MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-190E19
Chromosome	8 (Build37)
Map Location	126,499,537 - 126,598,256
singlet/doublet	doublet
Overlap gene	Abcb10, Taf5l, AK122209
Upstream gene	Spg7, Rpl13, Cpne7, Sult5a1, LOC100043251, Dpep1, Chmp1a, 4732415M23Rik, Cdk10, Spata2L, 1300018I17Rik, Zfp276, Fanca, Spire2, Tcf25, Mc1r, Tubb3, Def8, Afg3l1, Dbndd1, Gas8, Rn5s-ps1, Rhou, LOC100042484, LOC100042490, Rab4a, 1700054N08Rik, LOC100043296, Acta1, Nup133
Downstream gene	LOC100042530, LOC100042535, Galnt2, Pgbd5, Cog2, Agt, Capn9, 2310022B05Rik, Ttc13, Arv1, 2310031A18Rik, LOC668444, Trim67, 2810004N23Rik, Gnpat, Exoc8, Gm505, Egln1, Tsnax, Disc1
Link	Open Mouse BAC browser

Click to get alignment info.

name	Spg7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234847 MGI:2385906
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpl13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:270106 MGI:105922
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cpne7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102278 MGI:2142747
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sult5a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57429 MGI:1931463
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043251 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043251
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Dpep1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13479 MGI:94917
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chmp1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234852 MGI:1920159
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4732415M23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320869 MGI:2444920
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdk10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234854 MGI:2448549
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Spata2L (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78779 MGI:1926029
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1300018I17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72325 MGI:1914143
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 129 ESTs, 3 Proteins

name	Zfp276 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57247 MGI:1888495
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fanca (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14087 MGI:1341823
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Spire2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234857 MGI:2446256
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tcf25 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66855 MGI:1914105
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Mc1r (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17199 MGI:99456
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tubb3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22152 MGI:107813
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Def8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23854 MGI:1346331
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Afg3l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:114896 MGI:1928277
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dbndd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72185 MGI:1919435
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gas8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104346 MGI:1202386
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rn5s-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19805 MGI:99528
definition	note : 5S RNA, pseudogene 1 pseudo : _no_value

name	Rhou (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69581 MGI:1916831
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042484 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042484
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC100042490 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042490
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Rab4a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19341 MGI:105069
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700054N08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73420 MGI:1920670
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043296 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043296
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 28 ESTs, 2 Proteins pseudo : _no_value

name	Acta1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11459 MGI:87902
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nup133 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234865 MGI:2442620
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abcb10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56199 MGI:1860508
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Taf5l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102162 MGI:1919039
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AK122209 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382038 MGI:2681124
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042530 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042530
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC100042535 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042535
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	Galnt2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108148 MGI:894694
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pgbd5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209966 MGI:2429955
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cog2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76332 MGI:1923582
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Agt (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11606 MGI:87963
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Capn9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73647 MGI:1920897
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310022B05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69551 MGI:1916801
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ttc13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234875 MGI:2384573
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arv1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68865 MGI:1916115
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310031A18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69627 MGI:1916877
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668444 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668444
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Trim67 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330863 MGI:3045323
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 ESTs, 12 Proteins

name	2810004N23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66523 MGI:1913773
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gnpat (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14712 MGI:1343460
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Exoc8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102058 MGI:2142527
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm505 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244666 MGI:2685351
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 4 Proteins

name	Egln1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:112405 MGI:1932286
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tsnax (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53424 MGI:1855672
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Disc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244667 MGI:2447658
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Spg7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981976 GeneID:234847 MGI:2385906
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : spastic paraplegia 7 homolog (human) transcript_id : NM_153176.3

name	Rpl13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382665 GeneID:270106 MGI:105922
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein L13 transcript_id : NM_016738.3

name	Cpne7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:92373430 GeneID:102278 MGI:2142747
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : copine VII transcript_id : NM_170684.2

name	Sult5a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377411 GeneID:57429 MGI:1931463
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sulfotransferase family 5A, member 1 transcript_id : NM_020564.2

name	LOC100043251 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149259111 GeneID:100043251
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : hypothetical protein LOC100043251 transcript_id : XM_001480321.1

name	Dpep1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6681216 GeneID:13479 MGI:94917
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dipeptidase 1 (renal) transcript_id : NM_007876.1

name	Chmp1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133891733 GeneID:234852 MGI:1920159
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chromatin modifying protein 1A transcript_id : NM_145606.2

name	4732415M23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134948589 GeneID:320869 MGI:2444920
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4732415M23 gene transcript_id : NM_177279.4

name	Cdk10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37595743 GeneID:234854 MGI:2448549
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin-dependent kinase (CDC2-like) 10 transcript_id : NM_194446.1

name	Cdk10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37595739 GeneID:234854 MGI:2448549
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin-dependent kinase (CDC2-like) 10 transcript_id : NM_194444.1

name	Spata2L (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27753957 GeneID:78779 MGI:1926029
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : spermatogenesis associated 2-like transcript_id : NM_030176.2

name	1300018I17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149259113 GeneID:72325 MGI:1914143
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 129 ESTs, 3 Proteins product : RIKEN cDNA 1300018I17 gene, transcript variant 7 transcript_id : XM_902711.3

name	Zfp276 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10048419 GeneID:57247 MGI:1888495
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein (C2H2 type) 276 transcript_id : NM_020497.1

name	Fanca (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366102 GeneID:14087 MGI:1341823
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Fanconi anemia, complementation group A transcript_id : NM_016925.2

name	Spire2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982562 GeneID:234857 MGI:2446256
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : spire homolog 2 (Drosophila) transcript_id : NM_172287.2

name	Tcf25 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83776564 GeneID:66855 MGI:1914105
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transcription factor 25 (basic helix-loop-helix) transcript_id : NM_025804.2

name	Tcf25 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385557 GeneID:66855 MGI:1914105
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transcription factor 25 (basic helix-loop-helix) transcript_id : NM_001037878.2

name	Tcf25 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131030 GeneID:66855 MGI:1914105
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transcription factor 25 (basic helix-loop-helix) transcript_id : NM_001037877.2

name	Mc1r (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124339840 GeneID:17199 MGI:99456
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : melanocortin 1 receptor transcript_id : NM_008559.2

name	Tubb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982671 GeneID:22152 MGI:107813
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tubulin, beta 3 transcript_id : NM_023279.2

name	Def8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366853 GeneID:23854 MGI:1346331
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : differentially expressed in FDCP 8 transcript_id : NM_054046.3

name	Afg3l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:66792805 GeneID:114896 MGI:1928277
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : AFG3(ATPase family gene 3)-like 1 (yeast) transcript_id : NM_054070.2

name	Dbndd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348942 GeneID:72185 MGI:1919435
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dysbindin (dystrobrevin binding protein 1) domain containing 1 transcript_id : NM_028146.2

name	Gas8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126157524 GeneID:104346 MGI:1202386
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : growth arrest specific 8 transcript_id : NM_018855.2

name	Rhou (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142380453 GeneID:69581 MGI:1916831
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ras homolog gene family, member U transcript_id : NM_133955.2

name	LOC100042484 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149259066 GeneID:100042484
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100042484 transcript_id : XM_001478300.1

name	LOC100042490 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149259068 GeneID:100042490
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100042490 transcript_id : XM_001478310.1

name	Rab4a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388506 GeneID:19341 MGI:105069
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB4A, member RAS oncogene family transcript_id : NM_009003.2

name	1700054N08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625951 GeneID:73420 MGI:1920670
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700054N08 gene transcript_id : NM_028536.1

name	Acta1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893192 GeneID:11459 MGI:87902
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : actin, alpha 1, skeletal muscle transcript_id : NM_009606.2

name	Nup133 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:26986606 GeneID:234865 MGI:2442620
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleoporin 133 transcript_id : NM_172288.1

name	Abcb10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:66932950 GeneID:56199 MGI:1860508
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP-binding cassette, sub-family B (MDR/TAP), member 10 transcript_id : NM_019552.2

name	Taf5l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129904 GeneID:102162 MGI:1919039
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor transcript_id : NM_133966.2

name	AK122209 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71274161 GeneID:382038 MGI:2681124
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence AK122209 transcript_id : NM_001029876.1

name	LOC100042535 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149259070 GeneID:100042535
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : similar to reproductive homeobox on X chromosome 8 transcript_id : XM_001478390.1

name	Galnt2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46877108 GeneID:108148 MGI:894694
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 2 transcript_id : NM_139272.2

name	Pgbd5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:67782366 GeneID:209966 MGI:2429955
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : piggyBac transposable element derived 5 transcript_id : NM_171824.2

name	Cog2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24475693 GeneID:76332 MGI:1923582
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : component of oligomeric golgi complex 2 transcript_id : NM_029746.2

name	Agt (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113461997 GeneID:11606 MGI:87963
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : angiotensinogen (serpin peptidase inhibitor, clade A, member 8) transcript_id : NM_007428.3

name	Capn9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352341 GeneID:73647 MGI:1920897
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calpain 9 (nCL-4) transcript_id : NM_023709.3

name	2310022B05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42475991 GeneID:69551 MGI:1916801
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310022B05 gene transcript_id : NM_175149.3

name	Ttc13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352053 GeneID:234875 MGI:2384573
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tetratricopeptide repeat domain 13 transcript_id : NM_145607.3

name	Arv1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802810 GeneID:68865 MGI:1916115
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ARV1 homolog (yeast) transcript_id : NM_026855.2

name	2310031A18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487446 GeneID:69627 MGI:1916877
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310031A18 gene transcript_id : NM_001081120.1

name	Trim67 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149259116 GeneID:330863 MGI:3045323
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 ESTs, 2 Proteins product : tripartite motif-containing 67, transcript variant 1 transcript_id : XM_001480431.1

name	Trim67 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149259118 GeneID:330863 MGI:3045323
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 10 Proteins product : tripartite motif-containing 67, transcript variant 2 transcript_id : XM_001480436.1

name	Trim67 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149259120 GeneID:330863 MGI:3045323
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 9 Proteins product : tripartite motif-containing 67, transcript variant 3 transcript_id : XM_001480440.1

name	2810004N23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13385069 GeneID:66523 MGI:1913773
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2810004N23 gene transcript_id : NM_025615.1

name	Gnpat (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981733 GeneID:14712 MGI:1343460
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glyceronephosphate O-acyltransferase transcript_id : NM_010322.2

name	Exoc8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111160870 GeneID:102058 MGI:2142527
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : exocyst complex component 8 transcript_id : NM_198103.2

name	Gm505 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149259122 GeneID:244666 MGI:2685351
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 4 Proteins product : gene model 505, (NCBI) transcript_id : XM_001480455.1

name	Egln1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23956235 GeneID:112405 MGI:1932286
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : EGL nine homolog 1 (C. elegans) transcript_id : NM_053207.1

name	Tsnax (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130833 GeneID:53424 MGI:1855672
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : translin-associated factor X transcript_id : NM_016909.2

name	Disc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119874420 GeneID:244667 MGI:2447658
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : disrupted in schizophrenia 1 transcript_id : NM_174854.2

name	Disc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119874422 GeneID:244667 MGI:2447658
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : disrupted in schizophrenia 1 transcript_id : NM_174853.2

name	Spg7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981977 GeneID:234847 MGI:2385906
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004222 - metalloendopeptidase activity [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008089 - anterograde axon cargo transport [Evidence IMP]; GO:0007155 - cell adhesion [Evidence TAS]; GO:0007005 - mitochondrion organization and biogenesis [Evidence IMP]; GO:0030163 - protein catabolism [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA]; GO:0030155 - regulation of cell adhesion [Evidence TAS] codon_start : 1 exception : mismatches in translation note : paraplegin; cell matrix adhesion regulator; cell adhesion regulator product : spastic paraplegia 7 homolog protein_id : NP_694816.2

name	Rpl13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33186863 CCDS:CCDS22747.1 GeneID:270106 MGI:105922
definition	GO_component : GO:0005830 - cytosolic ribosome (sensu Eukaryota) [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0007046 - ribosome biogenesis [Evidence IEA] codon_start : 1 note : snoRNA MBII-202 product : ribosomal protein L13 protein_id : NP_058018.2

name	Cpne7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:25470894 CCDS:CCDS22748.1 GeneID:102278 MGI:2142747
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : copine 7 protein protein_id : NP_733785.1

name	Sult5a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10181192 CCDS:CCDS22749.1 GeneID:57429 MGI:1931463
definition	GO_function : GO:0008146 - sulfotransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : sulfotransferase-related protein SULT-X1; sulfotransferase related gene X1 product : sulfotransferase family 5A, member 1 protein_id : NP_065589.1

name	LOC100043251 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149259112 GeneID:100043251
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480371.1

name	Dpep1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681217 CCDS:CCDS22750.1 GeneID:13479 MGI:94917
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0016805 - dipeptidase activity [Evidence IEA]; GO:0008239 - dipeptidyl-peptidase activity [Evidence IEA]; GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004237 - membrane dipeptidase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : dipeptidase 1 (renal) protein_id : NP_031902.1

name	Chmp1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704220 GeneID:234852 MGI:1920159
definition	GO_component : GO:0000794 - condensed nuclear chromosome [Evidence ISS]; GO:0005769 - early endosome [Evidence ISS]; GO:0012505 - endomembrane system [Evidence ISS]; GO:0016020 - membrane [Evidence IEA]; GO:0005815 - microtubule organizing center [Evidence ISS]; GO:0016363 - nuclear matrix [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence ISS] [Evidence IPI] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0016458 - gene silencing [Evidence ISS]; GO:0007076 - mitotic chromosome condensation [Evidence ISS]; GO:0045749 - negative regulation of S phase of mitotic cell cycle [Evidence ISS]; GO:0045892 - negative regulation of transcription, DNA-dependent [Evidence ISS]; GO:0015031 - protein transport [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : procollagen (type III) N-endopeptidase protein_id : NP_663581.1

name	4732415M23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124301188 GeneID:320869 MGI:2444920
definition	codon_start : 1 product : hypothetical protein LOC320869 protein_id : NP_796253.2

name	Cdk10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37595744 CCDS:CCDS22751.1 GeneID:234854 MGI:2448549
definition	GO_component : GO:0005622 - intracellular [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; cyclin dependent kinase 10 product : cyclin-dependent kinase 10 isoform 1 protein_id : NP_919428.1

name	Cdk10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37595740 GeneID:234854 MGI:2448549
definition	GO_component : GO:0005622 - intracellular [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : non-AUG (CUG) translation initiation codon; isoform 2 is encoded by transcript variant 2; cyclin dependent kinase 10 product : cyclin-dependent kinase 10 isoform 2 protein_id : NP_919426.1 transl_except : (pos:125750247..125750249,aa:Met)

name	Spata2L (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27753958 CCDS:CCDS22752.1 GeneID:78779 MGI:1926029
definition	codon_start : 1 product : spermatogenesis associated 2-like protein_id : NP_084452.2

name	1300018I17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149259114 GeneID:72325 MGI:1914143
definition	codon_start : 1 product : hypothetical protein LOC72325 isoform 7 protein_id : XP_907804.3

name	Zfp276 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10048420 GeneID:57247 MGI:1888495
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc finger protein 276 protein_id : NP_065243.1

name	Fanca (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8393352 CCDS:CCDS22753.1 GeneID:14087 MGI:1341823
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006281 - DNA repair [Evidence IEA]; GO:0008585 - female gonad development [Evidence IMP]; GO:0008584 - male gonad development [Evidence IMP]; GO:0007140 - male meiosis [Evidence IMP]; GO:0042127 - regulation of cell proliferation [Evidence IMP]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 exception : mismatches in translation product : Fanconi anemia, complementation group A protein_id : NP_058621.1

name	Spire2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27151755 CCDS:CCDS22754.1 GeneID:234857 MGI:2446256
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : spir-2 protein protein_id : NP_758491.1

name	Tcf25 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83776561 GeneID:66855 MGI:1914105
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0003700 - transcription factor activity [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007507 - heart development [Evidence ISS]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; nuclear localized protein 1 product : nuclear localized protein 1 isoform a protein_id : NP_001032966.1

name	Tcf25 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83776565 GeneID:66855 MGI:1914105
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0003700 - transcription factor activity [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007507 - heart development [Evidence ISS]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; nuclear localized protein 1 product : nuclear localized protein 1 isoform b protein_id : NP_080080.2

name	Tcf25 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83776553 CCDS:CCDS22755.1 GeneID:66855 MGI:1914105
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0003700 - transcription factor activity [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007507 - heart development [Evidence ISS]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform c is encoded by transcript variant 3; nuclear localized protein 1 product : nuclear localized protein 1 isoform c protein_id : NP_001032967.1

name	Mc1r (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124339841 CCDS:CCDS22756.1 GeneID:17199 MGI:99456
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019233 - sensory perception of pain [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : tobacco darkening; extension recessive yellow product : melanocortin 1 receptor protein_id : NP_032585.2

name	Tubb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963615 CCDS:CCDS22757.1 GeneID:22152 MGI:107813
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA]; GO:0015630 - microtubule cytoskeleton [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0043234 - protein complex [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005200 - structural constituent of cytoskeleton [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007018 - microtubule-based movement [Evidence IEA]; GO:0007017 - microtubule-based process [Evidence IEA]; GO:0051258 - protein polymerization [Evidence IEA] codon_start : 1 product : tubulin, beta 3 protein_id : NP_075768.1

name	Def8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16905081 CCDS:CCDS22759.1 GeneID:23854 MGI:1346331
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : differentially expressed in FDCP 8 protein_id : NP_473387.1

name	Afg3l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66792806 CCDS:CCDS22760.1 GeneID:114896 MGI:1928277
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004222 - metalloendopeptidase activity [Evidence ISS] [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0030163 - protein catabolism [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : AFG3(ATPase family gene 3)-like 1 protein_id : NP_473411.2

name	Dbndd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13605926 CCDS:CCDS22761.1 GeneID:72185 MGI:1919435
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 product : dysbindin (dystrobrevin binding protein 1) domain containing 1 protein_id : NP_082422.1

name	Gas8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126157525 GeneID:104346 MGI:1202386
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0019861 - flagellum [Evidence IEA]; GO:0009434 - flagellum (sensu Eukaryota) [Evidence IDA]; GO:0005874 - microtubule [Evidence IEA] [Evidence IDA] GO_function : GO:0016829 - lyase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0030317 - sperm motility [Evidence TAS] [Evidence IEP] codon_start : 1 note : growth arrest specific 11; growth arrest specific protein 11; beta growth arrest specific protein 11 product : growth arrest specific 8 protein_id : NP_061343.2

name	Rhou (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19923060 CCDS:CCDS22762.1 GeneID:69581 MGI:1916831
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence IMP]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence IDA]; GO:0000082 - G1/S transition of mitotic cell cycle [Evidence IDA]; GO:0016601 - Rac protein signal transduction [Evidence IDA]; GO:0008360 - regulation of cell shape [Evidence IDA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 note : Wnt1 responsive Cdc42 homolog product : ras homolog gene family, member U protein_id : NP_598716.1

name	LOC100042484 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149259067 GeneID:100042484
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478350.1

name	LOC100042490 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149259069 GeneID:100042490
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478360.1

name	Rab4a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679595 GeneID:19341 MGI:105069
definition	GO_component : GO:0005768 - endosome [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008565 - protein transporter activity [Evidence IDA] GO_process : GO:0015031 - protein transport [Evidence IDA]; GO:0030100 - regulation of endocytosis [Evidence IDA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation function : roled in the intracellular vesicular transport, endocytosis or secretary process product : RAB4A, member RAS oncogene family protein_id : NP_033029.1

name	1700054N08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625952 CCDS:CCDS22763.1 GeneID:73420 MGI:1920670
definition	codon_start : 1 product : hypothetical protein LOC73420 protein_id : NP_082812.1

name	Acta1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33563240 CCDS:CCDS22764.1 GeneID:11459 MGI:87902
definition	GO_component : GO:0005884 - actin filament [Evidence ISS]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0001725 - stress fiber [Evidence ISS]; GO:0005865 - striated muscle thin filament [Evidence TAS] GO_function : GO:0043531 - ADP binding [Evidence ISS]; GO:0005524 - ATP binding [Evidence ISS] [Evidence IEA]; GO:0017022 - myosin binding [Evidence ISS]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] [Evidence IEA]; GO:0005200 - structural constituent of cytoskeleton [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA]; GO:0030240 - muscle thin filament assembly [Evidence ISS]; GO:0048741 - skeletal muscle fiber development [Evidence IDA] codon_start : 1 product : actin, alpha 1, skeletal muscle protein_id : NP_033736.1

name	Nup133 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26986607 CCDS:CCDS22765.1 GeneID:234865 MGI:2442620
definition	GO_component : GO:0005643 - nuclear pore [Evidence IEA] [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005487 - nucleocytoplasmic transporter activity [Evidence ISS]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006406 - mRNA export from nucleus [Evidence ISS]; GO:0015031 - protein transport [Evidence IEA]; GO:0050658 - RNA transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : nucleoporin 133 protein_id : NP_758492.1

name	Abcb10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9506367 CCDS:CCDS22766.1 GeneID:56199 MGI:1860508
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016887 - ATPase activity [Evidence IEA]; GO:0042626 - ATPase activity, coupled to transmembrane movement of substances [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005215 - transporter activity [Evidence ISS] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : Abc-mitochondrial erythroid; ATP-binding cassette, sub-family B (MDR/TAP), member 12 product : ATP-binding cassette, sub-family B, member 10 protein_id : NP_062425.1

name	Taf5l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527184 CCDS:CCDS22767.1 GeneID:102162 MGI:1919039
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor protein_id : NP_598727.1

name	AK122209 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71274162 CCDS:CCDS22768.1 GeneID:382038 MGI:2681124
definition	codon_start : 1 product : hypothetical protein LOC382038 protein_id : NP_001025047.1

name	LOC100042535 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149259071 GeneID:100042535
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478440.1

name	Galnt2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46877109 CCDS:CCDS22769.1 GeneID:108148 MGI:894694
definition	GO_component : GO:0005796 - Golgi lumen [Evidence TAS]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0004653 - polypeptide N-acetylgalactosaminyltransferase activity [Evidence ISS] [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006493 - protein amino acid O-linked glycosylation [Evidence ISS] codon_start : 1 note : ppGaNTase-T2 product : UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 2 protein_id : NP_644678.2

name	Pgbd5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:25777750 CCDS:CCDS22770.1 GeneID:209966 MGI:2429955
definition	codon_start : 1 product : piggyBac transposable element derived 5 protein_id : NP_741958.1

name	Cog2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:17921980 CCDS:CCDS22771.1 GeneID:76332 MGI:1923582
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007030 - Golgi organization and biogenesis [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : low density lipoprotein receptor defect C complementing product : component of oligomeric golgi complex 2 protein_id : NP_084022.1

name	Agt (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113461998 GeneID:11606 MGI:87963
definition	GO_component : GO:0005615 - extracellular space [Evidence IDA] GO_function : GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA]; GO:0031702 - type 1 angiotensin receptor binding [Evidence IDA]; GO:0031703 - type 2 angiotensin receptor binding [Evidence IPI] GO_process : GO:0002019 - angiotensin mediated regulation of renal output [Evidence IMP]; GO:0001998 - angiotensin mediated vasoconstriction during regulation of blood pressure [Evidence IDA]; GO:0048143 - astrocyte activation [Evidence IMP]; GO:0001568 - blood vessel development [Evidence IMP]; GO:0002035 - brain renin-angiotensin system [Evidence IDA]; GO:0007160 - cell-matrix adhesion [Evidence IMP]; GO:0042756 - drinking behavior [Evidence IMP]; GO:0008065 - establishment of blood-nerve barrier [Evidence IMP]; GO:0030198 - extracellular matrix organization and biogenesis [Evidence IMP]; GO:0042445 - hormone metabolism [Evidence IMP]; GO:0001822 - kidney development [Evidence IMP]; GO:0008285 - negative regulation of cell proliferation [Evidence IMP]; GO:0043524 - negative regulation of neuron apoptosis [Evidence IMP]; GO:0001543 - ovarian follicle rupture [Evidence IMP]; GO:0030432 - peristalsis [Evidence IMP]; GO:0040018 - positive regulation of body size [Evidence IMP]; GO:0045723 - positive regulation of fatty acid biosynthesis [Evidence IMP]; GO:0043410 - positive regulation of MAPKKK cascade [Evidence IMP]; GO:0046622 - positive regulation of organ size [Evidence IMP] [Evidence IDA]; GO:0001991 - regulation of blood pressure by circulatory renin-angiotensin [Evidence IMP]; GO:0050880 - regulation of blood vessel size [Evidence IEA]; GO:0001999 - renal response to blood flow during renin-angiotensin regulation of blood pressure [Evidence IMP]; GO:0002018 - renin-angiotensin regulation of aldosterone production [Evidence IMP]; GO:0009409 - response to cold [Evidence IMP]; GO:0051145 - smooth muscle cell differentiation [Evidence IMP] [Evidence IDA]; GO:0048659 - smooth muscle cell proliferation [Evidence IMP] [Evidence IDA]; GO:0001658 - ureteric bud branching [Evidence IMP] [Evidence IDA]; GO:0042310 - vasoconstriction [Evidence IEA] codon_start : 1 product : angiotensinogen protein_id : NP_031454.3

name	Capn9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18201861 GeneID:73647 MGI:1920897
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0004198 - calpain activity [Evidence IEA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : calpain 9 (nCL-4) protein_id : NP_076198.1

name	2310022B05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:42475992 CCDS:CCDS22773.1 GeneID:69551 MGI:1916801
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC69551 protein_id : NP_780358.2

name	Ttc13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124249339 GeneID:234875 MGI:2384573
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 product : tetratricopeptide repeat domain 13 protein_id : NP_663582.2

name	Arv1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312118 CCDS:CCDS22774.1 GeneID:68865 MGI:1916115
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006629 - lipid metabolism [Evidence IEA]; GO:0006665 - sphingolipid metabolism [Evidence IEA] codon_start : 1 product : ARV1 homolog protein_id : NP_081131.1

name	2310031A18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487447 GeneID:69627 MGI:1916877
definition	codon_start : 1 product : hypothetical protein LOC69627 protein_id : NP_001074589.1

name	Trim67 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149259117 GeneID:330863 MGI:3045323
definition	codon_start : 1 product : tripartite motif-containing 67 isoform 1 protein_id : XP_001480481.1

name	Trim67 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149259119 GeneID:330863 MGI:3045323
definition	codon_start : 1 product : tripartite motif-containing 67 isoform 2 protein_id : XP_001480486.1

name	Trim67 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149259121 GeneID:330863 MGI:3045323
definition	codon_start : 1 product : tripartite motif-containing 67 isoform 3 protein_id : XP_001480490.1

name	2810004N23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385070 CCDS:CCDS22775.1 GeneID:66523 MGI:1913773
definition	codon_start : 1 exception : mismatches in translation note : Ayu21-55Imeg; Gt(Ayu21)55Imeg product : hypothetical protein LOC66523 protein_id : NP_079891.1

name	Gnpat (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981734 CCDS:CCDS22776.1 GeneID:14712 MGI:1343460
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005782 - peroxisomal matrix [Evidence TAS]; GO:0005778 - peroxisomal membrane [Evidence IEA]; GO:0005777 - peroxisome [Evidence IEA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IDA]; GO:0016287 - glycerone-phosphate O-acyltransferase activity [Evidence IMP] [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0044255 - cellular lipid metabolism [Evidence IEA]; GO:0008611 - ether lipid biosynthesis [Evidence TAS] [Evidence IMP]; GO:0016044 - membrane organization and biogenesis [Evidence IMP]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : glyceronephosphate O-acyltransferase protein_id : NP_034452.2

name	Exoc8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37674218 CCDS:CCDS22777.1 GeneID:102058 MGI:2142527
definition	GO_component : GO:0000145 - exocyst [Evidence ISS] GO_function : GO:0035091 - phosphoinositide binding [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS]; GO:0017160 - Ral GTPase binding [Evidence ISS] GO_process : GO:0006887 - exocytosis [Evidence IEA] [Evidence ISS]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : exocyst complex component 8 protein_id : NP_932771.1

name	Gm505 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149259123 GeneID:244666 MGI:2685351
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480505.1

name	Egln1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956236 GeneID:112405 MGI:1932286
definition	GO_function : GO:0005506 - iron ion binding [Evidence IEA]; GO:0031418 - L-ascorbic acid binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016706 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors [Evidence IEA]; GO:0016702 - oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0019538 - protein metabolism [Evidence IEA] codon_start : 1 product : EGL nine homolog 1 protein_id : NP_444437.1

name	Tsnax (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8394490 CCDS:CCDS22778.1 GeneID:53424 MGI:1855672
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] codon_start : 1 product : translin-associated factor X protein_id : NP_058605.1

name	Disc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119874421 GeneID:244667 MGI:2447658
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : disrupted in schizophrenia 1 isoform 1 protein_id : NP_777279.2

name	Disc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119874423 GeneID:244667 MGI:2447658
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : disrupted in schizophrenia 1 isoform 2 protein_id : NP_777278.2

name	(CDS detail)
type	promoter
link
xref
definition	note : D box

name	LOC100042530 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042530
definition	number : 1 pseudo : _no_value

name	LOC668444 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668444
definition	number : 1 pseudo : _no_value

name	LOC668444 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668444
definition	number : 2 pseudo : _no_value

name	(CDS detail)
type	misc_binding
link
xref
definition	bound_moiety : Sp1

name	(CDS detail)
type	misc_binding
link
xref
definition	bound_moiety : Sp1

name	Rn5s-ps1 (CDS detail)
type	misc_feature
link	vega ensembl
xref
definition	note : 5S rRNA pseudogene pseudo : _no_value

name	LOC100043296 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149259115 GeneID:100043296
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 28 ESTs, 2 Proteins product : similar to ribosomal protein L35 pseudo : _no_value transcript_id : XR_034676.1

clone name	MSMg01-480F11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-144F09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-526M01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-105G16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-481N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-479E11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-122C03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-156M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-070M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-075A23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-409F01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-333M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-179F10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-377K24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-143G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-476F22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-528O05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-493E01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-475I20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381P18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-336P09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-546L23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536J17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-131O07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-389C13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-542B17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-411L21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-307H14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-178J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-397P15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505P15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-377B04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-462D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-394C24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-512H20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-214C01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-300M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-398P04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-343B23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-406N01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-366G09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-107D07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-086A16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-231O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-517I06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-089H06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-172G06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-333G22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-308J06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-380N05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-232G17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-389O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-500J08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-295O02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-478P10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-094N02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-369A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-539K10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-325O08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-144H18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-374I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-119D14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-133A01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-407P19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-133P19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-534B10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-481A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-384N18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-397P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-054H22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-074G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-093O11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-180N14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-069E23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-545J10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-345B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-160N18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416M06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-135H01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-489I06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-336K19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-347C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-371D02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-146N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-029C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172K05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092M18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149N19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081C18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-082H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274N11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-170F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040G10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205E08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138J03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-096F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091D15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154M17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-257D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-096N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258M24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234B19
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-190E19.b	B6Ng01-190E19.g
ACC	GA014089	GA014090
length	1,182	1,052
definition	B6Ng01-190E19.b	B6Ng01-190E19.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(126,597,105 - 126,598,256)	(126,499,537 - 126,500,591)
sequence	gaattcttatcctcctgcctccacctcccaaatgcacaaatgtgtgccaa cctgccttctttatgcagtactgggatcaaatgcagggcctcaagcaggc taggcaagtgctctaccgattctgctgtgtctcgagtcctctggttgtaa tttaactaaacgttatgcatgtctgtgaatcatgaatgcaaagaaaagaa cacccagtgttgtctttatgaaaaagtatagggaaggccgtgagaagacg ccatgaagcatggttgttaagataaatcactgtcagactgggagagcctg agacaataggagagggtagagaagtgctgaagacccttgccactgtccag gtgcactggtcacacgccttcaaattcttgctccacttcaaggaatgcca aactaaaacttttgttcaaatgatggatggcatatgtggcctacaaaaaa atgggagggtttggaactccagtcggaagtttgtcctccaagatgggacc tcagtctatcggtagattggcactcatgggtaaactataatgctgacctg ctttagggtgagcatgggaccgagcgagcctccccttcagtcaacaggta ctgtgttgtatttccatggtgctgagggttgagccaaggcctcagacaca acaggtgggaagacttccatccagccactgccccatcctctttttgtgtt ttgaaacaggatctcactaagttgcccaggctggccttgaacttgctacc ctccggcctctgcctcttgattggctgaatgacaggctttaacaggccag tatgctggctctgttcatgttggatgaaaagttgtcacaggacttggcac tcactaaatgttagttctttctcccacccactccctgcaccttgaaagct ggatttagttttaacacccaaatgccacccggtcctttgacatttcacca gtcagtgcgcactgctggggtgtcttcacttgcccccaccaagccagtgc tatttgcagaggatttgtcgaaccttgaaatgttgaggcctagcaacatg ccactggtggaggtttgtaagcaccacagcagaacctggggcctggggaa ggcatggagcgggaacctccacgtatgcgcgttcactccatggaaattat agaattcagcagcacttggccatccacgcatc	gaattccaagttcaaggccagcctggtctacccagccagttccaggccag ccatggttacacagtgagatacggtatggggggaaaaaaggaggctattt gactaaatctaaactcatccaagtatagttcatgtacttactaatttatt ctattatttaaaaacaaatttggctcccgacaggtcgcatgtgtacaccc acccaggggcaatctggattcaaaaatgaaagacacgcgtgcacacacac acacacacacacacacacacacacacgagtgtgccagttaatttttgaca agccgtgacttccctgaaggctgagtactcctaaaccttcccctgctacc ccagccccagtggggaagtggccattggccccttacctggattcttacat ggctggttggctttctctcctgcagcgcttatgtcccatccttctcccgg gagtcatggtgactccctccttccttccattcctaggcctcgaagaacca aatgtcccacctcagtctatctgcccagacactgactgttagctctttat tgatcgatcaaaaactaattggggacaaggacctttagcatttggacaca cggattcccgattttgggggccagattaattcaaagcattagaaccaatc ttcaacattttaagatttattttagtttacatgtatggaagttttgcctg catgcacgtatgtttagcatgtgcgtgtgcatgttggatctcctagataa agggttatgagtatttgtgagccacacatggatgccaggaaccaaaccca ggtcctctgcaagagcaaccagggctaagccatatctctggacctgactg atcgattgattgattgatttttttgtttgtttgtttgggttttttttttt ttttgagaacagggtttctctgtatagccctggcctgtcctgaactcact ttgtagacaggctggcctcgatcgtactcagaaatcggcctgcctctgcc tctgagtgctgtgataggattgcgccaccacgcccagcgaatgattgatt tt
quality values	Open. Hide. 47 15 16 18 58 58 58 54 62 47 62 62 62 62 62 62 62 62 62 62 62 39 21 62 62 62 62 62 42 42 62 62 62 62 62 59 59 59 56 56 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 59 62 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 54 62 62 54 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 59 62 62 62 59 59 59 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 54 62 62 62 59 59 62 62 62 62 62 59 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 59 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 54 62 62 62 62 54 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 54 46 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 54 58 39 58 58 54 58 58 52 58 58 54 58 58 58 42 39 58 58 54 36 58 54 58 54 58 49 58 54 58 58 31 41 58 51 52 50 58 53 50 58 51 51 49 58 49 54 49 58 58 53 58 58 54 58 52 50 51 58 58 47 41 41 58 58 58 52 58 51 58 58 39 18 58 47 50 58 58 58 46 49 38 33 54 43 58 50 58 58 53 51 46 58 46 53 53 32 58 51 50 37 58 53 51 58 51 58 50 40 41 28 54 51 50 37 29 58 51 37 41 53 51 13 22 51 58 54 54 41 41 43 38 53 40 54 51 50 58 58 58 58 58 46 42 49 52 58 58 58 47 52 54 47 44 34 40 54 35 32 53 54 53 45 49 41 39 51 37 54 49 52 36 34 31 49 39 54 52 45 41 51 32 49 51 49 39 53 38 39 46 51 45 52 44 30 22 46 47 53 35 28 34 46 25 33 46 45 52 45 51 47 41 41 46 46 41 41 26 29 44 39 30 53 40 51 45 40 45 40 29 34 26 47 32 45 51 28 19 47 32 39 21 51 31 34 32 27 34 31 33 37 40 53 40 51 29 53 40 32 47 32 32 31 31 31 43 31 42 35 27 33 29 31 51 51 51 33 32 31 42 42 31 36 23 31 29 18 45 32 24 30 31 31 23 31 24 32 36 38 32 33 30 21 47 37 32 43 29 31 37 32 42 31 30 21 47 28 30 34 36 46 31 28 27 46 25 28 33 27 31 48 31 31 32 31 29 27 28 23 27 31 35 47 30 26 31 31 31 36 19 20 47 29 27 24 38 48 48 41 22 32 30 30 32 46 16 27 41 30 31 37 28 31 23 30 41 25 17 31 31 26 15 12 37 30 30 32 15 14 34 48 31 32 31 21 25 32 31 33 34 36 19 23 32 24 18 26 23 22 31 32 27 31 31 48 48 34 23 24 18 32 19 32 27 22 33 20 29 15 19 29 30 34 22 18 23 30 15 24 29 20 19 18 13 22 30 22 19 7 13 43 15 16 21 18 14 33 10 11 32 17 48 23 18 20 26 17 32 15 11 12 15 16 12 24 40 24 7 6 4 18 11 24 6 18 9 11 24 27 13 28 5 3 4 15 27 15 22 10 8 16 10 15 10 15 16 17 12 7 10 19 28 7 6 10 20 28 12 25 7 8 8 8 19 24 7 11 17 8 24 18 6 10 17 13 21 28 7 9 11 19 17 17 22 8 16 13 8 15 12 13 20 10 6 8 7 18 8 21 17 16 15 9 7 12 5 7 4 7 5 12 12 10 21 4 7 4 18 6 8 21 7 5 6 8 9 6 7 5 7 5 3 4 17 7 5 4 4 4 4 8 8 5 18 8 8 12 14 4 6 7 8 5 7 7 2 2 2 4 17 10 23 9 7 2 1 2 17 9	Open. Hide. 62 47 54 47 62 62 39 31 62 62 62 51 44 44 24 38 49 32 35 59 59 62 62 62 62 62 59 62 59 62 62 62 59 59 62 62 59 59 62 62 62 62 59 59 62 62 62 59 59 62 62 59 59 62 59 62 62 59 62 62 62 62 59 62 59 59 59 59 59 62 62 59 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 62 62 59 62 62 62 54 62 59 59 59 59 62 62 62 62 59 62 62 62 62 62 62 59 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 54 59 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 44 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 42 62 54 44 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 47 42 62 62 62 62 62 62 62 62 62 62 50 44 62 62 62 47 39 62 62 62 43 62 52 62 54 62 62 62 62 62 54 39 50 58 52 58 54 58 34 45 58 58 58 58 54 58 40 58 58 52 58 58 58 58 52 52 52 54 47 54 26 54 45 39 35 54 49 35 58 58 50 52 52 54 58 52 42 58 54 52 54 52 54 54 54 58 52 46 34 33 41 50 37 58 58 27 39 58 52 49 50 58 51 50 50 58 58 43 49 52 54 58 48 46 50 40 51 58 40 50 41 58 50 58 51 42 50 54 51 54 43 39 39 39 53 40 29 53 53 50 50 52 50 51 52 52 51 44 58 50 51 41 50 52 41 51 50 53 49 51 53 58 32 52 49 26 39 58 51 46 39 50 39 31 39 53 53 49 35 49 22 35 42 38 52 50 35 44 44 42 42 40 40 37 44 20 39 30 29 54 41 54 53 37 53 17 37 51 32 42 42 40 32 24 17 44 24 32 34 24 25 28 26 37 54 14 16 41 31 52 40 41 51 29 32 53 34 31 37 46 33 45 31 32 28 22 27 23 41 13 30 15 12 9 33 32 45 53 46 31 36 31 45 8 46 30 31 34 33 38 34 31 31 31 31 36 31 31 26 31 34 42 31 20 37 37 27 37 17 37 19 31 37 35 21 31 46 32 18 33 22 28 20 46 46 43 46 41 32 35 10 37 26 46 26 32 29 29 17 38 21 39 41 25 30 32 31 39 31 36 38 37 39 46 36 37 41 28 31 31 19 11 10 32 9 8 15 41 25 21 44 7 14 9 17 25 31 16 25 18 21 9 23 41 6 8 21 31 11 12 20 30 22 24 35 13 5 5 5 18 16 23 6 10 14 32 22 7 5 18 22 33 28 19 5 19 24 7 7 13 10 9 23 14 15 30 31 28 8 6 21 9 7 7 30 8 33 48 22 26 32 8 10 30 21 17 30 18 12 16 9 22 21 14 10 22 23 7 9 16 5 10 22 10 6 15 4 4 20 3 5 3 5 11 7 13 27 11 11 12 20 5 8 27 5 9 4 3 10 5 16 7 5 6 6 6 8 16 13 11 9 8 14 17 6 6 16

Alignment Information

BAC End 1

BAC End 2

seq1: chr8_126597105_126598256
seq2: B6Ng01-190E19.b_64_1224 (reverse)

seq1  GATGCCGTGGATGGCC-AGTGCTGCTGTA-TCTATAAACT-CAT-GAGTG  46
      |||| ||||||||||| |||||||||| | |||||||  | ||| |||||
seq2  GATG-CGTGGATGGCCAAGTGCTGCTGAATTCTATAATTTCCATGGAGTG  49

seq1  ACCGC-CATACGTG--AGTTCCCGCTCCATGCCTTCCCCAGG-CCCAGGT  92
      | ||| ||||||||   ||||||||||||||||||||||||| |||||||
seq2  AACGCGCATACGTGGAGGTTCCCGCTCCATGCCTTCCCCAGGCCCCAGGT  99

seq1  TCTGCTGTGGTGCTTACAAACCTCCA-CAGTGGCATG-TGCTAGGCCTCA  140
      |||||||||||||||||||||||||| |||||||||| ||||||||||||
seq2  TCTGCTGTGGTGCTTACAAACCTCCACCAGTGGCATGTTGCTAGGCCTCA  149

seq1  ACATTTCAAGGTTCGACAAATCCTCTGCAAATAGCACTGGCTTGGTGGGG  190
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATTTCAAGGTTCGACAAATCCTCTGCAAATAGCACTGGCTTGGTGGGG  199

seq1  GCAAGTGAAGACACCCCAGCAGTGCGCACTGACTGGTGAAATGTCAAAGG  240
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAAGTGAAGACACCCCAGCAGTGCGCACTGACTGGTGAAATGTCAAAGG  249

seq1  ACCGGGTGGCATTTGGGTGTTAAAACTAAATCCAGCTTTCAAGGTGCAGG  290
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCGGGTGGCATTTGGGTGTTAAAACTAAATCCAGCTTTCAAGGTGCAGG  299

seq1  GAGTGGGTGGGAGAAAGAACTAACATTTAGTGAGTGCCAAGTCCTGTGAC  340
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGTGGGTGGGAGAAAGAACTAACATTTAGTGAGTGCCAAGTCCTGTGAC  349

seq1  AACTTTTCATCCAACATGAACAGAGCCAGCATACTGGCCTGTTAAAGCCT  390
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACTTTTCATCCAACATGAACAGAGCCAGCATACTGGCCTGTTAAAGCCT  399

seq1  GTCATTCAGCCAATCAAGAGGCAGAGGCCGGAGGGTAGCAAGTTCAAGGC  440
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCATTCAGCCAATCAAGAGGCAGAGGCCGGAGGGTAGCAAGTTCAAGGC  449

seq1  CAGCCTGGGCAACTTAGTGAGATCCTGTTTCAAAACACAAAAAGAGGATG  490
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCCTGGGCAACTTAGTGAGATCCTGTTTCAAAACACAAAAAGAGGATG  499

seq1  GGGCAGTGGCTGGATGGAAGTCTTCCCACCTGTTGTGTCTGAGGCCTTGG  540
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGCAGTGGCTGGATGGAAGTCTTCCCACCTGTTGTGTCTGAGGCCTTGG  549

seq1  CTCAACCCTCAGCACCATGGAAATACAACACAGTACCTGTTGACTGAAGG  590
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCAACCCTCAGCACCATGGAAATACAACACAGTACCTGTTGACTGAAGG  599

seq1  GGAGGCTCGCTCGGTCCCATGCTCACCCTAAAGCAGGTCAGCATTATAGT  640
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAGGCTCGCTCGGTCCCATGCTCACCCTAAAGCAGGTCAGCATTATAGT  649

seq1  TTACCCATGAGTGCCAATCTACCGATAGACTGAGGTCCCATCTTGGAGGA  690
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTACCCATGAGTGCCAATCTACCGATAGACTGAGGTCCCATCTTGGAGGA  699

seq1  CAAACTTCCGACTGGAGTTCCAAACCCTCCCATTTTTTTGTAGGCCACAT  740
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAACTTCCGACTGGAGTTCCAAACCCTCCCATTTTTTTGTAGGCCACAT  749

seq1  ATGCCATCCATCATTTGAACAAAAGTTTTAGTTTGGCATTCCTTGAAGTG  790
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGCCATCCATCATTTGAACAAAAGTTTTAGTTTGGCATTCCTTGAAGTG  799

seq1  GAGCAAGAATTTGAAGGCGTGTGACCAGTGCACCTGGACAGTGGCAAGGG  840
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGCAAGAATTTGAAGGCGTGTGACCAGTGCACCTGGACAGTGGCAAGGG  849

seq1  TCTTCAGCACTTCTCTACCCTCTCCTATTGTCTCAGGCTCTCCCAGTCTG  890
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTCAGCACTTCTCTACCCTCTCCTATTGTCTCAGGCTCTCCCAGTCTG  899

seq1  ACAGTGATTTATCTTAACAACCATGCTTCATGGCGTCTTCTCACGGCCTT  940
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGTGATTTATCTTAACAACCATGCTTCATGGCGTCTTCTCACGGCCTT  949

seq1  CCCTATACTTTTTCATAAAGACAACACTGGGTGTTCTTTTCTTTGCATTC  990
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTATACTTTTTCATAAAGACAACACTGGGTGTTCTTTTCTTTGCATTC  999

seq1  ATGATTCACAGACATGCATAACGTTTAGTTAAATTACAACCAGAGGACTC  1040
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGATTCACAGACATGCATAACGTTTAGTTAAATTACAACCAGAGGACTC  1049

seq1  GAGACACAGCAGAATCGGTAGAGCACTTGCCTAGCCTGCTTGAGGCCCTG  1090
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGACACAGCAGAATCGGTAGAGCACTTGCCTAGCCTGCTTGAGGCCCTG  1099

seq1  CATTTGATCCCAGTACTGCATAAAGAAGGCAGGTTGGCACACATTTGTGC  1140
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATTTGATCCCAGTACTGCATAAAGAAGGCAGGTTGGCACACATTTGTGC  1149

seq1  ATTTGGGAGGTG  1152
      ||||||||||||
seq2  ATTTGGGAGGTG  1161

seq1: chr8_126499537_126500591
seq2: B6Ng01-190E19.g_66_1117

seq1  GAATTCCAAGTTCAAGGCCAGCCTGGTCTACCCAGCCAGTTCCAGGCCAG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCAAGTTCAAGGCCAGCCTGGTCTACCCAGCCAGTTCCAGGCCAG  50

seq1  CCATGGTTACACAGTGAGATACGGTATGGGGGGAAAAAAGGAGGCTATTT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCATGGTTACACAGTGAGATACGGTATGGGGGGAAAAAAGGAGGCTATTT  100

seq1  GACTAAATCTAAACTCATCCAAGTATAGTTCATGTACTTACTAATTTATT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACTAAATCTAAACTCATCCAAGTATAGTTCATGTACTTACTAATTTATT  150

seq1  CTATTATTTAAAAACAAATTTGGCTCCCGACAGGTCGCATGTGTACACCC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTATTATTTAAAAACAAATTTGGCTCCCGACAGGTCGCATGTGTACACCC  200

seq1  ACCCAGGGGCAATCTGGATTCAAAAATGAAAGACACGCGTGCACACACAC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCCAGGGGCAATCTGGATTCAAAAATGAAAGACACGCGTGCACACACAC  250

seq1  ACACACACACACACACACACACACACGAGTGTGCCAGTTAATTTTTGACA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACACACACACACACACACACACACACGAGTGTGCCAGTTAATTTTTGACA  300

seq1  AGCCGTGACTTCCCTGAAGGCTGAGTACTCCTAAACCTTCCCCTGCTACC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCCGTGACTTCCCTGAAGGCTGAGTACTCCTAAACCTTCCCCTGCTACC  350

seq1  CCAGCCCCAGTGGGGAAGTGGCCATTGGCCCCTTACCTGGATTCTTACAT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGCCCCAGTGGGGAAGTGGCCATTGGCCCCTTACCTGGATTCTTACAT  400

seq1  GGCTGGTTGGCTTTCTCTCCTGCAGCGCTTATGTCCCATCCTTCTCCCGG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCTGGTTGGCTTTCTCTCCTGCAGCGCTTATGTCCCATCCTTCTCCCGG  450

seq1  GAGTCATGGTGACTCCCTCCTTCCTTCCATTCCTAGGCCTCGAAGAACCA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGTCATGGTGACTCCCTCCTTCCTTCCATTCCTAGGCCTCGAAGAACCA  500

seq1  AATGTCCCACCTCAGTCTATCTGCCCAGACACTGACTGTTAGCTCTTTAT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATGTCCCACCTCAGTCTATCTGCCCAGACACTGACTGTTAGCTCTTTAT  550

seq1  TGATCGATCAAAAACTAATTGGGGACAAGGACCTTTAGCATTTGGACACA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGATCGATCAAAAACTAATTGGGGACAAGGACCTTTAGCATTTGGACACA  600

seq1  CGGATTCCCGATTTTGGGGGCCAGATTAATTCAAAGCATTAGAACCAATC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGGATTCCCGATTTTGGGGGCCAGATTAATTCAAAGCATTAGAACCAATC  650

seq1  TTCAACATTTTAAGATTTATTTTAGTTTACATGTATGGAAGTTTTGCCTG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCAACATTTTAAGATTTATTTTAGTTTACATGTATGGAAGTTTTGCCTG  700

seq1  CATGCACGTATGTTTAGCATGTGCGTGTGCATGTTGGATCTCCTAGATAA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGCACGTATGTTTAGCATGTGCGTGTGCATGTTGGATCTCCTAGATAA  750

seq1  AGGGTTATGAGTATTTGTGAGCCACACATGGATGCCAGGAACCAAACCCA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGGTTATGAGTATTTGTGAGCCACACATGGATGCCAGGAACCAAACCCA  800

seq1  GGTCCTCTGCAAGAGCAACCAGGGCTAAGCCATATCTCTGGACCTGACTG  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTCCTCTGCAAGAGCAACCAGGGCTAAGCCATATCTCTGGACCTGACTG  850

seq1  ATCGATTGATTGATTGATTTTTTTGTTTGTTTGTTTGGG-TTTTTTTTTT  899
      ||||||||||||||||||||||||||||||||||||||| ||||||||||
seq2  ATCGATTGATTGATTGATTTTTTTGTTTGTTTGTTTGGGTTTTTTTTTTT  900

seq1  TTTTGAG-ACAGGGTTTCTCTGTATAGCCCTGG-CTGTCCTGGAACTCAC  947
      ||||||| ||||||||||||||||||||||||| ||||||| ||||||||
seq2  TTTTGAGAACAGGGTTTCTCTGTATAGCCCTGGCCTGTCCT-GAACTCAC  949

seq1  TTTGTAGACCAGGCTGGCCTCGATCGAACTCAGAAATCCGCCTGCCTCTG  997
      |||||||| ||||||||||||||||| ||||||||||| |||||||||||
seq2  TTTGTAGA-CAGGCTGGCCTCGATCGTACTCAGAAATCGGCCTGCCTCTG  998

seq1  CCTCCTGAGTGCTGGGATTAAAGGAGTGCGCCACCACGCCCAGCGATTGA  1047
      ||| |||||||||| |||   |||| |||||||||||||||||||| |||
seq2  CCT-CTGAGTGCTGTGAT---AGGATTGCGCCACCACGCCCAGCGAATGA  1044

seq1  TTGATTTT  1055
      ||||||||
seq2  TTGATTTT  1052

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information