MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-511D03
Chromosome	7 (Build37)
Map Location	6,588,588 - 6,588,721
singlet/doublet	singlet
Overlap gene	none
Upstream gene	LOC673215, V1rd2, LOC100041627, LOC100041637, V1rd1, LOC100041647, V1rd11, LOC100041666, V1rd6, EG384525, EG269859, Nlrp4c, Zfp787, Zfp444, Galp, Zfp371, EG627821, Zfp667, Zfp583, LOC100042467, LOC100042459, Zfp78, Zfp28, LOC100042450, Olfr1344, GA_x5J8B7W3DQU-679632-679375, Olfr1336, Olfr1346, Olfr5, Olfr1347, Olfr1348, Olfr1349, LOC665328, Olfr1350
Downstream gene	Zim2, Zim1, Peg3, Usp29, LOC627961, Aurkc, LOC628030, LOC100041822, 5730403M16Rik, 2810409K11Rik, Vmn2r-ps35, Zfp418, BC023179, 6430701C03Rik, Clcn4-2, V2r15, LOC100041866, LOC100042577, Vmn2r31, Vmn2r-ps36, V2r5, LOC100041883, EG628117, Vmn2r33, LOC665470, EG665474
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC673215 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:673215
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins pseudo : _no_value

name	V1rd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:81016 MGI:3033471
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041627 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041627
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC100041637 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041637
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 30 Proteins pseudo : _no_value

name	V1rd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:81017 MGI:3033470
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041647 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041647
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	V1rd11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404285 MGI:3033480
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041666 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041666
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	V1rd6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:81013 MGI:3033475
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG384525 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384525 MGI:3645266
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 5 Proteins

name	EG269859 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269859 MGI:3647769
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	Nlrp4c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83564 MGI:1890518
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp787 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67109 MGI:1914359
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp444 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72667 MGI:1923365
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Galp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232836 MGI:2663979
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp371 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170734 MGI:2159640
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG627821 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627821 MGI:3643580
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs

name	Zfp667 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384763 MGI:2442757
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp583 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213011 MGI:2682297
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042467 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042467
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC100042459 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042459
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Zfp78 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330463 MGI:107783
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Zfp28 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22690 MGI:99175
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042450 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042450
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs

name	Olfr1344 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257882 MGI:3031178
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W3DQU-679632-679375 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257846
definition	note : olfactory receptor GA_x5J8B7W3DQU-679632-679375 pseudo : _no_value

name	Olfr1336 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258917 MGI:3031170
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1346 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258918 MGI:3031180
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18349 MGI:106685
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1347 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258383 MGI:3031181
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1348 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258915 MGI:3031182
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1349 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269862 MGI:3031183
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665328 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665328
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Olfr1350 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258384 MGI:3031184
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zim2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76637 MGI:1923887
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	Zim1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22776 MGI:1341879
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Peg3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18616 MGI:104748
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Usp29 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57775 MGI:1888998
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC627961 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627961
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Aurkc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20871 MGI:1321119
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	LOC628030 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628030
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 41 Proteins pseudo : _no_value

name	LOC100041822 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041822
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	5730403M16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232853 MGI:1917764
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2810409K11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76373 MGI:1923623
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 11 ESTs, 2 Proteins

name	Vmn2r-ps35 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628048
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Zfp418 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232854 MGI:2444763
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC023179 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232855 MGI:2385265
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	6430701C03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76229 MGI:1923479
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA pseudo : _no_value

name	Clcn4-2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12727 MGI:104571
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V2r15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22306 MGI:1316729
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041866 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041866
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	LOC100042577 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042577
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 1 Protein

name	Vmn2r31 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042591
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 32 Proteins

name	Vmn2r-ps36 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665442
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 13 Proteins pseudo : _no_value

name	V2r5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22311 MGI:1316696
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 2 ESTs, 14 Proteins

name	LOC100041883 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041883
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	EG628117 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628117 MGI:3646304
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein pseudo : _no_value

name	Vmn2r33 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:624512
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 30 Proteins

name	LOC665470 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665470
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 4 Proteins pseudo : _no_value

name	EG665474 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665474 MGI:3643732
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	V1rd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13507705 GeneID:81016 MGI:3033471
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, D2 transcript_id : NM_030741.1

name	V1rd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13507707 GeneID:81017 MGI:3033470
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, D1 transcript_id : NM_030742.1

name	V1rd11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46430540 GeneID:404285 MGI:3033480
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, D11 transcript_id : NM_207544.1

name	V1rd6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13507699 GeneID:81013 MGI:3033475
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, D6 transcript_id : NM_030738.1

name	EG384525 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256134 GeneID:384525 MGI:3645266
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 5 Proteins product : predicted gene, EG384525 transcript_id : XM_357690.4

name	Nlrp4c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13878218 GeneID:83564 MGI:1890518
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NLR family, pyrin domain containing 4C transcript_id : NM_031389.1

name	Zfp787 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:67846114 GeneID:67109 MGI:1914359
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 787 transcript_id : NM_001013012.1

name	Zfp444 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142344196 GeneID:72667 MGI:1923365
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 444 transcript_id : NM_028316.2

name	Galp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31342456 GeneID:232836 MGI:2663979
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : galanin-like peptide precursor transcript_id : NM_178028.2

name	Zfp371 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83025106 GeneID:170734 MGI:2159640
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 371 transcript_id : NM_133204.2

name	EG627821 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379341 GeneID:627821 MGI:3643580
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs product : predicted gene, EG627821 transcript_id : XM_892523.2

name	Zfp667 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88853589 GeneID:384763 MGI:2442757
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 667 transcript_id : NM_001024928.2

name	Zfp583 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142376695 GeneID:213011 MGI:2682297
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 583 transcript_id : NM_001033249.2

name	LOC100042467 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256145 GeneID:100042467
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100042467 transcript_id : XM_001478575.1

name	LOC100042459 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256143 GeneID:100042459
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100042459 transcript_id : XM_001478563.1

name	Zfp78 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:68448538 GeneID:330463 MGI:107783
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 78 transcript_id : NM_001025163.1

name	Zfp78 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802063 GeneID:330463 MGI:107783
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 78 transcript_id : NM_177888.3

name	Zfp28 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364313 GeneID:22690 MGI:99175
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 28 transcript_id : NM_175247.2

name	LOC100042450 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256139 GeneID:100042450
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100042450, transcript variant 1 transcript_id : XM_001478530.1

name	LOC100042450 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256141 GeneID:100042450
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs product : hypothetical protein LOC100042450, transcript variant 2 transcript_id : XM_001478546.1

name	Olfr1344 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:59676556 GeneID:257882 MGI:3031178
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1344 transcript_id : NM_177061.3

name	Olfr1336 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129060 GeneID:258917 MGI:3031170
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1336 transcript_id : NM_146915.1

name	Olfr1346 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129062 GeneID:258918 MGI:3031180
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1346 transcript_id : NM_146916.1

name	Olfr5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22165409 GeneID:18349 MGI:106685
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 5 transcript_id : NM_146914.1

name	Olfr1347 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129530 GeneID:258383 MGI:3031181
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1347 transcript_id : NM_146385.1

name	Olfr1348 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129066 GeneID:258915 MGI:3031182
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1348 transcript_id : NM_146913.1

name	Olfr1349 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:53828667 GeneID:269862 MGI:3031183
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1349 transcript_id : NM_207136.1

name	Olfr1350 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239059 GeneID:258384 MGI:3031184
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1350 transcript_id : NM_146389.1

name	Zim2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379350 GeneID:76637 MGI:1923887
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, imprinted 2 transcript_id : XM_489216.4

name	Zim1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42734480 GeneID:22776 MGI:1341879
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, imprinted 1 transcript_id : NM_011769.3

name	Peg3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58331165 GeneID:18616 MGI:104748
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : paternally expressed 3 transcript_id : NM_008817.2

name	Usp29 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114145572 GeneID:57775 MGI:1888998
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin specific peptidase 29 transcript_id : NM_021323.2

name	Aurkc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124378051 GeneID:20871 MGI:1321119
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aurora kinase C transcript_id : NM_001080966.1

name	Aurkc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124378043 GeneID:20871 MGI:1321119
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aurora kinase C transcript_id : NM_020572.2

name	Aurkc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124378045 GeneID:20871 MGI:1321119
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aurora kinase C transcript_id : NM_001080965.1

name	5730403M16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349528 GeneID:232853 MGI:1917764
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5730403M16 gene transcript_id : NM_172738.2

name	2810409K11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256156 GeneID:76373 MGI:1923623
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 11 ESTs, 2 Proteins product : RIKEN cDNA 2810409K11 gene transcript_id : XM_001478656.1

name	Zfp418 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124339856 GeneID:232854 MGI:2444763
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 418 transcript_id : NM_146179.2

name	BC023179 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625909 GeneID:232855 MGI:2385265
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC023179 transcript_id : NM_145577.2

name	Clcn4-2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625939 GeneID:12727 MGI:104571
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chloride channel 4-2 transcript_id : NM_011334.3

name	V2r15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126507093 GeneID:22306 MGI:1316729
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 2, receptor, 15 transcript_id : NM_009490.2

name	LOC100041866 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256105 GeneID:100041866
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : similar to predicted gene, EG665255 transcript_id : XM_001477141.1

name	LOC100042577 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256162 GeneID:100042577
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 1 Protein product : similar to 2810047C21Rik protein transcript_id : XM_001478744.1

name	Vmn2r31 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256166 GeneID:100042591
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 12 Proteins product : vomeronasal receptor Vmn2r31, transcript variant 2 transcript_id : XM_001478759.1

name	Vmn2r31 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256168 GeneID:100042591
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 Proteins product : vomeronasal receptor Vmn2r31, transcript variant 3 transcript_id : XM_001478768.1

name	Vmn2r31 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256164 GeneID:100042591
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 27 Proteins product : vomeronasal receptor Vmn2r31, transcript variant 1 transcript_id : XM_001478750.1

name	Vmn2r31 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256170 GeneID:100042591
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins product : vomeronasal receptor Vmn2r31, transcript variant 4 transcript_id : XM_001478775.1

name	V2r5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379365 GeneID:22311 MGI:1316696
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 2 ESTs, 10 Proteins product : vomeronasal 2, receptor, 5, transcript variant 1 transcript_id : XM_620407.3

name	Vmn2r33 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94379371 GeneID:624512
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 10 Proteins product : vomeronasal receptor Vmn2r33, transcript variant 1 transcript_id : XM_620409.3

name	Vmn2r33 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:82903082 GeneID:624512
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 Proteins product : vomeronasal receptor Vmn2r33, transcript variant 2 transcript_id : XM_899013.1

name	Vmn2r33 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256174 GeneID:624512
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 25 Proteins product : vomeronasal receptor Vmn2r33, transcript variant 3 transcript_id : XM_899030.3

name	V1rd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13507706 GeneID:81016 MGI:3033471
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0016503 - pheromone receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : pheromone receptor V3R2 product : vomeronasal 1 receptor, D2 protein_id : NP_109666.1

name	V1rd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13507708 CCDS:CCDS20765.1 GeneID:81017 MGI:3033470
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0016503 - pheromone receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : pheromone receptor V3R1 product : vomeronasal 1 receptor, D1 protein_id : NP_109667.1

name	V1rd11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46430541 CCDS:CCDS20766.1 GeneID:404285 MGI:3033480
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0016503 - pheromone receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA] codon_start : 1 product : vomeronasal 1 receptor, D11 protein_id : NP_997427.1

name	V1rd6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13507700 CCDS:CCDS20767.1 GeneID:81013 MGI:3033475
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0016503 - pheromone receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : pheromone receptor V3R6 product : vomeronasal 1 receptor, D6 protein_id : NP_109663.1

name	EG384525 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38085727 GeneID:384525 MGI:3645266
definition	codon_start : 1 product : similar to ribosomal protein protein_id : XP_357690.1

name	Nlrp4c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13878219 GeneID:83564 MGI:1890518
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation note : ribonuclease/angiogenin inhibitor 2; NACHT, leucine rich repeat and PYD containing 4C product : VNACHT, leucine rich repeat and PYD containing 4C protein_id : NP_113566.1

name	Zfp787 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67846115 CCDS:CCDS20769.1 GeneID:67109 MGI:1914359
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger protein 787 protein_id : NP_001013030.1

name	Zfp444 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037297 CCDS:CCDS20770.1 GeneID:72667 MGI:1923365
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc finger protein 444 protein_id : NP_082592.1

name	Galp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794256 CCDS:CCDS20771.1 GeneID:232836 MGI:2663979
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005179 - hormone activity [Evidence IEA]; GO:0005102 - receptor binding [Evidence TAS] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : galanin-like peptide precursor protein_id : NP_821171.1

name	Zfp371 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83025107 CCDS:CCDS20772.1 GeneID:170734 MGI:2159640
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : zinc finger gonad protein 1 product : zinc finger protein 371 protein_id : NP_573467.2

name	EG627821 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82903229 GeneID:627821 MGI:3643580
definition	codon_start : 1 product : hypothetical protein protein_id : XP_897616.1

name	Zfp667 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67972433 CCDS:CCDS20773.1 GeneID:384763 MGI:2442757
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 product : zinc finger protein 667 protein_id : NP_001020099.1

name	Zfp583 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701750 GeneID:213011 MGI:2682297
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger protein 583 protein_id : NP_001028421.1

name	LOC100042467 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256146 GeneID:100042467
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478625.1

name	LOC100042459 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256144 GeneID:100042459
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478613.1

name	Zfp78 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:68448539 CCDS:CCDS20774.1 GeneID:330463 MGI:107783
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : zinc finger protein 78 isoform 1 protein_id : NP_001020334.1

name	Zfp78 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244508 CCDS:CCDS20775.1 GeneID:330463 MGI:107783
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : zinc finger protein 78 isoform 2 protein_id : NP_808556.1

name	Zfp28 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33504577 GeneID:22690 MGI:99175
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc finger protein 28 protein_id : NP_780456.1

name	LOC100042450 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256140 GeneID:100042450
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001478580.1

name	LOC100042450 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256142 GeneID:100042450
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001478596.1

name	Olfr1344 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:59676557 CCDS:CCDS20776.1 GeneID:257882 MGI:3031178
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2QGBW-3169916-3170881; olfactory receptor MOR124-1 product : olfactory receptor 1344 protein_id : NP_796035.2

name	Olfr1336 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129061 CCDS:CCDS20777.1 GeneID:258917 MGI:3031170
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2QGBW-3190370-3191314; olfactory receptor MOR103-7 product : olfactory receptor 1336 protein_id : NP_667126.1

name	Olfr1346 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129063 CCDS:CCDS20778.1 GeneID:258918 MGI:3031180
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2QGBW-3203957-3204898; olfactory receptor MOR103-6 product : olfactory receptor 1346 protein_id : NP_667127.1

name	Olfr5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22165410 GeneID:18349 MGI:106685
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2QGBW-3210997-3210059 product : olfactory receptor 5 protein_id : NP_667125.1

name	Olfr1347 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129531 CCDS:CCDS20779.1 GeneID:258383 MGI:3031181
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2QGBW-3218686-3217748; MOR103-19_i; olfactory receptor MOR103-11 product : olfactory receptor 1347 protein_id : NP_666497.1

name	Olfr1348 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129067 GeneID:258915 MGI:3031182
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2QGBW-3232059-3231121; olfactory receptor MOR103-9 product : olfactory receptor 1348 protein_id : NP_667124.1

name	Olfr1349 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:53828668 CCDS:CCDS20780.1 GeneID:269862 MGI:3031183
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2QGBW-3245761-3244808; olfactory receptor MOR232-8 product : olfactory receptor 1349 protein_id : NP_997019.1

name	Olfr1350 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239060 CCDS:CCDS20781.1 GeneID:258384 MGI:3031184
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2QGBW-3300391-3301317; olfactory receptor MOR222-3 product : olfactory receptor 1350 protein_id : NP_666501.1

name	Zim2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82903235 GeneID:76637 MGI:1923887
definition	codon_start : 1 product : hypothetical protein protein_id : XP_489216.2

name	Zim1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:42734481 CCDS:CCDS20782.1 GeneID:22776 MGI:1341879
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc finger, imprinted 1 protein_id : NP_035899.3

name	Peg3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58331166 CCDS:CCDS20783.1 GeneID:18616 MGI:104748
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA] codon_start : 1 note : granule cell antiserum positive 4; paternally expressed gene 3 product : paternally expressed 3 protein_id : NP_032843.2

name	Usp29 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114145573 CCDS:CCDS20784.1 GeneID:57775 MGI:1888998
definition	GO_function : GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004221 - ubiquitin thiolesterase activity [Evidence IEA] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 note : ossification center-associated transcript product : ubiquitin specific protease 29 protein_id : NP_067298.2

name	Aurkc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124378046 GeneID:20871 MGI:1321119
definition	GO_component : GO:0000775 - chromosome, pericentric region [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; serine/threonine kinase 13 (aurora/IPL-like); aurora B product : aurora kinase C isoform a protein_id : NP_001074434.1

name	Aurkc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124378052 GeneID:20871 MGI:1321119
definition	GO_component : GO:0000775 - chromosome, pericentric region [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; serine/threonine kinase 13 (aurora/IPL-like); aurora B product : aurora kinase C isoform b protein_id : NP_001074435.1

name	Aurkc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124378044 GeneID:20871 MGI:1321119
definition	GO_component : GO:0000775 - chromosome, pericentric region [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 3; serine/threonine kinase 13 (aurora/IPL-like); aurora B product : aurora kinase C isoform b protein_id : NP_065597.2

name	5730403M16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370086 GeneID:232853 MGI:1917764
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : hypothetical protein LOC232853 protein_id : NP_766326.1

name	2810409K11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256157 GeneID:76373 MGI:1923623
definition	codon_start : 1 product : hypothetical protein LOC76373 protein_id : XP_001478706.1

name	Zfp418 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124339857 GeneID:232854 MGI:2444763
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger protein 418 protein_id : NP_666291.2

name	BC023179 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625910 CCDS:CCDS20785.1 GeneID:232855 MGI:2385265
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : hypothetical protein LOC232855 protein_id : NP_663552.2

name	Clcn4-2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625940 CCDS:CCDS20786.1 GeneID:12727 MGI:104571
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005254 - chloride channel activity [Evidence IEA]; GO:0031404 - chloride ion binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0005247 - voltage-gated chloride channel activity [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0006821 - chloride transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : voltage-gated chloride channel ClC-4A product : chloride channel 4 protein_id : NP_035464.3

name	V2r15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126507094 GeneID:22306 MGI:1316729
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : vomeronasal organ family 2, receptor, 15 product : vomeronasal 2, receptor, 15 protein_id : NP_033516.2

name	LOC100041866 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256106 GeneID:100041866
definition	codon_start : 1 product : similar to predicted gene, EG665255 protein_id : XP_001477191.1

name	LOC100042577 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256163 GeneID:100042577
definition	codon_start : 1 product : similar to 2810047C21Rik protein protein_id : XP_001478794.1

name	Vmn2r31 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256169 GeneID:100042591
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 3 protein_id : XP_001478818.1

name	Vmn2r31 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256165 GeneID:100042591
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 1 protein_id : XP_001478800.1

name	Vmn2r31 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256167 GeneID:100042591
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 2 protein_id : XP_001478809.1

name	Vmn2r31 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256171 GeneID:100042591
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 4 protein_id : XP_001478825.1

name	V2r5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63555322 GeneID:22311 MGI:1316696
definition	codon_start : 1 product : vomeronasal 2, receptor, 5 isoform 1 protein_id : XP_620407.1

name	Vmn2r33 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82903083 GeneID:624512
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 2 protein_id : XP_904106.1

name	Vmn2r33 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82903087 GeneID:624512
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 3 protein_id : XP_904123.1

name	Vmn2r33 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82903085 GeneID:624512
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 1 protein_id : XP_620409.2

name	LOC673215 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673215
definition	number : 1 pseudo : _no_value

name	LOC100041627 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041627
definition	number : 2 pseudo : _no_value

name	LOC100041627 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041627
definition	number : 1 pseudo : _no_value

name	LOC100041637 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041637
definition	number : 1 pseudo : _no_value

name	LOC100041647 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041647
definition	number : 1 pseudo : _no_value

name	LOC100041666 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041666
definition	number : 2 pseudo : _no_value

name	LOC100041666 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041666
definition	number : 1 pseudo : _no_value

name	EG269859 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:269859
definition	number : 1 pseudo : _no_value

name	LOC665328 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665328
definition	number : 1 pseudo : _no_value

name	LOC627961 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627961
definition	number : 1 pseudo : _no_value

name	LOC100041822 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041822
definition	number : 5 pseudo : _no_value

name	LOC100041822 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041822
definition	number : 4 pseudo : _no_value

name	LOC100041822 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041822
definition	number : 3 pseudo : _no_value

name	LOC100041822 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041822
definition	number : 2 pseudo : _no_value

name	LOC100041822 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041822
definition	number : 1 pseudo : _no_value

name	Vmn2r-ps35 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628048
definition	number : 1 pseudo : _no_value

name	Vmn2r-ps36 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665442
definition	number : 6 pseudo : _no_value

name	Vmn2r-ps36 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665442
definition	number : 5 pseudo : _no_value

name	Vmn2r-ps36 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665442
definition	number : 4 pseudo : _no_value

name	Vmn2r-ps36 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665442
definition	number : 3 pseudo : _no_value

name	Vmn2r-ps36 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665442
definition	number : 2 pseudo : _no_value

name	Vmn2r-ps36 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665442
definition	number : 1 pseudo : _no_value

name	LOC100041883 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041883
definition	number : 7 pseudo : _no_value

name	LOC100041883 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041883
definition	number : 6 pseudo : _no_value

name	LOC100041883 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041883
definition	number : 5 pseudo : _no_value

name	LOC100041883 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041883
definition	number : 4 pseudo : _no_value

name	LOC100041883 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041883
definition	number : 3 pseudo : _no_value

name	LOC100041883 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041883
definition	number : 2 pseudo : _no_value

name	LOC100041883 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041883
definition	number : 1 pseudo : _no_value

name	EG665474 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665474
definition	number : 6 pseudo : _no_value

name	EG665474 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665474
definition	number : 5 pseudo : _no_value

name	EG665474 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665474
definition	number : 4 pseudo : _no_value

name	EG665474 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665474
definition	number : 3 pseudo : _no_value

name	EG665474 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665474
definition	number : 2 pseudo : _no_value

name	EG665474 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665474
definition	number : 1 pseudo : _no_value

name	LOC628030 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256102 GeneID:628030
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 41 Proteins product : similar to Arp2 pseudo : _no_value transcript_id : XR_033042.1

name	6430701C03Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149256074 GeneID:76229 MGI:1923479
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6430701C03 gene pseudo : _no_value transcript_id : XR_035717.1

name	EG628117 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149256107 GeneID:628117 MGI:3646304
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : predicted gene, EG628117 pseudo : _no_value transcript_id : XR_033094.1

name	LOC665470 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256108 GeneID:665470
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 4 Proteins product : similar to putative pheromone receptor pseudo : _no_value transcript_id : XR_033101.1

clone name	MSMg01-263A15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-398A09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-358J11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-543N20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-298H11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-047J17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-500P15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290J16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-141M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-367N01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-049A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354K14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528B18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-455A06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-374L17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-053G03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-143A02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-137B22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-391C19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-350J18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-134I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-327C01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-512F07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-345G01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-511D03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-406A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-096M21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-385M13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-187A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-080K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-083E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-339M02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-083K11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-532I18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-446B11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-345K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-274J13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-513A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536M13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-447H24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-176K08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-477M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-187A24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-129P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138N12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-332D09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-312L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138P14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-021F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026H09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283A20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309L13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-175G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-040D10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075A15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208C18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-199J03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-303I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-305H13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-178N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031I15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-029M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288L15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157L24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-299B01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-333E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226K04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225C04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311H22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-298B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250L03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267P06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-267P07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265D09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-141N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089A12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-201G20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-153D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101N13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157P23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034H22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-119E24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-325O07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-158D20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-061I14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-115J16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-053N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246N22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344K23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165J01
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-511D03.T7 (MSMg01no511_d03.b1)	MSMg01-511D03.TJ (MSMg01no511_d03.g1)
ACC	AG584449	AG584450
length	740	861
length of high quality (start - end)	135 (171 - 305)	---
definition	CHROMAT_FILE: MSMg01no511_d03.b1 PHD_FILE: MSMg01no511_d03.b1.phd.1 CHEM: term DYE: big TIME: Wed May 18 20:40:59 2005	CHROMAT_FILE: MSMg01no511_d03.g1 PHD_FILE: MSMg01no511_d03.g1.phd.1 CHEM: term DYE: big TIME: Wed May 18 20:40:59 2005
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	CTAXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXTCGCGGA ATTCCACATATTTTCCCCTGATGAAATTAGGACAATAAATTCTGAGCCCA GTGGCTGTGTCATCTGGTTGACTATAAATATTAAGATTGTCTGGTGTTTT CCATTTGCCGTGATTCATGTAGGCAAGTTGAGAGGGTGCAGCCACATGGT AGCCATCTGCTGAACCTGCCAAGGGACTGGATGGCTGGTGGAAAGTGAAT GCTAGTTCCAGGCATTCTCAGGAGGGACACCTGCCAGGTGGCTTATCAAA GCTATCTAGAAGAATGGACAACAGTCATGGTCTCAGGCGGCTGGCTGTTT TGGGCAAGGAACAGACAGAGACTCGAGTGTCTTGGTGAATCTACCCTTGG TGGCTGGATTATATCAACGTTGCTTGCATATATCCTGAGTAGTGTGGGTT TATTTAAAATTACAGGATATATCTGCTGACCCGGTTCTGTCGTGTAGAAA GTAAAGCTTTCTGCTATTTGGCAAAATTTTGTGGTTAGCGGTCTTTCTCT TTGAGCCTGCGGAATTATCACACTAAACTCCCAGTGAAATACAAACTAGT CCTTAACCTGTTTCTTAACCTTCCAAGAATAAACAAAAGGTTTGTTATAC TTGCAAGAATTCCTAGCATCTATTTATTGTTAATTACTTTTTCCAAACTA TTTCCTCAAAAATTTTATTCCGATACGCACCCCTCGTCCN	CATTATATTCTCTACCACAAAACCAACACCCCCTAACCTATCCTAAAATA CTAAAACATATTATCACATATATTCTATATCTACCACATCACATACCACC CTATTACCCACAACACTAACACACCATCCATTCTCATTGAAAAACTTAAT ATACAAATATAAAAAAATAAACCCCCCCCAATTAATCCACAAATACCCCT CGAACTAAAAAAAACAAAACCCGCTGTTACATCCACCATTTTGCCCCTCT CTATTACGTTTCCGTTTTACACATTTTTTAATTACATCTAAAAACACAAC AGTCACCTTATCTATAACATTACCACAATTCTTCAACCCCATACCCAAAC TCTACTCACAATCCAATTAAACCAAAACAAAAAATAATAAGCAAAATTAA CAAAAATCCTCCCACCAATATACAAAAAAAAAAATTACCTATTACCTTTT ACCACACTCACCCACAGCACTATTTACCACCATCCTCCCAACATACCCCA ATTAATCTAATCTCCCATTTCTGTTAAATATAAACCCCCTATAATACAAA TACTACCCAACATTTTCAGCCCCGATATAAATTTTTACAATTTCATTCCC CCCTTCTTATACCCCCAAAAATAAAAAAAATGTACCNCCCCCCACTTCTA CAAAACACAGATTTAAATAAAAAATTTAACACACCAAATTATTCTAACAC CCATTATACACTAGAGGCAATACATAGACATTAATTAGTTCAACTTTTCC TTTACACAAAAAACAAAGTATCTTCCCGCGTTTCTAATTTTAATTAACCC CTTCACACTGAATTTTAATTAAAAAATAGAACCACCCCACCCACACCCTT ATACCATAAAT
quality values	Open. Hide. 11 11 13 15 13 11 10 8 8 13 10 9 8 13 10 10 10 10 10 23 23 47 41 40 28 28 28 19 19 10 15 9 8 8 8 8 8 10 11 9 8 10 8 8 8 12 19 32 39 34 37 34 23 17 14 14 15 15 11 15 12 10 9 8 8 8 8 19 22 30 33 33 37 37 37 37 37 30 22 12 11 19 15 32 32 39 43 43 43 43 39 39 39 47 42 43 43 39 39 39 39 36 43 39 43 47 47 43 43 43 46 44 44 39 39 43 48 48 24 24 11 11 11 16 15 22 30 40 29 35 39 30 26 14 15 14 27 23 14 12 12 10 11 16 24 32 40 36 35 37 35 39 39 48 48 50 48 37 34 24 15 14 19 19 17 15 11 11 11 22 18 23 28 32 37 43 34 34 28 28 20 20 32 34 34 37 30 33 28 28 14 14 18 28 37 57 57 57 41 41 20 20 20 31 32 43 48 43 41 41 30 28 28 36 36 48 57 47 48 44 42 37 32 28 28 28 40 43 39 35 35 32 36 36 36 36 28 28 33 33 33 33 37 28 23 23 28 38 43 57 57 57 50 43 35 35 43 43 35 27 27 14 13 13 16 28 38 38 36 29 21 27 18 18 25 32 32 35 35 37 42 43 37 36 32 32 17 17 24 30 32 31 28 19 11 11 18 19 31 37 23 21 11 10 10 10 10 12 12 15 15 20 19 27 27 25 25 22 30 17 14 15 14 14 14 18 18 28 32 37 48 47 30 30 15 15 12 12 12 21 22 12 19 13 8 10 6 6 8 8 12 26 19 28 13 13 13 26 28 43 33 33 19 19 14 18 14 26 28 37 43 40 40 28 28 23 23 15 9 9 9 12 21 22 11 11 11 19 14 19 19 29 31 37 37 28 24 24 18 17 17 17 24 22 28 18 13 8 8 8 8 8 9 10 13 10 11 15 19 23 30 37 30 24 24 15 22 26 32 32 14 14 14 12 12 13 14 14 12 16 11 10 10 11 11 16 13 11 12 19 22 22 24 30 29 30 28 28 29 21 19 16 15 17 17 18 27 17 11 8 8 8 8 10 10 10 15 27 27 27 24 10 10 8 8 8 15 12 13 11 11 10 10 12 18 11 11 9 9 12 18 15 13 14 13 13 12 13 17 17 10 9 9 9 9 12 13 28 27 20 10 13 8 8 8 8 8 8 15 10 11 11 19 13 12 8 8 8 8 8 8 8 10 10 11 17 20 28 21 19 21 16 12 10 10 9 9 9 9 9 14 10 9 14 22 9 9 9 11 11 8 8 8 8 8 10 8 8 8 8 10 12 10 10 11 12 12 13 13 16 11 11 9 7 10 6 6 8 8 9 10 10 12 8 8 9 10 10 10 16 14 11 9 9 11 14 17 12 13 12 16 12 11 11 11 11 12 9 10 10 8 10 6 6 6 8 11 11 9 12 14 12 12 10 9 8 10 10 10 12 11 13 16 11 11 9 10 9 10 13 15 12 13 13 12 12 11 11 15 13 10 10 11 12 10 10 10 13 10 10 10 10 8 12 8 11 8 7 8 10 10 10 8 8 8 8 8 10 12 11 16 18 31 32 25 26 14 14 14 9 8 8 9 10 8 8 8 8 10 9 9 11 9 11 8 6 6 6 6 6 8 8 10 12 10 10 9 9 3 0	Open. Hide. 9 10 9 9 10 15 13 8 8 8 8 8 8 8 8 16 13 13 13 11 11 9 15 8 8 6 6 8 8 15 14 10 8 8 8 10 8 6 8 6 6 8 6 8 8 10 10 12 11 11 9 11 11 8 12 8 10 8 8 10 10 9 9 6 8 6 6 8 8 9 9 10 10 8 8 6 8 8 8 9 6 6 8 8 8 7 7 8 8 8 8 6 6 6 8 8 8 8 8 10 10 9 6 8 6 6 6 6 8 8 8 8 8 9 9 9 9 8 11 13 8 10 10 8 9 9 9 9 8 15 8 8 8 8 8 8 8 8 8 8 8 10 8 8 6 6 6 8 10 9 8 8 6 6 8 10 8 9 9 9 9 10 10 8 8 13 11 10 8 10 8 8 8 15 23 22 11 9 8 8 6 7 7 6 8 8 8 6 6 6 8 10 6 6 8 8 8 8 8 8 8 8 8 8 9 8 8 8 9 12 12 13 11 8 8 8 8 8 8 8 8 8 10 7 6 6 8 8 11 11 12 8 8 8 7 7 9 9 10 8 8 8 8 8 8 6 9 9 9 8 8 8 10 10 10 8 8 9 10 13 13 8 8 10 10 8 9 9 8 8 8 8 8 8 10 10 10 11 8 8 8 8 8 8 8 8 8 10 13 18 11 8 8 6 6 6 6 8 11 9 9 9 8 6 6 7 8 8 6 6 8 8 6 6 6 8 7 6 8 8 8 8 8 8 9 8 8 8 10 10 10 9 10 8 10 8 8 10 8 11 11 10 10 10 10 10 8 8 6 6 8 8 8 8 8 8 8 8 6 6 6 6 8 10 13 11 11 25 12 13 10 11 11 11 9 8 8 8 8 8 9 10 6 8 6 6 8 8 8 7 6 6 8 10 12 22 21 19 19 11 10 10 19 11 10 10 10 8 8 8 8 8 8 8 9 10 10 10 10 8 8 8 9 8 8 8 8 8 10 14 16 12 13 8 8 9 10 12 9 9 8 8 6 6 7 7 21 28 26 20 15 15 12 12 12 12 11 10 13 10 10 10 10 8 8 6 6 6 6 8 8 10 10 11 11 13 11 11 8 8 8 8 8 8 8 8 8 8 8 10 10 8 8 8 8 8 8 11 11 11 10 11 6 6 6 6 8 8 8 6 6 8 10 10 10 10 10 10 8 8 8 8 8 8 11 11 9 8 6 6 6 8 13 18 14 14 12 9 9 8 8 8 8 8 8 8 8 8 8 8 8 8 8 12 11 12 11 11 12 8 8 8 8 8 8 9 9 9 9 9 8 8 8 8 8 9 14 10 10 13 10 11 10 9 9 10 9 9 10 13 8 10 8 8 8 8 12 12 13 11 10 10 9 8 8 8 8 8 8 9 9 9 11 8 8 8 8 8 10 10 8 8 8 8 15 23 15 15 10 8 6 6 8 8 8 3 0 3 17 19 22 13 8 8 8 10 10 8 6 6 6 8 8 9 10 10 9 9 9 9 9 8 8 8 6 8 6 6 6 10 13 14 18 13 10 10 10 9 9 9 8 8 8 8 8 8 9 9 9 8 8 8 8 8 9 10 10 9 9 9 6 6 6 6 6 6 8 10 8 8 6 6 8 8 8 8 8 8 10 13 15 15 15 15 13 16 8 8 6 6 8 8 8 8 8 8 8 9 9 11 11 11 11 11 12 15 24 15 13 11 10 10 8 8 8 10 8 9 11 18 14 9 8 8 8 8 8 8 8 10 8 8 8 9 9 12 6 6 6 6 6 6 8 8 8 8 8 8 8 8 9 11 11 10 12 11 11 12 11 11 8 8 8 8 8 8 8 8 8 6 6 10 8 10 10 10 10 9 9 9 9 12 13 10 8 8 8 10 8 10 10 11 11 12 12 8 8 8 8 8 8 8 8 8 10 19 13 8 8 8 8 8 8 8 8 10 10 8 8 8 8

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no511_d03.b1 MSMg01no511_d03.b1 CHROMAT_FILE:
MSMg01no511_d03.b1 PHD_FILE: MSMg01no511_d03.b1.phd.1 CHEM: term DYE:
big TIME: Wed May 18 20:40:59 2005
         (135 letters)



>mm_chr7_6588388_6588922
          Length = 535

 Score =  244 bits (126), Expect = 2e-69
 Identities = 132/134 (98%)
 Strand = Plus / Plus

                                                                       
Query: 1   aggcaagttgagagggtgcagccacatggtagccatctgctgaacctgccaagggactgg 60
           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 201 aggcaagttgagagggtgcaaccacatggtagccatctgctgaacctgccaagggactgg 260

                                                                       
Query: 61  atggctggtggaaagtgaatgctagttccaggcattctcaggagggacacctgccaggtg 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 261 atggctggtggaaagtgaatgctagttccaggcattctcaggagggacacctgccaggtg 320

                         
Query: 121 gcttatcaaagcta 134
           ||||| ||||||||
Sbjct: 321 gcttagcaaagcta 334


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 6
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 135
Length of database: 535
Length adjustment: 8
Effective length of query: 127
Effective length of database: 527
Effective search space:    66929
Effective search space used:    66929
X1: 7 (13.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 7 (14.4 bits)
S2: 7 (14.3 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information