctgttattactatgattcataaaagccagtgccaggcagatttga ttgacatgtatgaaccactatagaaactaataaggaagagctttgtaaat ccttagtgttcttactttagtataactaacattttatgttaggtttggta tagaaataaacttaaaggtacactatatattactgtgcagcaatttattt taatattttttttcagatgcattttgcagaggcatcagaaaactaaagaa tgattgggttattttatttctcaatattaattgaagcagatacttgtgaa gtcattgggaggtgagccaattctggttcaacaatttaatcacaaatact tgagggatttttttatttttttatttttttgccttgttttattacaagtc taatactcttcagtccaaaagtctcatatgtgtaaaaggcaaactacttt tgtgttcttgacattcagtaaaaatatcacaaatcattttaaaatataca agccttgctttttattttagtatagtaaatatctcttaattttattgaga gataatttcaatgagattaatttgaaattttaagatatagctcactattg tagctgactttattcagcgtatatatcagaaagattagctagttttgttt ttcccaaaagattctttcatcttatataaattaacccaaatgtgggaaaa ttttttttctaaatgtgtagaacaagcagatgttgaaagccagcttgtac gataattgtattaaaatatgtaagccctttggcttcattagtttggcatt taagatcttgttaacatacatgagtagttctgccaaaaccacaattttta ttatctttgatgctagagtaagatcagtgttgttcctttaaattgccaaa gagtaaaccttggtatggagttaaaattgttcatgtgagttagatacatc ttttgacatatgtatttatacattaatatagaatgtcccagttttcattc acagtctagtttttcttatctttgctttgactgctagattaaatttttaa ttgtttagatatctatccctcccctcatcacccagcttttgatggtgact	gaattctcttggtgtggaggctagaccccatccttcaagggatgcaggat gaggaagcacagaccatgaaggctaagagagttgggtgtgggtctgggtg tcccaggtttccagccacacccgccagccaaactggacaagacaaccaca agacagctggcctggctgctggtgctgcttggggggaggagatgcaagag cagccatgggtggcatgagtagccattctgggcggaagaaccagctgatg atccaagagtgtggagggatccagaagagagactgagagtagctgcatgt tgggcaccaaggacctagagagagaaagtggagagctggacataaggctt agctcggggaggggcagcagactggctggtgctatcttctccaacgatgc aatcctaaatgtcaaaatcccaaggataaaactccaaattataaaattcc cagagaccaaatctccaaggtgtagttccataggtgtgtggaggggggat ggtcattgtaaagctttctttacaggatttctgcgcgtggaacaatggag ggattgtgtcttttggattttaggatgagcagaggcagcagcatgcagag tgcgggagaagaatccatttgaattttgttctcctatgggaaagggagag aacccaaaagtcccccaggactttgatgtgaggaggggcagaaaggaga
quality values	Open. Hide. 58 34 27 31 62 62 47 47 62 47 56 41 47 62 62 54 54 62 62 35 47 62 41 32 62 62 62 62 62 62 43 43 39 28 28 38 28 29 38 50 54 56 56 56 59 59 62 62 62 59 54 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 42 54 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 37 38 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 62 62 62 62 62 62 62 54 54 58 58 58 58 58 58 58 58 58 58 47 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 46 58 58 58 58 58 54 54 58 58 58 58 54 45 45 54 58 58 54 58 58 58 58 58 58 58 58 58 58 54 58 54 58 50 51 53 58 58 58 58 53 51 58 51 58 58 58 58 51 58 58 58 58 58 58 40 58 58 58 51 49 58 53 53 51 58 58 46 49 51 51 51 54 58 51 46 52 58 58 58 50 53 33 50 51 50 58 58 52 52 52 58 58 58 58 49 58 58 51 48 32 41 31 33 50 58 50 38 46 33 51 52 58 58 50 49 39 51 50 49 49 49 50 52 52 40 58 40 52 50 52 50 50 51 46 40 44 44 49 54 34 54 54 51 50 54 54 35 29 49 49 49 49 36 49 44 45 41 28 54 40 50 54 53 54 40 52 37 51 34 35 49 41 49 41 45 28 51 32 51 40 44 41 45 54 45 40 38 39 32 42 46 54 35 51 40 31 36 31 53 31 33 45 42 51 52 31 37 37 37 45 54 54 52 45 32 34 41 32 45 46 32 41 32 31 36 49 31 40 49 36 49 49 32 31 42 42 32 32 53 53 32 40 46 31 27 35 53 34 39 42 26 33 27 42 51 31 51 23 31 30 46 25 23 45 31 45 26 31 31 51 31 32 31 31 31 29 30 31 30 15 16 9 45 30 22 11 31 24 31 19 27 31 46 47 46 31 36 29 31 36 30 19 31 47 34 31 37 31 42 29 36 38 31 41 32 32 30 22 21 33 19 31 31 31 32 39 31 35 39 38 8 23 31 20 47 39 25 48 36 31 32 31 19 19 21 39 39 24 37 23 31 31 41 31 19 15 20 28 39 36 29 27 32 29 30 26 23 28 22 31 48 48 33 13 30 38 25 33 30 25 28 26 13 19 33 24 29 17 27 24 20 12 19 10 13 11 25 25 44 44 23 21 23 23 15 30 31 25 31 27 21 21 43 20 23 32 28 32 17 21 25 8 25 13 17 19 25 21 20 30 23 31 20 29 30 19 19 24 33 47 47 29 31 15 15 20 27 14 19 14 32 27 28 19 27 10 24 34 47 38 24 12 20 8 15 11 16 15 34 28 28 20 11 47 22 22 24 27 20 28 22 13 10 17 28 17 21 5 31 12 3 47 31 40 16 4 5 6 7 9 5 28 15 12 7 24 4 8 9 7 17 6 10 18 28 11 13 8 25 28 5 15 10 3 2 6 16 16 28 21 13 6 11 3 25 28 17 18 26 5 6 3 13 12 15 17 5	Open. Hide. 62 47 42 39 62 62 62 62 62 56 56 44 27 38 50 43 32 29 44 43 44 59 62 59 59 59 62 62 62 59 62 62 62 62 62 59 62 62 62 62 54 54 59 62 62 62 62 62 54 59 62 59 59 62 59 62 62 62 62 62 62 59 59 62 62 59 62 59 59 62 62 62 62 59 62 62 62 54 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 54 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 54 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 59 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 43 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 47 49 49 62 62 62 54 47 62 54 51 51 42 44 51 56 42 32 38 37 31 31 39 38 51 51 42 51 51 31 51 33 32 51 56 32 56 47 56 51 51 51 23 51 30 37 38 31 43 56 38 32 26 43 56 41 38 32 56 32 56 16 36 36 37 56 47 56 56 41 38 38 56 24 32 14 50 37 26 23 16 31 38 30 30 34 10 22 14 9 24 10 21 12 10 11 18 10 9 14 10 11 17 9 14 8 38 31 30 31 9 15 27 13 16 13 14 13 9 31 31 9 16 14 12 12 14 15 18 31 28 27 23 38 10 13 15 12 16 14 16 16 14 21 7 13 19 9 24 24 24 13 17 18 14 8 23 7 24 17 9 19 15 21 21 11 17 8 13 18 14 15 19 13 16 11 13 27 23 18 18 10 12 12 10 11 18 23 35 14 17 19 17 26 27 22 19 16 13 22 12 8 8 15 13 7 9

Alignment Information

BAC End 1

BAC End 2

seq1: chr7_105856231_105857521
seq2: B6Ng01-320D22.b_44_1143

seq1  GAATTCTGTTATTACTATGATTCATAAAAGCCAGTGCCAGGCAGATTTGA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTGTTATTACTATGATTCATAAAAGCCAGTGCCAGGCAGATTTGA  50

seq1  TTGACATGTATGAACCACTATAGAAACTAATAAGGAAGAGCTTTGTAAAT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGACATGTATGAACCACTATAGAAACTAATAAGGAAGAGCTTTGTAAAT  100

seq1  CCTTAGTGTTCTTACTTTAGTATAACTAACATTTTATGTTAGGTTTGGTA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTTAGTGTTCTTACTTTAGTATAACTAACATTTTATGTTAGGTTTGGTA  150

seq1  TAGAAATAAACTTAAAGGTACACTATATATTACTGTGCAGCAATTTATTT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGAAATAAACTTAAAGGTACACTATATATTACTGTGCAGCAATTTATTT  200

seq1  TAATATTTTTTTTCAGATGCATTTTGCAGAGGCATCAGAAAACTAAAGAA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAATATTTTTTTTCAGATGCATTTTGCAGAGGCATCAGAAAACTAAAGAA  250

seq1  TGATTGGGTTATTTTATTTCTCAATATTAATTGAAGCAGATACTTGTGAA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGATTGGGTTATTTTATTTCTCAATATTAATTGAAGCAGATACTTGTGAA  300

seq1  GTCATTGGGAGGTGAGCCAATTCTGGTTCAACAATTTAATCACAAATACT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCATTGGGAGGTGAGCCAATTCTGGTTCAACAATTTAATCACAAATACT  350

seq1  TGAGGGATTTTTTTATTTTTTTATTTTTTTGCCTTGTTTTATTACAAGTC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGGGATTTTTTTATTTTTTTATTTTTTTGCCTTGTTTTATTACAAGTC  400

seq1  TAATACTCTTCAGTCCAAAAGTCTCATATGTGTAAAAGGCAAACTACTTT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAATACTCTTCAGTCCAAAAGTCTCATATGTGTAAAAGGCAAACTACTTT  450

seq1  TGTGTTCTTGACATTCAGTAAAAATATCACAAATCATTTTAAAATATACA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGTTCTTGACATTCAGTAAAAATATCACAAATCATTTTAAAATATACA  500

seq1  AGCCTTGCTTTTTATTTTAGTATAGTAAATATCTCTTAATTTTATTGAGA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCCTTGCTTTTTATTTTAGTATAGTAAATATCTCTTAATTTTATTGAGA  550

seq1  GATAATTTCAATGAGATTAATTTGAAATTTTAAGATATAGCTCACTATTG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATAATTTCAATGAGATTAATTTGAAATTTTAAGATATAGCTCACTATTG  600

seq1  TAGCTGACTTTATTCAGCGTATATATCAGAAAGATTAGCTAGTTTTGTTT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGCTGACTTTATTCAGCGTATATATCAGAAAGATTAGCTAGTTTTGTTT  650

seq1  TTCCCAAAAGATTCTTTCATCTTATATAAATTAACCCAAATGTGGGAAAA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCCAAAAGATTCTTTCATCTTATATAAATTAACCCAAATGTGGGAAAA  700

seq1  TTTTTTTTCTAAATGTGTAGAACAAGCAGATGTTGAAAGCCAGCTTGTAC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTTTTTCTAAATGTGTAGAACAAGCAGATGTTGAAAGCCAGCTTGTAC  750

seq1  GATAATTGTATTAAAATATGTAAGCCCTTTGGCTTCATTAGTTTGGCATT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATAATTGTATTAAAATATGTAAGCCCTTTGGCTTCATTAGTTTGGCATT  800

seq1  TAAGATCTTGTTAACATACATGAGTAGTTCTGCCAAAACCACAATTTTTA  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAGATCTTGTTAACATACATGAGTAGTTCTGCCAAAACCACAATTTTTA  850

seq1  TTATCTTTGATGCTAGAGTAAGATCAGTGTTGTTCCTTTAAATTGCCAAA  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTATCTTTGATGCTAGAGTAAGATCAGTGTTGTTCCTTTAAATTGCCAAA  900

seq1  GAGTAAACCTTGGTATGGAGTTAAAATTGTTCATGTGAGTTAGATACAAT  950
      ||||||||||||||||||||||||||||||||||||||||||||||| ||
seq2  GAGTAAACCTTGGTATGGAGTTAAAATTGTTCATGTGAGTTAGATAC-AT  949

seq1  CTTTTGACATATGTATTTATACATTAATATAGAATGTCCCAGTTTTCATT  1000
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTTGACATATGTATTTATACATTAATATAGAATGTCCCAGTTTTCATT  999

seq1  CACAGTCTAGTTTTTCTTATCTTTGCTTTGACTGCTAGATTTAAAATTTT  1050
      |||||||||||||||||||||||||||||||||||||||||  |||||||
seq2  CACAGTCTAGTTTTTCTTATCTTTGCTTTGACTGCTAGATT--AAATTTT  1047

seq1  TAAATTGTTTAGAATATCTTATCCCTCCCTCAATCACCCAGCCTTTTGAT  1100
      | |||||||||| ||||| ||||||||||   ||||||||| ||||||||
seq2  T-AATTGTTTAG-ATATC-TATCCCTCCCCTCATCACCCAG-CTTTTGAT  1093

seq1  GTTGACTGTGTTTATTTTGAGACTTTGGCTTAGTGAGAAAGTGGAAAAAC  1150
      | |||||                                           
seq2  GGTGACT-------------------------------------------  1100

seq1  TTGGGGAATCATGGAGTTTGCTTTCCTCTGTAGCTTTGTCCACACCAATC  1200
                                                        
seq2  --------------------------------------------------  1100

seq1  CCAACTCAGACTTTCAGGTGACTCAGAGTTCTAGTCCAGCATAGAAGTAG  1250
                                                        
seq2  --------------------------------------------------  1100

seq1  AGTATCACTTAGAACTTACATTTCAGCTTGGCATGGTGACT  1291
                                               
seq2  -----------------------------------------  1100

seq1: chr7_105958791_105959481
seq2: B6Ng01-320D22.g_63_761 (reverse)

seq1  TCTCC-TTCTGCCCCTCCTCAC-TC-AAGTCCT-GGGGACTTTTGGCTTC  46
      ||||| |||||||||||||||| || ||||||| |||||||||||| |||
seq2  TCTCCTTTCTGCCCCTCCTCACATCAAAGTCCTGGGGGACTTTTGGGTTC  50

seq1  TCTCCCTTTCCC-TAGGAGA--CAAATTCAAATGGCTTCTTCTCCC-CAC  92
      |||||||||||| |||||||   |||||||||||| |||||||||| |||
seq2  TCTCCCTTTCCCATAGGAGAACAAAATTCAAATGGATTCTTCTCCCGCAC  100

seq1  TCTGCATGCTGCTGCCTCTGCTCATCCTAAAATCCAAAAGACACAATCCC  142
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGCATGCTGCTGCCTCTGCTCATCCTAAAATCCAAAAGACACAATCCC  150

seq1  TCCATTGTTCCACGCGCAGAAATCCTGTAAAGAAAGCTTTACAATGACCA  192
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCATTGTTCCACGCGCAGAAATCCTGTAAAGAAAGCTTTACAATGACCA  200

seq1  TCCCCCCTCCACACACCTATGGAACTACACCTTGGAGATTTGGTCTCTGG  242
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCCCCCTCCACACACCTATGGAACTACACCTTGGAGATTTGGTCTCTGG  250

seq1  GAATTTTATAATTTGGAGTTTTATCCTTGGGATTTTGACATTTAGGATTG  292
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTTTATAATTTGGAGTTTTATCCTTGGGATTTTGACATTTAGGATTG  300

seq1  CATCGTTGGAGAAGATAGCACCAGCCAGTCTGCTGCCCCTCCCCGAGCTA  342
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATCGTTGGAGAAGATAGCACCAGCCAGTCTGCTGCCCCTCCCCGAGCTA  350

seq1  AGCCTTATGTCCAGCTCTCCACTTTCTCTCTCTAGGTCCTTGGTGCCCAA  392
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCCTTATGTCCAGCTCTCCACTTTCTCTCTCTAGGTCCTTGGTGCCCAA  400

seq1  CATGCAGCTACTCTCAGTCTCTCTTCTGGATCCCTCCACACTCTTGGATC  442
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGCAGCTACTCTCAGTCTCTCTTCTGGATCCCTCCACACTCTTGGATC  450

seq1  ATCAGCTGGTTCTTCCGCCCAGAATGGCTACTCATGCCACCCATGGCTGC  492
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCAGCTGGTTCTTCCGCCCAGAATGGCTACTCATGCCACCCATGGCTGC  500

seq1  TCTTGCATCTCCTCCCCCCAAGCAGCACCAGCAGCCAGGCCAGCTGTCTT  542
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTGCATCTCCTCCCCCCAAGCAGCACCAGCAGCCAGGCCAGCTGTCTT  550

seq1  GTGGTTGTCTTGTCCAGTTTGGCTGGCGGGTGTGGCTGGAAACCTGGGAC  592
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGGTTGTCTTGTCCAGTTTGGCTGGCGGGTGTGGCTGGAAACCTGGGAC  600

seq1  ACCCAGACCCACACCCAACTCTCTTAGCCTTCATGGTCTGTGCTTCCTCA  642
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCCAGACCCACACCCAACTCTCTTAGCCTTCATGGTCTGTGCTTCCTCA  650

seq1  TCCTGCATCCCTTGAAGGATGGGGTCTAGCCTCCACACCAAGAGAATTC  691
      |||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTGCATCCCTTGAAGGATGGGGTCTAGCCTCCACACCAAGAGAATTC  699

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information