MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-408K12
Chromosome	7 (Build37)
Map Location	3,198,562 - 3,198,808
singlet/doublet	singlet
Overlap gene	none
Upstream gene	LOC100041028, LOC627003, EG664817, Speer9-ps1, AU018091, LOC100041503
Downstream gene	Nlrp12, GA_x5J8B7W3939-136239-135295, LOC384710, Myadm, Prkcc, Cacng7, LOC672553, Cacng8, Cacng6, LOC100041095, 9930022N03Rik, LOC100041109, Oscar, Ndufa3, Tfpt, Prpf31, Cnot3, Leng1, Tmc4, Leng4, Tsen34, Rps9, Lilrb3, Pira1, LOC100041137, LOC100041146, Pira2, LOC675749, LOC100038908, LOC100038909, Pira11, Pira3, LOC100041186, LOC664841, Lair1, Ttyh1, Leng8, Leng9, Cdc42ep5, LOC384521, EG232801
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100041028 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041028
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC627003 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627003
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	EG664817 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:664817 MGI:3643014
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 30 ESTs, 4 Proteins

name	Speer9-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73949 MGI:1921199
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA pseudo : _no_value

name	AU018091 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245128 MGI:2142124
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041503 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041503
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 160 ESTs, 7 Proteins pseudo : _no_value

name	Nlrp12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:378425 MGI:2676630
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 11 ESTs, 14 Proteins

name	GA_x5J8B7W3939-136239-135295 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257852
definition	note : olfactory receptor GA_x5J8B7W3939-136239-135295 pseudo : _no_value

name	LOC384710 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:384710
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	Myadm (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50918 MGI:1355332
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prkcc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18752 MGI:97597
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cacng7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:81904 MGI:1932374
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC672553 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:672553
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	Cacng8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:81905 MGI:1932376
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cacng6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54378 MGI:1859168
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041095 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041095
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	9930022N03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245126 MGI:2442280
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041109 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041109
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Oscar (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232790 MGI:2179720
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ndufa3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66091 MGI:1913341
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tfpt (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69714 MGI:1916964
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prpf31 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68988 MGI:1916238
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cnot3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232791 MGI:2385261
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Leng1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69757 MGI:1917007
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmc4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:353499 MGI:2669035
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Leng4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77582 MGI:1924832
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tsen34 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66078 MGI:1913328
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rps9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76846 MGI:1924096
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lilrb3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18733 MGI:894311
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pira1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18722 MGI:1195971
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041137 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041137
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs, 27 Proteins pseudo : _no_value

name	LOC100041146 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041146
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 28 ESTs, 19 Proteins

name	Pira2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18725 MGI:1195970
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC675749 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:675749
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 31 Proteins pseudo : _no_value

name	LOC100038908 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038908
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100038909 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038909
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pira11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18724 MGI:1276541
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Pira3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18726 MGI:1195969
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041186 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041186
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	LOC664841 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664841
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 5 Proteins pseudo : _no_value

name	Lair1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52855 MGI:105492
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ttyh1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57776 MGI:1889007
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Leng8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232798 MGI:2142195
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Leng9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243813 MGI:2444509
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdc42ep5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58804 MGI:1929745
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC384521 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:384521
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	EG232801 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232801 MGI:3647196
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG664817 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256082 GeneID:664817 MGI:3643014
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 30 ESTs, 4 Proteins product : predicted gene, EG664817 transcript_id : XM_972852.2

name	AU018091 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51921298 GeneID:245128 MGI:2142124
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AU018091 transcript_id : NM_001004153.1

name	Nlrp12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256092 GeneID:378425 MGI:2676630
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 11 ESTs, 14 Proteins product : NLR family, pyrin domain containing 12 transcript_id : XM_001476888.1

name	Myadm (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:8393799 GeneID:50918 MGI:1355332
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myeloid-associated differentiation marker transcript_id : NM_016969.1

name	Prkcc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126215539 GeneID:18752 MGI:97597
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein kinase C, gamma transcript_id : NM_011102.3

name	Cacng7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61098136 GeneID:81904 MGI:1932374
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium channel, voltage-dependent, gamma subunit 7 transcript_id : NM_133189.2

name	LOC672553 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256096 GeneID:672553
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : hypothetical LOC672553 transcript_id : XM_001477048.1

name	Cacng8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21687185 GeneID:81905 MGI:1932376
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium channel, voltage-dependent, gamma subunit 8 transcript_id : NM_133190.1

name	Cacng6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21687181 GeneID:54378 MGI:1859168
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium channel, voltage-dependent, gamma subunit 6 transcript_id : NM_133183.1

name	LOC100041095 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256083 GeneID:100041095
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to LAIR hlog transcript_id : XM_001475796.1

name	9930022N03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368146 GeneID:245126 MGI:2442280
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9930022N03 gene transcript_id : NM_177363.3

name	Oscar (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31342247 GeneID:232790 MGI:2179720
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : osteoclast associated receptor transcript_id : NM_175632.2

name	Ndufa3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388145 GeneID:66091 MGI:1913341
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 3 transcript_id : NM_025348.2

name	Tfpt (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13122605 GeneID:69714 MGI:1916964
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TCF3 (E2A) fusion partner transcript_id : NM_023524.1

name	Prpf31 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802632 GeneID:68988 MGI:1916238
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PRP31 pre-mRNA processing factor 31 homolog (yeast) transcript_id : NM_027328.3

name	Cnot3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892394 GeneID:232791 MGI:2385261
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CCR4-NOT transcription complex, subunit 3 transcript_id : NM_146176.2

name	Leng1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130331 GeneID:69757 MGI:1917007
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leukocyte receptor cluster (LRC) member 1 transcript_id : NM_027203.3

name	Tmc4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116063551 GeneID:353499 MGI:2669035
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane channel-like gene family 4 transcript_id : NM_181820.2

name	Leng4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130665 GeneID:77582 MGI:1924832
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leukocyte receptor cluster (LRC) member 4 transcript_id : NM_029934.3

name	Tsen34 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13195595 GeneID:66078 MGI:1913328
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tRNA splicing endonuclease 34 homolog (SEN34, S. cerevisiae) transcript_id : NM_024168.1

name	Rps9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375455 GeneID:76846 MGI:1924096
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein S9 transcript_id : NM_029767.2

name	Lilrb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46879191 GeneID:18733 MGI:894311
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 3 transcript_id : NM_011095.1

name	Pira1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755063 GeneID:18722 MGI:1195971
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : paired-Ig-like receptor A1 transcript_id : NM_011087.1

name	LOC100041146 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256086 GeneID:100041146
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 28 ESTs, 19 Proteins product : similar to Leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 3 transcript_id : XM_001475879.1

name	Pira2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892524 GeneID:18725 MGI:1195970
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : paired-Ig-like receptor A2 transcript_id : NM_011089.2

name	LOC100038908 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256069 GeneID:100038908
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100038908 transcript_id : XM_001471664.1

name	LOC100038909 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256071 GeneID:100038909
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100038909 transcript_id : XM_001471663.1

name	Pira11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:75832024 GeneID:18724 MGI:1276541
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : paired-Ig-like receptor A11 transcript_id : NM_011088.1

name	Pira3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755065 GeneID:18726 MGI:1195969
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : paired-Ig-like receptor A3 transcript_id : NM_011090.1

name	Lair1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802805 GeneID:52855 MGI:105492
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leukocyte-associated Ig-like receptor 1 transcript_id : NM_178611.3

name	Ttyh1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142343810 GeneID:57776 MGI:1889007
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tweety homolog 1 (Drosophila) transcript_id : NM_021324.4

name	Ttyh1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803438 GeneID:57776 MGI:1889007
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tweety homolog 1 (Drosophila) transcript_id : NM_001001454.2

name	Leng8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129982 GeneID:232798 MGI:2142195
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leukocyte receptor cluster (LRC) member 8 transcript_id : NM_172736.3

name	Leng9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388035 GeneID:243813 MGI:2444509
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leukocyte receptor cluster (LRC) member 9 transcript_id : NM_175529.3

name	Cdc42ep5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:32129278 GeneID:58804 MGI:1929745
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CDC42 effector protein (Rho GTPase binding) 5 transcript_id : NM_021454.3

name	EG232801 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486980 GeneID:232801 MGI:3647196
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG232801 transcript_id : NM_001081239.1

name	EG664817 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94379300 GeneID:664817 MGI:3643014
definition	codon_start : 1 product : hypothetical protein protein_id : XP_977946.1

name	AU018091 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51921299 GeneID:245128 MGI:2142124
definition	codon_start : 1 exception : mismatches in translation product : cationic amino acid transporter 5 protein_id : NP_001004153.1

name	Nlrp12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256093 GeneID:378425 MGI:2676630
definition	codon_start : 1 product : NACHT, LRR and PYD containing protein 12 protein_id : XP_001476938.1

name	Myadm (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8393800 GeneID:50918 MGI:1355332
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : myeloid-associated differentiation marker protein_id : NP_058665.1

name	Prkcc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755080 GeneID:18752 MGI:97597
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0019992 - diacylglycerol binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007635 - chemosensory behavior [Evidence IMP] codon_start : 1 exception : unclassified translation discrepancy product : protein kinase C, gamma protein_id : NP_035232.1

name	Cacng7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61098137 GeneID:81904 MGI:1932374
definition	GO_component : GO:0005891 - voltage-gated calcium channel complex [Evidence ISS] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005245 - voltage-gated calcium channel activity [Evidence ISS] GO_process : GO:0006816 - calcium ion transport [Evidence ISS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : voltage dependent calcium channel gamma 7 subunit product : voltage-dependent calcium channel gamma-7 subunit protein_id : NP_573452.2

name	LOC672553 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256097 GeneID:672553
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477098.1

name	Cacng8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21687186 GeneID:81905 MGI:1932376
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005923 - tight junction [Evidence IEA] GO_function : GO:0005262 - calcium channel activity [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0006816 - calcium ion transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : voltage-dependent calcium channel gamma-8 subunit protein_id : NP_573453.1 transl_except : (pos:3394567..3394569,aa:Met)

name	Cacng6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21687182 GeneID:54378 MGI:1859168
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005923 - tight junction [Evidence IEA] GO_function : GO:0005262 - calcium channel activity [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0006816 - calcium ion transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : voltage-dependent calcium channel gamma-6 subunit protein_id : NP_573446.1

name	LOC100041095 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256084 GeneID:100041095
definition	codon_start : 1 product : similar to LAIR hlog protein_id : XP_001475846.1

name	9930022N03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893513 GeneID:245126 MGI:2442280
definition	codon_start : 1 product : hypothetical protein LOC245126 protein_id : NP_796337.1

name	Oscar (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28274692 CCDS:CCDS20718.1 GeneID:232790 MGI:2179720
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : osteoclast-associated receptor OSCAR product : osteoclast associated receptor protein_id : NP_783440.1

name	Ndufa3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21539587 GeneID:66091 MGI:1913341
definition	EC_number : 1.6.5.3 GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0008137 - NADH dehydrogenase (ubiquinone) activity [Evidence IEA]; GO:0003954 - NADH dehydrogenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] codon_start : 1 note : Complex I-B9; CI-B9 product : NADH-ubiquinone oxidoreductase B9 subunit protein_id : NP_079624.1

name	Tfpt (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13122606 CCDS:CCDS20720.1 GeneID:69714 MGI:1916964
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence ISS]; GO:0046982 - protein heterodimerization activity [Evidence ISS] GO_process : GO:0006917 - induction of apoptosis [Evidence ISS] codon_start : 1 product : TCF3 (E2A) fusion partner protein_id : NP_076013.1

name	Prpf31 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980642 GeneID:68988 MGI:1916238
definition	GO_component : GO:0015030 - Cajal body [Evidence ISS]; GO:0016607 - nuclear speck [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA]; GO:0005681 - spliceosome complex [Evidence IEA]; GO:0046540 - U4/U6 x U5 tri-snRNP complex [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence ISS]; GO:0043021 - ribonucleoprotein binding [Evidence ISS] GO_process : GO:0000351 - assembly of spliceosomal tri-snRNP U4/U6.U5 [Evidence ISS]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence ISS] [Evidence IEA] codon_start : 1 exception : mismatches in translation product : PRP31 protein_id : NP_081604.2

name	Cnot3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122717 CCDS:CCDS20721.1 GeneID:232791 MGI:2385261
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : CCR4-NOT transcription complex, subunit 3 protein_id : NP_666288.1

name	Leng1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312402 CCDS:CCDS20722.1 GeneID:69757 MGI:1917007
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 product : leukocyte receptor cluster (LRC) member 1 protein_id : NP_081479.1

name	Tmc4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116063552 CCDS:CCDS20723.1 GeneID:353499 MGI:2669035
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] codon_start : 1 product : transmembrane channel-like gene family 4 protein_id : NP_861541.2

name	Leng4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542014 CCDS:CCDS20724.1 GeneID:77582 MGI:1924832
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 product : leukocyte receptor cluster (LRC) member 4 protein_id : NP_084210.2

name	Tsen34 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13195596 CCDS:CCDS20725.1 GeneID:66078 MGI:1913328
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0004519 - endonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0008033 - tRNA processing [Evidence IEA] codon_start : 1 note : leukocyte receptor cluster (LRC) member 5 product : tRNA splicing endonuclease 34 protein_id : NP_077130.1

name	Rps9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33504483 CCDS:CCDS20726.1 GeneID:76846 MGI:1924096
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0015935 - small ribosomal subunit [Evidence IEA] GO_function : GO:0019843 - rRNA binding [Evidence IEA] codon_start : 1 product : ribosomal protein S9-like protein_id : NP_084043.1

name	Lilrb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46879192 GeneID:18733 MGI:894311
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0001782 - B cell homeostasis [Evidence IMP]; GO:0019724 - B cell mediated immunity [Evidence IMP]; GO:0019221 - cytokine and chemokine mediated signaling pathway [Evidence IMP]; GO:0043011 - myeloid dendritic cell differentiation [Evidence IMP] codon_start : 1 exception : unclassified translation discrepancy product : paired-Ig-like receptor B protein_id : NP_035225.1

name	Pira1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755064 GeneID:18722 MGI:1195971
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : unclassified translation discrepancy note : paired immunoglobulin-like receptor product : paired-Ig-like receptor A1 protein_id : NP_035217.1

name	LOC100041146 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256087 GeneID:100041146
definition	codon_start : 1 product : similar to Leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 3 protein_id : XP_001475929.1

name	Pira2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133892525 GeneID:18725 MGI:1195970
definition	codon_start : 1 product : paired-Ig-like receptor A2 protein_id : NP_035219.2

name	LOC100038908 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256070 GeneID:100038908
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001471714.1

name	LOC100038909 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256072 GeneID:100038909
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001471713.1

name	Pira11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75832025 GeneID:18724 MGI:1276541
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : paired-Ig-like receptor A11 protein_id : NP_035218.1

name	Pira3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755066 CCDS:CCDS20728.1 GeneID:18726 MGI:1195969
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : paired-Ig-like receptor A3 protein_id : NP_035220.1

name	Lair1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30519937 CCDS:CCDS20729.1 GeneID:52855 MGI:105492
definition	codon_start : 1 note : leukocyte-associated Ig-like receptor 1a product : leukocyte-associated Ig-like receptor 1 protein_id : NP_848726.1

name	Ttyh1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47825408 GeneID:57776 MGI:1889007
definition	codon_start : 1 exception : unclassified translation discrepancy note : isoform 1 is encoded by transcript variant 1 product : tweety 1 isoform 1 protein_id : NP_001001454.1

name	Ttyh1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543900 CCDS:CCDS20730.1 GeneID:57776 MGI:1889007
definition	codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : tweety 1 isoform 2 protein_id : NP_067299.2

name	Leng8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370082 CCDS:CCDS20731.1 GeneID:232798 MGI:2142195
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 product : leukocyte receptor cluster (LRC) member 8 protein_id : NP_766324.1

name	Leng9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425300 CCDS:CCDS20732.1 GeneID:243813 MGI:2444509
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : leukocyte receptor cluster (LRC) member 9 protein_id : NP_780738.1

name	Cdc42ep5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946838 CCDS:CCDS20733.1 GeneID:58804 MGI:1929745
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007254 - JNK cascade [Evidence IDA]; GO:0008360 - regulation of cell shape [Evidence IEA]; GO:0007266 - Rho protein signal transduction [Evidence IDA] codon_start : 1 note : Cdc42 effector protein 5; CRIB-containing BORG3 protein; binder of Rho GTPase 3 product : CDC42 effector protein (Rho GTPase binding) 5 protein_id : NP_067429.1

name	EG232801 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486981 GeneID:232801 MGI:3647196
definition	codon_start : 1 note : leukocyte immunoglobulin-like receptor product : hypothetical protein LOC232801 protein_id : NP_001074708.1

name	LOC100041028 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041028
definition	number : 1 pseudo : _no_value

name	LOC100041028 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041028
definition	number : 2 pseudo : _no_value

name	LOC100041028 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041028
definition	number : 3 pseudo : _no_value

name	LOC100041028 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041028
definition	number : 4 pseudo : _no_value

name	LOC627003 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627003
definition	number : 5 pseudo : _no_value

name	LOC627003 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627003
definition	number : 4 pseudo : _no_value

name	LOC627003 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627003
definition	number : 3 pseudo : _no_value

name	LOC627003 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627003
definition	number : 2 pseudo : _no_value

name	LOC627003 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627003
definition	number : 1 pseudo : _no_value

name	LOC384710 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:384710
definition	number : 1 pseudo : _no_value

name	LOC100041109 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041109
definition	number : 1 pseudo : _no_value

name	LOC100041109 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041109
definition	number : 2 pseudo : _no_value

name	LOC100041109 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041109
definition	number : 3 pseudo : _no_value

name	LOC100041109 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041109
definition	number : 4 pseudo : _no_value

name	LOC100041186 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041186
definition	number : 6 pseudo : _no_value

name	LOC100041186 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041186
definition	number : 5 pseudo : _no_value

name	LOC100041186 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041186
definition	number : 4 pseudo : _no_value

name	LOC100041186 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041186
definition	number : 3 pseudo : _no_value

name	LOC100041186 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041186
definition	number : 2 pseudo : _no_value

name	LOC100041186 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041186
definition	number : 1 pseudo : _no_value

name	LOC384521 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:384521
definition	number : 1 pseudo : _no_value

name	Speer9-ps1 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:141803248 GeneID:73949 MGI:1921199
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : spermatogenesis associated glutamate (E)-rich protein 9, pseudogene 1 pseudo : _no_value transcript_id : NR_001583.2

name	LOC100041503 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256091 GeneID:100041503
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 160 ESTs, 7 Proteins product : similar to proteasome (prosome, macropain) subunit, beta type 5 pseudo : _no_value transcript_id : XR_032959.1

name	LOC100041137 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256085 GeneID:100041137
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs, 27 Proteins product : similar to PIRA2 pseudo : _no_value transcript_id : XR_032462.1

name	LOC675749 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256088 GeneID:675749
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 31 Proteins product : similar to paired-Ig-like receptor A2 pseudo : _no_value transcript_id : XR_032476.1

name	LOC664841 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256101 GeneID:664841
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 5 Proteins product : similar to ribosomal protein S24 pseudo : _no_value transcript_id : XR_033247.1

clone name	MSMg01-148M08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-537H24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-138J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-485L05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423J07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-492A06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472F20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-492O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472F04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-478C12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-268C18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-401K04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-289D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-521K24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-297D15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-437A07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-268C18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-320G20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-397N04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-367N04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462A16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354J09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-538L01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-051D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-295K20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-509B23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-383O13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-325G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472C20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-289L23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-427K01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-263O02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-184D04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-140I16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-513A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-071P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262K22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-288E11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099J22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-289C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287M14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196D09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-301I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-288P20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093N19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-136I03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193F12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-336G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-341D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-136I03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037J07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-308H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229G10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-057L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228H16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-070L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043P23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279K24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080D18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171P01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206O03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323F12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-002I24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086G02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-213C24
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-408K12.T7 (MSMg01no408_k12.b1)	MSMg01-408K12.TJ (MSMg01no408_k12.g1)
ACC	AG506324	AG506325
length	771	774
length of high quality (start - end)	251 (65 - 315)	247 (72 - 318)
definition	CHROMAT_FILE: MSMg01no408_k12.b1 PHD_FILE: MSMg01no408_k12.b1.phd.1 CHEM: term DYE: big TIME: Wed May 18 18:24:42 2005	CHROMAT_FILE: MSMg01no408_k12.g1 PHD_FILE: MSMg01no408_k12.g1.phd.1 CHEM: term DYE: big TIME: Wed May 18 18:24:42 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	TXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXCGCGGAATT CACTGTGCTGTCAAAGATGACCCTGAACTTCTGATCTTCTTGTCTCTATC TCCTGAACTTTGGGATTATGGGTGTACAATACCATACTTAGTTTTGTTGT TGTTGTTGTTGTTGTTGTTTTCGAGACAGGGTTTCTCTGTATAGCCCTGG CTGTCCTGGAACTCACTTTGTAGACCAGGCTGGCCTTGAACTCAGAAATC TGCCTGCCTCTGCCTCCTGAGTGCTGGGATTAAAGGTGTGCGCCACCAAC ACCCGGCACCATACTTATTTTTAAGTTGCTTAATTCATTTCATTGTATTT CTTTTTCTGTGCAATTATAGGGAATAGGAGGAGTATGCATGCCATGATAT TTATGTGCACACCACAGGACAGTCAGTGAGAATTGGTTCTCTCCACAATA TAGGTCCCAGAAAGGGAACTCATCACATCAGGCCTGGTGCAAGTACCTTT TACCCATTAAGCCTATTGGTTGCTGTTCTTCCTCCTTATTTTCTTCCTCT TCCCCCCTCACACTTTTCTTTTCTTTTTTTTTTCCTTTTTTTTCTTCATC CGCATTCTTTTTTAAACCCTAATCCCCCCTCTCCCCCTTTTTCTCCCCCC TTATTTTTTTTTTTTTTTCCCCTTCCCCTCTTCTTTACTAACTTTTACTC CTCCTACTTTTAATTTTTTCTTCATTCTTTACCTACATCGCCCTTTTTCT CACCTATAATTCTTTCTTCTT	GAXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXTGCCTTCCAAGGACAAGCTTCCTAAGTCC TATTTTGAGAAGGAAAATAGTACCAGGCTATGCCACCCAGGTCTGTAAGG AATAGGAGCTTATTGTGGCGTGTGCCACAGTGAGATTGGAAGGTCATGAG ATGAAAGTCACCCGGATTAGCTCACACAACGGACCCCATATCCAAATAAA CATGAGAACAAAAGCTAGTACCTGACTGTTGCCTAGCATTCAGGGTGCTC TGGGTTCCAGATGCTGCCTCTCTTTAAGTGTGTAAAGATTTGTGCTCTTG CAGGGGAGTGGTGTCGCATGCCTTTAATCCTAGCACTTGGGAGGCGGAGG CAGTCGGAATTCTGACCTCCAGTCCAGCCTGGTCTACTAAGTGAGTTCCA GGATGCTGGAGTCCTGAGTGATAATAGCTCCCCCCTAGACACTCGGTCTT ATATGTCCTTTCCTCCGTTCCGTACCTTTTCCCTCTGTCCTTACCTTTCT GCCTTTTTCCTCCTCTCACTCCTTTTTCCCCTCTTACCTTTTCGTTCCTC TGGTTTTTTTTTCTCTCTTTCGTTTTCTACACTAACTTCTAGCCTTTTCT TAATTCCATTCTTTTTCTCTCCCTCTTCTTTCCCTTCTCCCACTCCTCCT TCCCCCTTGTCTTCTTTTTCTCCCTTTCCCTCTTTTTCTTCTCTTCCCTC TCTGTTTTCTCTTCTTCTTTTTCC
quality values	Open. Hide. 8 8 8 9 27 43 39 37 37 37 31 31 37 23 19 9 9 9 21 21 43 26 22 17 17 12 17 7 7 6 6 6 6 12 15 12 14 14 21 25 30 31 59 47 48 36 36 31 31 39 33 33 30 27 27 17 9 9 9 9 9 9 9 9 16 18 30 33 33 33 48 48 53 53 44 44 39 39 43 43 48 53 53 53 53 53 53 59 59 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 48 48 47 48 47 50 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 51 51 51 51 50 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 44 32 18 12 24 24 28 36 36 36 36 57 57 59 68 68 68 68 68 68 59 59 59 59 59 59 59 68 68 68 68 68 57 54 47 46 46 48 48 68 68 68 68 68 68 57 57 59 59 59 59 59 59 59 59 57 57 57 57 57 48 47 46 43 43 50 50 34 28 21 18 16 16 9 9 11 19 23 28 15 12 11 15 23 34 44 50 48 57 57 57 57 57 57 59 59 57 57 57 57 48 57 48 59 59 68 68 68 68 68 68 59 59 57 57 44 44 31 31 18 18 17 20 24 30 30 24 28 30 32 32 44 44 54 59 59 59 59 59 57 54 54 57 57 57 39 42 35 41 41 35 35 35 44 44 57 57 57 57 57 57 57 48 30 25 11 11 11 11 21 20 14 14 15 17 19 28 28 28 25 30 31 31 36 39 39 37 36 25 31 31 33 33 39 47 59 43 47 43 37 37 31 31 20 20 20 28 21 21 11 10 10 17 17 27 20 15 12 14 17 26 28 25 28 28 30 26 32 28 21 28 12 12 11 11 11 12 16 15 14 23 23 33 26 25 12 12 11 22 22 28 28 24 26 26 28 33 39 39 34 27 14 13 13 13 18 17 12 15 15 18 18 19 23 15 9 9 12 12 8 12 7 7 8 8 8 8 8 11 11 11 11 6 6 6 6 8 13 8 8 6 6 8 8 8 10 10 10 10 10 10 10 13 12 12 15 10 10 8 8 8 8 19 17 11 10 8 8 9 9 11 13 19 15 11 9 8 8 10 10 12 13 13 12 17 23 23 14 18 15 16 19 16 8 8 8 6 8 6 6 8 8 8 8 8 8 10 8 10 10 10 10 8 8 8 8 11 10 10 7 7 7 7 12 15 12 10 10 10 10 8 8 10 15 16 18 18 13 15 10 8 8 8 8 8 9 8 8 8 8 8 8 8 8 9 9 11 15 22 19 10 9 9 12 12 26 27 14 9 8 8 8 8 12 8 7 8 6 6 8 8 11 10 6 6 6 8 8 8 8 9 9 10 10 10 13 10 10 10 11 9 8 8 6 6 10 8 8 11 11 11 12 13 12 12 12 11 9 9 7 6 6 6 6 6 8 8 8 8 8 8 8 6 6 8 8 6 6 6 8 13 19 15 15 11 12 11 11 9 9 9 8 8 8 8 8 8 7 7 7 6 8 8 6 6 6 7 7 7	Open. Hide. 6 6 8 8 15 12 19 10 9 9 12 23 28 32 39 39 33 32 37 32 32 37 39 21 25 9 9 9 9 9 9 9 9 9 9 9 10 23 19 34 25 28 34 37 44 39 39 39 44 44 50 50 42 33 25 20 8 6 6 6 8 6 10 12 22 17 28 33 33 31 31 44 47 47 53 57 36 35 34 34 33 42 47 53 53 53 53 53 59 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 59 59 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 51 51 50 50 50 50 68 68 68 68 68 68 50 50 50 51 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 50 50 50 68 68 68 68 68 59 59 59 57 57 57 57 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 51 50 50 50 51 57 57 57 59 59 59 57 57 54 57 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 57 57 44 42 35 35 42 36 44 42 57 57 57 34 44 28 28 30 44 44 68 68 68 68 68 68 54 68 68 68 59 59 59 59 59 59 59 59 59 59 59 68 68 68 68 57 57 57 57 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 41 34 10 10 10 8 8 9 10 10 10 10 12 13 18 25 41 59 59 59 59 59 53 57 57 57 57 57 59 59 59 59 57 57 57 57 59 59 59 57 68 68 68 68 44 59 32 28 23 14 14 14 26 28 44 48 54 54 54 54 48 59 43 43 43 57 59 59 43 43 57 57 59 44 44 27 23 28 27 36 42 36 28 23 23 22 22 17 13 10 10 13 10 11 11 18 21 37 30 24 22 14 14 20 20 16 13 15 11 11 11 11 16 12 14 14 30 13 14 14 19 17 18 11 11 11 9 9 9 9 9 13 21 19 19 9 9 9 11 11 12 12 15 21 15 19 16 16 16 16 16 14 19 10 10 8 8 8 8 8 8 8 9 9 11 22 19 19 10 8 8 8 8 8 6 9 10 11 15 12 11 10 10 10 10 13 8 8 8 8 8 8 8 13 11 8 8 10 8 8 8 8 8 8 8 7 7 8 8 6 6 11 15 8 8 9 10 10 11 12 11 22 11 10 10 10 9 11 9 9 9 9 10 15 10 9 10 11 12 13 9 9 9 11 12 9 9 10 8 8 8 10 8 6 6 8 6 7 7 6 6 6 12 12 10 10 10 10 15 17 22 10 8 8 6 6 8 8 9 8 8 8 10 11 8 8 8 8 8 10 13 10 10 8 8 8 10 13 8 11 10 15 15 8 8 8 12 9 8 8 9 10 9 8 8 8 8 8 8 8 10 9 9 8 10 10 10 8 8 8 10 12 8 10 10 10 8 8 9 10 13 11 10 8 8 8 10 15 14 14 13 12 13 10 10 8 8 13 8 8 8 12 12 10 8 8 8 8 6 9 11 9 9 11 10 10 10 6 6 8 8 8 8 8 8 8 8 10 10 21 15 20 10 13 8 8 8 8 8 8 10 9 13 19 23 17 12 10 8 9 8 9 11 17 11 10 10 13 15 13 15 11 11 9 9 9 9 9 9 9 8 10 13 10 13 8 10 7 8 6 6 10 13 13 10 8 8 7 6 10 10 10 12 12 12 13 21 22 22 21 17

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no408_k12.g1 MSMg01no408_k12.g1 CHROMAT_FILE:
MSMg01no408_k12.g1 PHD_FILE: MSMg01no408_k12.g1.phd.1 CHEM: term DYE:
big TIME: Wed May 18 18:24:42 2005
         (247 letters)



>mm_chr7_3198362_3199008
          Length = 647

 Score =  455 bits (235), Expect = e-132
 Identities = 244/247 (98%)
 Strand = Plus / Plus

                                                                       
Query: 1   tgccttccaaggacaagcttcctaagtcctattttgagaaggaaaatagtaccaggctat 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 201 tgccttccaaggacaagcttcctaagtcctattttgagaaggaaaatagtaccaggctat 260

                                                                       
Query: 61  gccacccaggtctgtaaggaataggagcttattgtggcgtgtgccacagtgagattggaa 120
           ||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||
Sbjct: 261 gccacccaggtctgtaaggaataggagcttactgtggcgtgtgccactgtgagattggaa 320

                                                                       
Query: 121 ggtcatgagatgaaagtcacccggattagctcacacaacggaccccatatccaaataaac 180
           ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
Sbjct: 321 ggtcatgagatgaaagtcacccggattagctcacacagcggaccccatatccaaataaac 380

                                                                       
Query: 181 atgagaacaaaagctagtacctgactgttgcctagcattcagggtgctctgggttccaga 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 381 atgagaacaaaagctagtacctgactgttgcctagcattcagggtgctctgggttccaga 440

                  
Query: 241 tgctgcc 247
           |||||||
Sbjct: 441 tgctgcc 447


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 10
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 247
Length of database: 647
Length adjustment: 9
Effective length of query: 238
Effective length of database: 638
Effective search space:   151844
Effective search space used:   151844
X1: 7 (13.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 7 (14.4 bits)
S2: 7 (14.3 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information