MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-233G04
Chromosome	8 (Build37)
Map Location	124,436,741 - 124,573,081
singlet/doublet	doublet
Overlap gene	BC048644, Car5a, Banp
Upstream gene	LOC100042333, Foxf1a, Mthfsd, Foxc2, Foxl1, 1700018B08Rik, Fbxo31, Map1lc3b, Zcchc14, Jph3, Klhdc4, Slc7a5
Downstream gene	Gm22, Zfpm1, Trhr2, 5830416A07Rik, Il17c, Cyba, Mvd, Snai3, Rnf166, 2310061F22Rik, Cdt1, Aprt, Galns, Trappc2l, Pabpnl1, Cbfa2t3h, C230057M02Rik, A530010L16Rik, BC021611, LOC100043225, Cdh15, Ankrd11
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100042333 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042333
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Foxf1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15227 MGI:1347470
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mthfsd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234814 MGI:2679252
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Foxc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14234 MGI:1347481
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Foxl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14241 MGI:1347469
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700018B08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76405 MGI:1923655
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fbxo31 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76454 MGI:1354708
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Map1lc3b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67443 MGI:1914693
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zcchc14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:142682 MGI:2159407
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Jph3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57340 MGI:1891497
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klhdc4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234825 MGI:2384569
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc7a5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20539 MGI:1298205
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC048644 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:407789 MGI:3039566
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Car5a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12352 MGI:101946
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Banp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53325 MGI:1889023
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm22 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:195209 MGI:2684868
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 11 ESTs, 1 Protein

name	Zfpm1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22761 MGI:1095400
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trhr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170732 MGI:2177284
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5830416A07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76014 MGI:1923264
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Il17c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234836 MGI:2446486
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 Proteins

name	Cyba (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13057 MGI:1316658
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mvd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192156 MGI:2179327
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snai3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30927 MGI:1353563
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnf166 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68718 MGI:1915968
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310061F22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66965 MGI:1914215
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67177 MGI:1914427
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aprt (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11821 MGI:88061
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Galns (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50917 MGI:1355303
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trappc2l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59005 MGI:1916295
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pabpnl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382035 MGI:2685954
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cbfa2t3h (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12398 MGI:1338013
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C230057M02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319463 MGI:2442079
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs

name	A530010L16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382036 MGI:3037766
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	BC021611 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257633 MGI:2182591
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043225 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043225
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 358 ESTs, 6 Proteins

name	Cdh15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12555 MGI:106672
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ankrd11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77087 MGI:1924337
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042333 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149259056 GeneID:100042333
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to Ubtf protein transcript_id : XM_001477969.1

name	Foxf1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753901 GeneID:15227 MGI:1347470
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : forkhead box F1a transcript_id : NM_010426.1

name	Mthfsd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372291 GeneID:234814 MGI:2679252
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : methenyltetrahydrofolate synthetase domain containing transcript_id : NM_172761.2

name	Foxc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:8850212 GeneID:14234 MGI:1347481
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : forkhead box C2 transcript_id : NM_013519.1

name	Foxl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120952617 GeneID:14241 MGI:1347469
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : forkhead box L1 transcript_id : NM_008024.2

name	1700018B08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21313189 GeneID:76405 MGI:1923655
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700018B08 gene transcript_id : NM_029597.1

name	Fbxo31 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981580 GeneID:76454 MGI:1354708
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box protein 31 transcript_id : NM_133765.2

name	Map1lc3b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801716 GeneID:67443 MGI:1914693
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : microtubule-associated protein 1 light chain 3 beta transcript_id : NM_026160.2

name	Zcchc14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:18252797 GeneID:142682 MGI:2159407
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, CCHC domain containing 14 transcript_id : NM_080855.1

name	Jph3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130503 GeneID:57340 MGI:1891497
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : junctophilin 3 transcript_id : NM_020605.2

name	Klhdc4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21704209 GeneID:234825 MGI:2384569
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kelch domain containing 4 transcript_id : NM_145605.1

name	Slc7a5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982763 GeneID:20539 MGI:1298205
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 7 (cationic amino acid transporter, y+ system), member 5 transcript_id : NM_011404.2

name	BC048644 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803107 GeneID:407789 MGI:3039566
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC048644 transcript_id : NM_001033485.2

name	Car5a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112181174 GeneID:12352 MGI:101946
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : carbonic anhydrase 5a, mitochondrial transcript_id : NM_007608.2

name	Banp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124248563 GeneID:53325 MGI:1889023
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Btg3 associated nuclear protein transcript_id : NM_016812.2

name	Gm22 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94383858 GeneID:195209 MGI:2684868
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 11 ESTs, 1 Protein product : gene model 22, (NCBI) transcript_id : XM_111398.7

name	Zfpm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144227234 GeneID:22761 MGI:1095400
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein, multitype 1 transcript_id : NM_009569.2

name	Trhr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131032 GeneID:170732 MGI:2177284
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thyrotropin releasing hormone receptor 2 transcript_id : NM_133202.2

name	5830416A07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71979670 GeneID:76014 MGI:1923264
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5830416A07 gene transcript_id : NM_001029993.1

name	5830416A07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71725354 GeneID:76014 MGI:1923264
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5830416A07 gene transcript_id : NM_001029994.1

name	Il17c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149259062 GeneID:234836 MGI:2446486
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 Proteins product : interleukin 17C transcript_id : XM_001478158.1

name	Cyba (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802423 GeneID:13057 MGI:1316658
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome b-245, alpha polypeptide transcript_id : NM_007806.2

name	Mvd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20149735 GeneID:192156 MGI:2179327
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mevalonate (diphospho) decarboxylase transcript_id : NM_138656.1

name	Snai3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560481 GeneID:30927 MGI:1353563
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : snail homolog 3 (Drosophila) transcript_id : NM_013914.2

name	Rnf166 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131145 GeneID:68718 MGI:1915968
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger protein 166 transcript_id : NM_001033142.2

name	2310061F22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24418873 GeneID:66965 MGI:1914215
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310061F22 gene transcript_id : NM_153775.1

name	Cdt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982545 GeneID:67177 MGI:1914427
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chromatin licensing and DNA replication factor 1 transcript_id : NM_026014.3

name	Aprt (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118601012 GeneID:11821 MGI:88061
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adenine phosphoribosyl transferase transcript_id : NM_009698.2

name	Galns (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980653 GeneID:50917 MGI:1355303
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : galactosamine (N-acetyl)-6-sulfate sulfatase transcript_id : NM_016722.2

name	Trappc2l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10946913 GeneID:59005 MGI:1916295
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : trafficking protein particle complex 2-like transcript_id : NM_021502.1

name	Pabpnl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:55925590 GeneID:382035 MGI:2685954
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : poly(A)binding protein nuclear-like 1 transcript_id : NM_001007462.1

name	Cbfa2t3h (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753301 GeneID:12398 MGI:1338013
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : core-binding factor, runt domain, alpha subunit 2, translocated to, 3 homolog (human) transcript_id : NM_009824.1

name	C230057M02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149259064 GeneID:319463 MGI:2442079
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs product : RIKEN cDNA C230057M02 gene transcript_id : XM_001478205.1

name	A530010L16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149259107 GeneID:382036 MGI:3037766
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : RIKEN cDNA A530010L16 gene transcript_id : XM_001480265.1

name	BC021611 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113199774 GeneID:257633 MGI:2182591
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC021611 transcript_id : NM_144932.3

name	LOC100043225 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149259109 GeneID:100043225
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 358 ESTs, 6 Proteins product : similar to Eukaryotic translation initiation factor 1 (eIF1) (Protein translation factor SUI1 homolog) transcript_id : XM_001480268.1

name	Cdh15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119964693 GeneID:12555 MGI:106672
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cadherin 15 transcript_id : NM_007662.2

name	Ankrd11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487032 GeneID:77087 MGI:1924337
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat domain 11 transcript_id : NM_001081379.1

name	LOC100042333 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149259057 GeneID:100042333
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478019.1

name	Foxf1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753902 CCDS:CCDS22722.1 GeneID:15227 MGI:1347470
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0048566 - embryonic gut development [Evidence IGI]; GO:0045198 - establishment of epithelial cell polarity [Evidence IGI]; GO:0030198 - extracellular matrix organization and biogenesis [Evidence IGI]; GO:0030324 - lung development [Evidence IMP]; GO:0009887 - organ morphogenesis [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0001570 - vasculogenesis [Evidence IMP] codon_start : 1 note : HNF-3/forkhead homolog 8 product : forkhead box F1a protein_id : NP_034556.1

name	Mthfsd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370130 CCDS:CCDS22723.1 GeneID:234814 MGI:2679252
definition	GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : methenyltetrahydrofolate synthetase domain containing protein_id : NP_766349.1

name	Foxc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8850213 GeneID:14234 MGI:1347481
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] [Evidence IC]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0016563 - transcriptional activator activity [Evidence IDA] GO_process : GO:0048468 - cell development [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0007507 - heart development [Evidence IGI]; GO:0001656 - metanephros development [Evidence IMP]; GO:0001569 - patterning of blood vessels [Evidence IGI]; GO:0045893 - positive regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : forkhead homolog 14 product : forkhead box C2 protein_id : NP_038547.1

name	Foxl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120952618 GeneID:14241 MGI:1347469
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence TAS] GO_process : GO:0009887 - organ morphogenesis [Evidence IMP]; GO:0030166 - proteoglycan biosynthesis [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence TAS]; GO:0030111 - regulation of Wnt receptor signaling pathway [Evidence IMP]; GO:0006350 - transcription [Evidence IEA]; GO:0007495 - visceral mesoderm-endoderm interaction [Evidence IMP] codon_start : 1 note : forkhead homolog 6 product : forkhead box L1 protein_id : NP_032050.2

name	1700018B08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313190 GeneID:76405 MGI:1923655
definition	codon_start : 1 product : hypothetical protein LOC76405 protein_id : NP_083873.1

name	Fbxo31 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981581 GeneID:76454 MGI:1354708
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation note : F-box only protein 14 product : F-box only protein 31 protein_id : NP_598526.2

name	Map1lc3b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385664 CCDS:CCDS22726.1 GeneID:67443 MGI:1914693
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA]; GO:0005773 - vacuole [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006914 - autophagy [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : microtubule-associated protein 1 light chain 3 beta protein_id : NP_080436.1

name	Zcchc14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18252798 CCDS:CCDS22727.1 GeneID:142682 MGI:2159407
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : BDG-29 protein protein_id : NP_543131.1

name	Jph3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10181142 CCDS:CCDS22728.1 GeneID:57340 MGI:1891497
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence TAS]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IDA] GO_process : GO:0040011 - locomotion [Evidence IMP] codon_start : 1 note : junctophilin type 3 product : junctophilin 3 protein_id : NP_065630.1

name	Klhdc4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704210 CCDS:CCDS22729.1 GeneID:234825 MGI:2384569
definition	codon_start : 1 exception : mismatches in translation product : kelch domain containing 4 protein_id : NP_663580.1

name	Slc7a5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982764 CCDS:CCDS22730.1 GeneID:20539 MGI:1298205
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015359 - amino acid permease activity [Evidence IEA]; GO:0015171 - amino acid transporter activity [Evidence IEA]; GO:0005279 - amino acid-polyamine transporter activity [Evidence IEA]; GO:0005386 - carrier activity [Evidence IEA]; GO:0015179 - L-amino acid transporter activity [Evidence IDA] GO_process : GO:0006865 - amino acid transport [Evidence IEA]; GO:0015807 - L-amino acid transport [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : solute carrier family 7 (cationic amino acid transporter, y+ system), member 5 protein_id : NP_035534.2

name	Car5a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112181175 CCDS:CCDS22731.1 GeneID:12352 MGI:101946
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0004089 - carbonate dehydratase activity [Evidence IDA]; GO:0016829 - lyase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006094 - gluconeogenesis [Evidence TAS]; GO:0006730 - one-carbon compound metabolism [Evidence IEA] codon_start : 1 note : carbonic anhydrase 5, mitochondrial; carbonic anhydrase 5b, mitochondrial product : carbonic anhydrase 5a, mitochondrial protein_id : NP_031634.2

name	BC048644 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702019 GeneID:407789 MGI:3039566
definition	codon_start : 1 product : hypothetical protein LOC407789 protein_id : NP_001028657.1

name	Banp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124248564 GeneID:53325 MGI:1889023
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : Btg3 associated nuclear protein protein_id : NP_058092.2

name	Gm22 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94383859 GeneID:195209 MGI:2684868
definition	codon_start : 1 product : similar to KIAA1858 protein protein_id : XP_111398.6

name	Zfpm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677633 CCDS:CCDS22733.1 GeneID:22761 MGI:1095400
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003714 - transcription corepressor activity [Evidence TAS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007507 - heart development [Evidence IMP]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence TAS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : Friend of GATA-1 product : zinc finger protein, multitype 1 protein_id : NP_033595.1

name	Trhr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18875348 CCDS:CCDS22734.1 GeneID:170732 MGI:2177284
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0001615 - thyrotropin releasing hormone and secretagogue-like receptors activity [Evidence IDA] GO_process : GO:0007200 - G-protein signaling, coupled to IP3 second messenger (phospholipase C activating) [Evidence IDA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : thyrotropin releasing hormone receptor 2 protein_id : NP_573465.1

name	5830416A07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71979671 CCDS:CCDS22735.1 GeneID:76014 MGI:1923264
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; conserved nuclear protein Nhn1 product : conserved nuclear protein Nhn1 isoform a protein_id : NP_001025164.1

name	5830416A07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71725355 CCDS:CCDS22736.1 GeneID:76014 MGI:1923264
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; conserved nuclear protein Nhn1 product : conserved nuclear protein Nhn1 isoform b protein_id : NP_001025165.1

name	Il17c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149259063 GeneID:234836 MGI:2446486
definition	codon_start : 1 product : interleukin 17C protein_id : XP_001478208.1

name	Cyba (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22094077 CCDS:CCDS22737.1 GeneID:13057 MGI:1316658
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : cytochrome beta-558; p22 phox product : cytochrome b-245, alpha polypeptide protein_id : NP_031832.1

name	Mvd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20149736 CCDS:CCDS22738.1 GeneID:192156 MGI:2179327
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA] GO_process : GO:0006695 - cholesterol biosynthesis [Evidence IEA]; GO:0008299 - isoprenoid biosynthesis [Evidence IEA]; GO:0008610 - lipid biosynthesis [Evidence IEA]; GO:0016310 - phosphorylation [Evidence IEA]; GO:0006694 - steroid biosynthesis [Evidence IEA]; GO:0016126 - sterol biosynthesis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : diphosphomevalonate decarboxylase product : mevalonate (diphospho) decarboxylase protein_id : NP_619597.1

name	Snai3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305643 CCDS:CCDS22739.1 GeneID:30927 MGI:1353563
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IDA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA] codon_start : 1 note : snail-related gene from muscle cells; snail-related protein 2; zinc finger protein 293 product : snail homolog 3 protein_id : NP_038942.1

name	Rnf166 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84794603 CCDS:CCDS22740.1 GeneID:68718 MGI:1915968
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : ring finger protein 166 protein_id : NP_001028314.1

name	2310061F22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24418874 GeneID:66965 MGI:1914215
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC66965 protein_id : NP_722470.1

name	Cdt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982546 CCDS:CCDS22741.1 GeneID:67177 MGI:1914427
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IDA]; GO:0005657 - replication fork [Evidence IPI] GO_function : GO:0003677 - DNA binding [Evidence IEA] [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0006260 - DNA replication [Evidence IEA]; GO:0000076 - DNA replication checkpoint [Evidence IDA]; GO:0030174 - regulation of DNA replication initiation [Evidence IDA]; GO:0007090 - regulation of S phase of mitotic cell cycle [Evidence IDA] codon_start : 1 note : retroviral integration site 1 product : retroviral integration site 2 protein_id : NP_080290.3

name	Aprt (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118601013 GeneID:11821 MGI:88061
definition	GO_function : GO:0002055 - adenine binding [Evidence IDA]; GO:0003999 - adenine phosphoribosyltransferase activity [Evidence IMP] [Evidence IDA] [Evidence IGI]; GO:0016208 - AMP binding [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0046083 - adenine metabolism [Evidence IMP] [Evidence IGI] [Evidence IC]; GO:0006168 - adenine salvage [Evidence IMP]; GO:0007625 - grooming behavior [Evidence IGI]; GO:0009116 - nucleoside metabolism [Evidence IEA]; GO:0006166 - purine ribonucleoside salvage [Evidence IGI] [Evidence IMP] codon_start : 1 product : adenine phosphoribosyl transferase protein_id : NP_033828.2

name	Galns (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980654 GeneID:50917 MGI:1355303
definition	GO_function : GO:0008484 - sulfuric ester hydrolase activity [Evidence ISS] codon_start : 1 exception : mismatches in translation note : N-acetylgalactosamine-6-sulfate sulfatase product : galactosamine (N-acetyl)-6-sulfate sulfatase protein_id : NP_057931.2

name	Trappc2l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946914 CCDS:CCDS22742.1 GeneID:59005 MGI:1916295
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005478 - intracellular transporter activity [Evidence IEA] GO_process : GO:0006888 - ER to Golgi vesicle-mediated transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : hematopoietic stem/progenitor cells 176 protein_id : NP_067477.1

name	Pabpnl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:55925591 CCDS:CCDS22743.1 GeneID:382035 MGI:2685954
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0008143 - poly(A) binding [Evidence ISS]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : embryonic poly(A) binding protein 2 product : poly(A)binding protein nuclear-like 1 protein_id : NP_001007463.1

name	Cbfa2t3h (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753302 CCDS:CCDS22744.1 GeneID:12398 MGI:1338013
definition	GO_component : GO:0005622 - intracellular [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030851 - granulocyte differentiation [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation note : CBFA2T3 identified gene homolog; core-binding factor, runt domain, alpha subunit 2; translocated to, 3 homolog product : core-binding factor, runt domain, alpha subunit 2, translocated to, 3 homolog protein_id : NP_033954.1

name	C230057M02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149259065 GeneID:319463 MGI:2442079
definition	codon_start : 1 product : hypothetical protein LOC319463 protein_id : XP_001478255.1

name	A530010L16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149259108 GeneID:382036 MGI:3037766
definition	codon_start : 1 product : hypothetical protein LOC382036 protein_id : XP_001480315.1

name	BC021611 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113199775 GeneID:257633 MGI:2182591
definition	GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : hypothetical protein LOC257633 protein_id : NP_659181.2

name	LOC100043225 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149259110 GeneID:100043225
definition	codon_start : 1 product : similar to Eukaryotic translation initiation factor 1 (eIF1) (Protein translation factor SUI1 homolog) protein_id : XP_001480318.1

name	Cdh15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119964694 CCDS:CCDS22746.1 GeneID:12555 MGI:106672
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 note : M cadherin product : cadherin 15 protein_id : NP_031688.2

name	Ankrd11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487033 GeneID:77087 MGI:1924337
definition	GO_function : GO:0003677 - DNA binding [Evidence IEA] codon_start : 1 product : ankyrin repeat domain 11 protein_id : NP_001074848.1

clone name	MSMg01-458P06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-478H17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-432A13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-302I15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-098C16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-291H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-465K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340F12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290G19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-236E07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-301L19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-269L06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-157N01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-520L11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-398N08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-213O21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-334F02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-212I22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529L03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-341B15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-540K19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-103C03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-393C17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-446C08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-342C10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-433O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-098L08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-055G12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-101G09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-432G11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-465E01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-111I10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-458G23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-336J09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-275C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-467A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-316H09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-317B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-201B09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-084D12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-350E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052L18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-195K20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-058I16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-061P20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-543L12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-376G21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-134O05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-308I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-055A08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-297K06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-296D13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-263I10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-109P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-131I02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-065A05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-493D12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-076H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-079M05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-107P02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-169L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-487B21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-506M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-051J18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-407I03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-180B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423H15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-417O08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-065K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-531F09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-080K11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-083E22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-480F11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-144F09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-526M01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-337E03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-048P22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-049A02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-441F21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-105G16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-481N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316P12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202E04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-097E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139N22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078L19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-192P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-060P07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111K07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-199M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263K07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-096F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-082C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154N05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-112O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022K04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255K23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324A07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-200I05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323C13
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-233G04.b	B6Ng01-233G04.g
ACC	GA045462	GA045463
length	483	1,075
definition	B6Ng01-233G04.b	B6Ng01-233G04.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(124,436,741 - 124,437,229)	(124,571,983 - 124,573,081)
sequence	cctctcgtgaatactgctttccccttgctgcatgagtctcagaggtctgg gacacacaagcataggacctgggtatccactctttacaaaaaagacaaaa agcagacaggttatcaagtctctgtcccagcatctcacaagctacagtta gggatgcgtgctatcacacatggccagaagacacacctttctgttgggag cctttgggtggggacctgtcttgtctcagcacttgcttgtgtagactgaa gtccctctcctagagactcgagaatgcttgtgtttcttcaagtctcaaga atgaactttgggggctggagagatggctcagtggttaagagcactggctg gtcttccagaggtcctgagttcaattcccagaaaccacatggtggctcac aaccatctgtaatgggatctgatgccctcttctggtgcgtctgaagtcat atatatgtatatgtgtgtgtgtgtgtgtgtgtg	gaattccaaggttgttccagctgctcaaagcatcaaaaacttgttatgac tccacacaggcctcagagatataagacacaacagtggtaaatacctggtc ctcagaggctccaggaggctttgttctgcctcttcccggtagccttggca tcccctaacccgtgtccgtattacttcaatgccaccctgttgctgcatgg ccactccctctatctttgcctcacgtgccctaagtaaggacccgtactgt tatgctgggtggtctggatgctgcagaaggctctccatccagcctgaatc ctatgcacaaaaccatttgctacagaaggagatgatgctaggttgagtgt cacagggcatctttggggtccatgtgtagtctgccatcttcatctcttct cataacaaggaggtcacagaaccaccctggtgagtggccagagcaggcct catgtcttgcagggatggaactgaagccaagctgtgccaattgatgttga tactgaactactatccctgcttgtctgtccactgtggtactgagtaggtc agtactgctctgaaatctagggattcctcactggggctacgagtctgacc atatcctcctccgccaaacagttaatggggctcctctgtgaacacagtag ctctgaccagatgcctcttggggtcaacagggacatctgtggtgacacag ctctactcaaccccagccacaccaagcatccacatgccccagtgccctac ccagcccacaccgtggtatctgtctcttggaataaaagcaaccaggtaca ggccagcccagcccaatgttaacttcacagggaagggaggaccacagagg ccagaggcggaggtgaaagcagatgaccttcaggagcaaccctgttagaa gagacttcttccagggaaagagactggtcttttaacccttctgtggtcat gtgcttcgtgggttgccttttcttttttttaagtcattttatttattatt atttaatatgttgttgtgtgttgtggttcagacaggtttctctgattagc tctggctgtctggactcaccctgta
quality values	Open. Hide. 62 62 62 62 62 62 62 62 62 47 51 56 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 51 50 48 48 34 56 59 62 54 62 62 62 59 59 59 59 59 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 62 62 62 54 54 54 54 54 62 54 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 54 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 47 62 62 62 62 62 62 62 62 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 46 46 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 54 58 54 58 58 58 58 58 58 58 58 58 49 25	Open. Hide. 62 49 32 47 62 62 39 32 54 62 62 20 20 21 21 21 21 16 10 15 21 38 49 62 62 59 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 59 62 62 62 62 62 59 49 62 62 62 59 59 62 54 54 49 38 48 35 59 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 49 59 62 59 59 62 62 62 62 62 62 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 46 46 62 62 62 62 62 62 54 62 62 62 54 47 54 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 47 62 62 62 62 62 62 62 62 62 62 62 54 47 62 62 62 62 62 62 62 62 54 47 58 58 58 58 58 54 58 58 58 58 58 52 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 54 58 58 58 58 54 46 58 58 58 41 49 58 54 58 58 58 58 58 50 58 54 49 58 54 52 58 58 58 58 58 58 58 47 58 58 58 58 58 58 50 51 54 58 58 53 58 58 41 27 54 50 58 47 50 53 51 58 58 58 58 58 51 51 40 41 40 49 32 51 41 58 50 46 30 53 53 51 50 51 54 58 49 49 44 49 40 58 50 50 39 29 58 58 53 52 51 58 50 50 40 43 58 49 38 58 50 53 50 50 52 42 49 58 52 50 51 49 50 41 50 51 39 49 58 29 58 54 52 51 50 51 19 50 31 39 54 40 50 50 44 50 53 51 41 39 38 58 58 41 50 37 53 50 50 28 58 58 25 27 39 53 53 51 54 54 38 51 54 39 32 29 39 52 31 41 52 53 53 53 34 42 53 45 33 53 37 54 54 31 26 40 54 40 32 40 40 41 38 39 39 37 53 39 45 35 47 36 44 35 41 47 38 51 54 35 33 34 42 53 37 54 47 45 42 37 54 41 32 32 41 54 27 33 32 34 33 40 40 32 34 46 32 32 29 47 34 53 41 53 42 47 36 32 40 41 25 34 32 33 51 49 46 26 52 28 31 15 40 32 29 36 32 25 27 30 18 28 20 34 35 33 51 51 31 31 33 41 51 33 33 31 26 51 32 37 33 37 31 30 37 31 23 30 32 20 47 43 33 35 13 47 24 26 24 22 29 9 33 22 32 23 25 25 17 30 12 14 22 18 30 7 37 15 15 21 42 13 33 31 38 43 48 31 26 24 20 9 26 13 25 29 18 37 27 34 33 15 27 13 31 19 33 24 27 22 33 31 31 31 15 32 37 23 33 32 9 36 8 21 17 25 25 38 26 28 14 26 31 31 48 36 22 48 25 20 33 19 22 20 30 28 31 15 28 22 44 44 21 11 19 31 48 24 18 26 26 23 29 13 9 33 22 19 23 22 32 22 25 23 20 25 21 14 16 27 39 33 14 22 32 17 11 30 43 34 28 15 21 43 48 43 43 43 39 33 11 16 9 4 7 21 28 38 40 20 18 5 34 9 25 27 3 3 3 15 11 9 34 21 8 16 15 5 5 5 3 3 25 17 15 11 6 5 4 5 7 17 19 4 3 4 10 13 5 3 6 28 13 8 17 14 3 17 10 9 12 21 13 8 4 9 7 7 4 7 14 13 18 7 13 8 5 6 10 25 7 15 8 11 5 6 7 8 4 3 4 6 15 5 5

Alignment Information

BAC End 1

BAC End 2

seq1: chr8_124436741_124437229
seq2: B6Ng01-233G04.b_45_533

seq1  GAATTCCCTCTCGTGAATACTGCTTTCCCCTTGCTGCATGAGTCTCAGAG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCCTCTCGTGAATACTGCTTTCCCCTTGCTGCATGAGTCTCAGAG  50

seq1  GTCTGGGACACACAAGCATAGGACCTGGGTATCCACTCTTTACAAAAAAG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCTGGGACACACAAGCATAGGACCTGGGTATCCACTCTTTACAAAAAAG  100

seq1  ACAAAAAGCAGACAGGTTATCAAGTCTCTGTCCCAGCATCTCACAAGCTA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAAAAAGCAGACAGGTTATCAAGTCTCTGTCCCAGCATCTCACAAGCTA  150

seq1  CAGTTAGGGATGCGTGCTATCACACATGGCCAGAAGACACACCTTTCTGT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGTTAGGGATGCGTGCTATCACACATGGCCAGAAGACACACCTTTCTGT  200

seq1  TGGGAGCCTTTGGGTGGGGACCTGTCTTGTCTCAGCACTTGCTTGTGTAG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGAGCCTTTGGGTGGGGACCTGTCTTGTCTCAGCACTTGCTTGTGTAG  250

seq1  ACTGAAGTCCCTCTCCTAGAGACTCGAGAATGCTTGTGTTTCTTCAAGTC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGAAGTCCCTCTCCTAGAGACTCGAGAATGCTTGTGTTTCTTCAAGTC  300

seq1  TCAAGAATGAACTTTGGGGGCTGGAGAGATGGCTCAGTGGTTAAGAGCAC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAAGAATGAACTTTGGGGGCTGGAGAGATGGCTCAGTGGTTAAGAGCAC  350

seq1  TGGCTGGTCTTCCAGAGGTCCTGAGTTCAATTCCCAGAAACCACATGGTG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGCTGGTCTTCCAGAGGTCCTGAGTTCAATTCCCAGAAACCACATGGTG  400

seq1  GCTCACAACCATCTGTAATGGGATCTGATGCCCTCTTCTGGTGCGTCTGA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTCACAACCATCTGTAATGGGATCTGATGCCCTCTTCTGGTGCGTCTGA  450

seq1  AGTCATATATATGTATATGTGTGTGTGTGTGTGTGTGTG  489
      |||||||||||||||||||||||||||||||||||||||
seq2  AGTCATATATATGTATATGTGTGTGTGTGTGTGTGTGTG  489

seq1: chr8_124571983_124573081
seq2: B6Ng01-233G04.g_68_1142 (reverse)

seq1  TACAGAGTGAGTTCCAGGACAGCCAGAGCTATACAGAGAAACCCTGTCTC  50
      ||||| ||||| |||| ||||||||||||||  |||||||| ||||||| 
seq2  TACAGGGTGAG-TCCA-GACAGCCAGAGCTAATCAGAGAAA-CCTGTCT-  46

seq1  GAAACAAACAAACAAACAAACAAACAAACAAATAATAAAATAAATAA-AA  99
      ||| ||        |||| ||||   |||| ||       ||||||| ||
seq2  GAACCA-------CAACACACAA--CAACATAT-------TAAATAATAA  80

seq1  TAAATAAAAATGAACCTTAAAAAAAAAGAAAAAGGCAACCCACGAAGCAC  149
      ||||| |||||||  |||||||||||   |||||||||||||||||||||
seq2  TAAAT-AAAATGA--CTTAAAAAAAA--GAAAAGGCAACCCACGAAGCAC  125

seq1  ATGACCACAGAAGGGTTAAAAGACCAGTCTCTTTCCCTGGAAGAAGTCTC  199
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGACCACAGAAGGGTTAAAAGACCAGTCTCTTTCCCTGGAAGAAGTCTC  175

seq1  TTCTAACAGGGTTGCTCCTGAAGGTCATCTGCTTTCACCTCCGCCTCTGG  249
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTAACAGGGTTGCTCCTGAAGGTCATCTGCTTTCACCTCCGCCTCTGG  225

seq1  CCTCTGTGGTCCTCCCTTCCCTGTGAAGTTAACATTGGGCTGGGCTGGCC  299
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCTGTGGTCCTCCCTTCCCTGTGAAGTTAACATTGGGCTGGGCTGGCC  275

seq1  TGTACCTGGTTGCTTTTATTCCAAGAGACAGATACCACGGTGTGGGCTGG  349
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTACCTGGTTGCTTTTATTCCAAGAGACAGATACCACGGTGTGGGCTGG  325

seq1  GTAGGGCACTGGGGCATGTGGATGCTTGGTGTGGCTGGGGTTGAGTAGAG  399
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAGGGCACTGGGGCATGTGGATGCTTGGTGTGGCTGGGGTTGAGTAGAG  375

seq1  CTGTGTCACCACAGATGTCCCTGTTGACCCCAAGAGGCATCTGGTCAGAG  449
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTGTCACCACAGATGTCCCTGTTGACCCCAAGAGGCATCTGGTCAGAG  425

seq1  CTACTGTGTTCACAGAGGAGCCCCATTAACTGTTTGGCGGAGGAGGATAT  499
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTACTGTGTTCACAGAGGAGCCCCATTAACTGTTTGGCGGAGGAGGATAT  475

seq1  GGTCAGACTCGTAGCCCCAGTGAGGAATCCCTAGATTTCAGAGCAGTACT  549
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTCAGACTCGTAGCCCCAGTGAGGAATCCCTAGATTTCAGAGCAGTACT  525

seq1  GACCTACTCAGTACCACAGTGGACAGACAAGCAGGGATAGTAGTTCAGTA  599
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACCTACTCAGTACCACAGTGGACAGACAAGCAGGGATAGTAGTTCAGTA  575

seq1  TCAACATCAATTGGCACAGCTTGGCTTCAGTTCCATCCCTGCAAGACATG  649
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAACATCAATTGGCACAGCTTGGCTTCAGTTCCATCCCTGCAAGACATG  625

seq1  AGGCCTGCTCTGGCCACTCACCAGGGTGGTTCTGTGACCTCCTTGTTATG  699
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGCCTGCTCTGGCCACTCACCAGGGTGGTTCTGTGACCTCCTTGTTATG  675

seq1  AGAAGAGATGAAGATGGCAGACTACACATGGACCCCAAAGATGCCCTGTG  749
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAAGAGATGAAGATGGCAGACTACACATGGACCCCAAAGATGCCCTGTG  725

seq1  ACACTCAACCTAGCATCATCTCCTTCTGTAGCAAATGGTTTTGTGCATAG  799
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACACTCAACCTAGCATCATCTCCTTCTGTAGCAAATGGTTTTGTGCATAG  775

seq1  GATTCAGGCTGGATGGAGAGCCTTCTGCAGCATCCAGACCACCCAGCATA  849
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATTCAGGCTGGATGGAGAGCCTTCTGCAGCATCCAGACCACCCAGCATA  825

seq1  ACAGTACGGGTCCTTACTTAGGGCACGTGAGGCAAAGATAGAGGGAGTGG  899
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGTACGGGTCCTTACTTAGGGCACGTGAGGCAAAGATAGAGGGAGTGG  875

seq1  CCATGCAGCAACAGGGTGGCATTGAAGTAATACGGACACGGGTTAGGGGA  949
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCATGCAGCAACAGGGTGGCATTGAAGTAATACGGACACGGGTTAGGGGA  925

seq1  TGCCAAGGCTACCGGGAAGAGGCAGAACAAAGCCTCCTGGAGCCTCTGAG  999
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCCAAGGCTACCGGGAAGAGGCAGAACAAAGCCTCCTGGAGCCTCTGAG  975

seq1  GACCAGGTATTTACCACTGTTGTGTCTTATATCTCTGAGGCCTGTGTGGA  1049
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACCAGGTATTTACCACTGTTGTGTCTTATATCTCTGAGGCCTGTGTGGA  1025

seq1  GTCATAACAAGTTTTTGATGCTTTGAGCAGCTGGAACAACCTTGGAATTC  1099
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCATAACAAGTTTTTGATGCTTTGAGCAGCTGGAACAACCTTGGAATTC  1075

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information