MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-276D16
Chromosome	8 (Build37)
Map Location	125,625,717 - 125,733,420
singlet/doublet	doublet
Overlap gene	Rpl13, Cpne7, Sult5a1, LOC100043251, Dpep1, Chmp1a
Upstream gene	Gm22, Zfpm1, Trhr2, 5830416A07Rik, Il17c, Cyba, Mvd, Snai3, Rnf166, 2310061F22Rik, Cdt1, Aprt, Galns, Trappc2l, Pabpnl1, Cbfa2t3h, C230057M02Rik, A530010L16Rik, BC021611, LOC100043225, Cdh15, Ankrd11, Spg7
Downstream gene	4732415M23Rik, Cdk10, Spata2L, 1300018I17Rik, Zfp276, Fanca, Spire2, Tcf25, Mc1r, Tubb3, Def8, Afg3l1, Dbndd1, Gas8, Rn5s-ps1, Rhou, LOC100042484, LOC100042490, Rab4a, 1700054N08Rik, LOC100043296, Acta1, Nup133, Abcb10, Taf5l, AK122209, LOC100042530, LOC100042535
Link	Open Mouse BAC browser

Click to get alignment info.

name	Gm22 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:195209 MGI:2684868
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 11 ESTs, 1 Protein

name	Zfpm1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22761 MGI:1095400
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trhr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170732 MGI:2177284
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5830416A07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76014 MGI:1923264
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Il17c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234836 MGI:2446486
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 Proteins

name	Cyba (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13057 MGI:1316658
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mvd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192156 MGI:2179327
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snai3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30927 MGI:1353563
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnf166 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68718 MGI:1915968
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310061F22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66965 MGI:1914215
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67177 MGI:1914427
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aprt (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11821 MGI:88061
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Galns (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50917 MGI:1355303
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trappc2l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59005 MGI:1916295
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pabpnl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382035 MGI:2685954
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cbfa2t3h (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12398 MGI:1338013
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C230057M02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319463 MGI:2442079
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs

name	A530010L16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382036 MGI:3037766
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	BC021611 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257633 MGI:2182591
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043225 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043225
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 358 ESTs, 6 Proteins

name	Cdh15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12555 MGI:106672
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ankrd11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77087 MGI:1924337
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Spg7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234847 MGI:2385906
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpl13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:270106 MGI:105922
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cpne7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102278 MGI:2142747
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sult5a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57429 MGI:1931463
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043251 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043251
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Dpep1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13479 MGI:94917
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chmp1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234852 MGI:1920159
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4732415M23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320869 MGI:2444920
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdk10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234854 MGI:2448549
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Spata2L (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78779 MGI:1926029
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1300018I17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72325 MGI:1914143
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 129 ESTs, 3 Proteins

name	Zfp276 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57247 MGI:1888495
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fanca (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14087 MGI:1341823
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Spire2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234857 MGI:2446256
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tcf25 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66855 MGI:1914105
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Mc1r (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17199 MGI:99456
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tubb3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22152 MGI:107813
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Def8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23854 MGI:1346331
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Afg3l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:114896 MGI:1928277
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dbndd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72185 MGI:1919435
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gas8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104346 MGI:1202386
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rn5s-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19805 MGI:99528
definition	note : 5S RNA, pseudogene 1 pseudo : _no_value

name	Rhou (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69581 MGI:1916831
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042484 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042484
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC100042490 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042490
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Rab4a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19341 MGI:105069
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700054N08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73420 MGI:1920670
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043296 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043296
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 28 ESTs, 2 Proteins pseudo : _no_value

name	Acta1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11459 MGI:87902
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nup133 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234865 MGI:2442620
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abcb10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56199 MGI:1860508
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Taf5l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102162 MGI:1919039
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AK122209 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382038 MGI:2681124
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042530 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042530
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC100042535 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042535
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	Gm22 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94383858 GeneID:195209 MGI:2684868
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 11 ESTs, 1 Protein product : gene model 22, (NCBI) transcript_id : XM_111398.7

name	Zfpm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144227234 GeneID:22761 MGI:1095400
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein, multitype 1 transcript_id : NM_009569.2

name	Trhr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131032 GeneID:170732 MGI:2177284
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thyrotropin releasing hormone receptor 2 transcript_id : NM_133202.2

name	5830416A07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71979670 GeneID:76014 MGI:1923264
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5830416A07 gene transcript_id : NM_001029993.1

name	5830416A07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71725354 GeneID:76014 MGI:1923264
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5830416A07 gene transcript_id : NM_001029994.1

name	Il17c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149259062 GeneID:234836 MGI:2446486
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 Proteins product : interleukin 17C transcript_id : XM_001478158.1

name	Cyba (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802423 GeneID:13057 MGI:1316658
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome b-245, alpha polypeptide transcript_id : NM_007806.2

name	Mvd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20149735 GeneID:192156 MGI:2179327
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mevalonate (diphospho) decarboxylase transcript_id : NM_138656.1

name	Snai3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560481 GeneID:30927 MGI:1353563
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : snail homolog 3 (Drosophila) transcript_id : NM_013914.2

name	Rnf166 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131145 GeneID:68718 MGI:1915968
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger protein 166 transcript_id : NM_001033142.2

name	2310061F22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24418873 GeneID:66965 MGI:1914215
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310061F22 gene transcript_id : NM_153775.1

name	Cdt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982545 GeneID:67177 MGI:1914427
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chromatin licensing and DNA replication factor 1 transcript_id : NM_026014.3

name	Aprt (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118601012 GeneID:11821 MGI:88061
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adenine phosphoribosyl transferase transcript_id : NM_009698.2

name	Galns (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980653 GeneID:50917 MGI:1355303
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : galactosamine (N-acetyl)-6-sulfate sulfatase transcript_id : NM_016722.2

name	Trappc2l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10946913 GeneID:59005 MGI:1916295
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : trafficking protein particle complex 2-like transcript_id : NM_021502.1

name	Pabpnl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:55925590 GeneID:382035 MGI:2685954
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : poly(A)binding protein nuclear-like 1 transcript_id : NM_001007462.1

name	Cbfa2t3h (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753301 GeneID:12398 MGI:1338013
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : core-binding factor, runt domain, alpha subunit 2, translocated to, 3 homolog (human) transcript_id : NM_009824.1

name	C230057M02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149259064 GeneID:319463 MGI:2442079
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs product : RIKEN cDNA C230057M02 gene transcript_id : XM_001478205.1

name	A530010L16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149259107 GeneID:382036 MGI:3037766
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : RIKEN cDNA A530010L16 gene transcript_id : XM_001480265.1

name	BC021611 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113199774 GeneID:257633 MGI:2182591
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC021611 transcript_id : NM_144932.3

name	LOC100043225 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149259109 GeneID:100043225
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 358 ESTs, 6 Proteins product : similar to Eukaryotic translation initiation factor 1 (eIF1) (Protein translation factor SUI1 homolog) transcript_id : XM_001480268.1

name	Cdh15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119964693 GeneID:12555 MGI:106672
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cadherin 15 transcript_id : NM_007662.2

name	Ankrd11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487032 GeneID:77087 MGI:1924337
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat domain 11 transcript_id : NM_001081379.1

name	Spg7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981976 GeneID:234847 MGI:2385906
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : spastic paraplegia 7 homolog (human) transcript_id : NM_153176.3

name	Rpl13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382665 GeneID:270106 MGI:105922
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein L13 transcript_id : NM_016738.3

name	Cpne7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:92373430 GeneID:102278 MGI:2142747
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : copine VII transcript_id : NM_170684.2

name	Sult5a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377411 GeneID:57429 MGI:1931463
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sulfotransferase family 5A, member 1 transcript_id : NM_020564.2

name	LOC100043251 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149259111 GeneID:100043251
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : hypothetical protein LOC100043251 transcript_id : XM_001480321.1

name	Dpep1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6681216 GeneID:13479 MGI:94917
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dipeptidase 1 (renal) transcript_id : NM_007876.1

name	Chmp1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133891733 GeneID:234852 MGI:1920159
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chromatin modifying protein 1A transcript_id : NM_145606.2

name	4732415M23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134948589 GeneID:320869 MGI:2444920
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4732415M23 gene transcript_id : NM_177279.4

name	Cdk10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37595743 GeneID:234854 MGI:2448549
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin-dependent kinase (CDC2-like) 10 transcript_id : NM_194446.1

name	Cdk10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37595739 GeneID:234854 MGI:2448549
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin-dependent kinase (CDC2-like) 10 transcript_id : NM_194444.1

name	Spata2L (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27753957 GeneID:78779 MGI:1926029
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : spermatogenesis associated 2-like transcript_id : NM_030176.2

name	1300018I17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149259113 GeneID:72325 MGI:1914143
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 129 ESTs, 3 Proteins product : RIKEN cDNA 1300018I17 gene, transcript variant 7 transcript_id : XM_902711.3

name	Zfp276 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10048419 GeneID:57247 MGI:1888495
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein (C2H2 type) 276 transcript_id : NM_020497.1

name	Fanca (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366102 GeneID:14087 MGI:1341823
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Fanconi anemia, complementation group A transcript_id : NM_016925.2

name	Spire2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982562 GeneID:234857 MGI:2446256
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : spire homolog 2 (Drosophila) transcript_id : NM_172287.2

name	Tcf25 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83776564 GeneID:66855 MGI:1914105
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transcription factor 25 (basic helix-loop-helix) transcript_id : NM_025804.2

name	Tcf25 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385557 GeneID:66855 MGI:1914105
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transcription factor 25 (basic helix-loop-helix) transcript_id : NM_001037878.2

name	Tcf25 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131030 GeneID:66855 MGI:1914105
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transcription factor 25 (basic helix-loop-helix) transcript_id : NM_001037877.2

name	Mc1r (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124339840 GeneID:17199 MGI:99456
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : melanocortin 1 receptor transcript_id : NM_008559.2

name	Tubb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982671 GeneID:22152 MGI:107813
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tubulin, beta 3 transcript_id : NM_023279.2

name	Def8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366853 GeneID:23854 MGI:1346331
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : differentially expressed in FDCP 8 transcript_id : NM_054046.3

name	Afg3l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:66792805 GeneID:114896 MGI:1928277
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : AFG3(ATPase family gene 3)-like 1 (yeast) transcript_id : NM_054070.2

name	Dbndd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348942 GeneID:72185 MGI:1919435
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dysbindin (dystrobrevin binding protein 1) domain containing 1 transcript_id : NM_028146.2

name	Gas8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126157524 GeneID:104346 MGI:1202386
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : growth arrest specific 8 transcript_id : NM_018855.2

name	Rhou (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142380453 GeneID:69581 MGI:1916831
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ras homolog gene family, member U transcript_id : NM_133955.2

name	LOC100042484 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149259066 GeneID:100042484
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100042484 transcript_id : XM_001478300.1

name	LOC100042490 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149259068 GeneID:100042490
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100042490 transcript_id : XM_001478310.1

name	Rab4a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388506 GeneID:19341 MGI:105069
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB4A, member RAS oncogene family transcript_id : NM_009003.2

name	1700054N08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625951 GeneID:73420 MGI:1920670
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700054N08 gene transcript_id : NM_028536.1

name	Acta1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893192 GeneID:11459 MGI:87902
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : actin, alpha 1, skeletal muscle transcript_id : NM_009606.2

name	Nup133 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:26986606 GeneID:234865 MGI:2442620
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleoporin 133 transcript_id : NM_172288.1

name	Abcb10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:66932950 GeneID:56199 MGI:1860508
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP-binding cassette, sub-family B (MDR/TAP), member 10 transcript_id : NM_019552.2

name	Taf5l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129904 GeneID:102162 MGI:1919039
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor transcript_id : NM_133966.2

name	AK122209 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71274161 GeneID:382038 MGI:2681124
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence AK122209 transcript_id : NM_001029876.1

name	LOC100042535 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149259070 GeneID:100042535
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : similar to reproductive homeobox on X chromosome 8 transcript_id : XM_001478390.1

name	Gm22 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94383859 GeneID:195209 MGI:2684868
definition	codon_start : 1 product : similar to KIAA1858 protein protein_id : XP_111398.6

name	Zfpm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677633 CCDS:CCDS22733.1 GeneID:22761 MGI:1095400
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003714 - transcription corepressor activity [Evidence TAS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007507 - heart development [Evidence IMP]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence TAS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : Friend of GATA-1 product : zinc finger protein, multitype 1 protein_id : NP_033595.1

name	Trhr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18875348 CCDS:CCDS22734.1 GeneID:170732 MGI:2177284
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0001615 - thyrotropin releasing hormone and secretagogue-like receptors activity [Evidence IDA] GO_process : GO:0007200 - G-protein signaling, coupled to IP3 second messenger (phospholipase C activating) [Evidence IDA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : thyrotropin releasing hormone receptor 2 protein_id : NP_573465.1

name	5830416A07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71979671 CCDS:CCDS22735.1 GeneID:76014 MGI:1923264
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; conserved nuclear protein Nhn1 product : conserved nuclear protein Nhn1 isoform a protein_id : NP_001025164.1

name	5830416A07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71725355 CCDS:CCDS22736.1 GeneID:76014 MGI:1923264
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; conserved nuclear protein Nhn1 product : conserved nuclear protein Nhn1 isoform b protein_id : NP_001025165.1

name	Il17c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149259063 GeneID:234836 MGI:2446486
definition	codon_start : 1 product : interleukin 17C protein_id : XP_001478208.1

name	Cyba (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22094077 CCDS:CCDS22737.1 GeneID:13057 MGI:1316658
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : cytochrome beta-558; p22 phox product : cytochrome b-245, alpha polypeptide protein_id : NP_031832.1

name	Mvd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20149736 CCDS:CCDS22738.1 GeneID:192156 MGI:2179327
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA] GO_process : GO:0006695 - cholesterol biosynthesis [Evidence IEA]; GO:0008299 - isoprenoid biosynthesis [Evidence IEA]; GO:0008610 - lipid biosynthesis [Evidence IEA]; GO:0016310 - phosphorylation [Evidence IEA]; GO:0006694 - steroid biosynthesis [Evidence IEA]; GO:0016126 - sterol biosynthesis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : diphosphomevalonate decarboxylase product : mevalonate (diphospho) decarboxylase protein_id : NP_619597.1

name	Snai3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305643 CCDS:CCDS22739.1 GeneID:30927 MGI:1353563
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IDA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA] codon_start : 1 note : snail-related gene from muscle cells; snail-related protein 2; zinc finger protein 293 product : snail homolog 3 protein_id : NP_038942.1

name	Rnf166 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84794603 CCDS:CCDS22740.1 GeneID:68718 MGI:1915968
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : ring finger protein 166 protein_id : NP_001028314.1

name	2310061F22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24418874 GeneID:66965 MGI:1914215
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC66965 protein_id : NP_722470.1

name	Cdt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982546 CCDS:CCDS22741.1 GeneID:67177 MGI:1914427
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IDA]; GO:0005657 - replication fork [Evidence IPI] GO_function : GO:0003677 - DNA binding [Evidence IEA] [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0006260 - DNA replication [Evidence IEA]; GO:0000076 - DNA replication checkpoint [Evidence IDA]; GO:0030174 - regulation of DNA replication initiation [Evidence IDA]; GO:0007090 - regulation of S phase of mitotic cell cycle [Evidence IDA] codon_start : 1 note : retroviral integration site 1 product : retroviral integration site 2 protein_id : NP_080290.3

name	Aprt (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118601013 GeneID:11821 MGI:88061
definition	GO_function : GO:0002055 - adenine binding [Evidence IDA]; GO:0003999 - adenine phosphoribosyltransferase activity [Evidence IMP] [Evidence IDA] [Evidence IGI]; GO:0016208 - AMP binding [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0046083 - adenine metabolism [Evidence IMP] [Evidence IGI] [Evidence IC]; GO:0006168 - adenine salvage [Evidence IMP]; GO:0007625 - grooming behavior [Evidence IGI]; GO:0009116 - nucleoside metabolism [Evidence IEA]; GO:0006166 - purine ribonucleoside salvage [Evidence IGI] [Evidence IMP] codon_start : 1 product : adenine phosphoribosyl transferase protein_id : NP_033828.2

name	Galns (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980654 GeneID:50917 MGI:1355303
definition	GO_function : GO:0008484 - sulfuric ester hydrolase activity [Evidence ISS] codon_start : 1 exception : mismatches in translation note : N-acetylgalactosamine-6-sulfate sulfatase product : galactosamine (N-acetyl)-6-sulfate sulfatase protein_id : NP_057931.2

name	Trappc2l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946914 CCDS:CCDS22742.1 GeneID:59005 MGI:1916295
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005478 - intracellular transporter activity [Evidence IEA] GO_process : GO:0006888 - ER to Golgi vesicle-mediated transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : hematopoietic stem/progenitor cells 176 protein_id : NP_067477.1

name	Pabpnl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:55925591 CCDS:CCDS22743.1 GeneID:382035 MGI:2685954
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0008143 - poly(A) binding [Evidence ISS]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : embryonic poly(A) binding protein 2 product : poly(A)binding protein nuclear-like 1 protein_id : NP_001007463.1

name	Cbfa2t3h (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753302 CCDS:CCDS22744.1 GeneID:12398 MGI:1338013
definition	GO_component : GO:0005622 - intracellular [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030851 - granulocyte differentiation [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation note : CBFA2T3 identified gene homolog; core-binding factor, runt domain, alpha subunit 2; translocated to, 3 homolog product : core-binding factor, runt domain, alpha subunit 2, translocated to, 3 homolog protein_id : NP_033954.1

name	C230057M02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149259065 GeneID:319463 MGI:2442079
definition	codon_start : 1 product : hypothetical protein LOC319463 protein_id : XP_001478255.1

name	A530010L16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149259108 GeneID:382036 MGI:3037766
definition	codon_start : 1 product : hypothetical protein LOC382036 protein_id : XP_001480315.1

name	BC021611 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113199775 GeneID:257633 MGI:2182591
definition	GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : hypothetical protein LOC257633 protein_id : NP_659181.2

name	LOC100043225 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149259110 GeneID:100043225
definition	codon_start : 1 product : similar to Eukaryotic translation initiation factor 1 (eIF1) (Protein translation factor SUI1 homolog) protein_id : XP_001480318.1

name	Cdh15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119964694 CCDS:CCDS22746.1 GeneID:12555 MGI:106672
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 note : M cadherin product : cadherin 15 protein_id : NP_031688.2

name	Ankrd11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487033 GeneID:77087 MGI:1924337
definition	GO_function : GO:0003677 - DNA binding [Evidence IEA] codon_start : 1 product : ankyrin repeat domain 11 protein_id : NP_001074848.1

name	Spg7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981977 GeneID:234847 MGI:2385906
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004222 - metalloendopeptidase activity [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008089 - anterograde axon cargo transport [Evidence IMP]; GO:0007155 - cell adhesion [Evidence TAS]; GO:0007005 - mitochondrion organization and biogenesis [Evidence IMP]; GO:0030163 - protein catabolism [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA]; GO:0030155 - regulation of cell adhesion [Evidence TAS] codon_start : 1 exception : mismatches in translation note : paraplegin; cell matrix adhesion regulator; cell adhesion regulator product : spastic paraplegia 7 homolog protein_id : NP_694816.2

name	Rpl13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33186863 CCDS:CCDS22747.1 GeneID:270106 MGI:105922
definition	GO_component : GO:0005830 - cytosolic ribosome (sensu Eukaryota) [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0007046 - ribosome biogenesis [Evidence IEA] codon_start : 1 note : snoRNA MBII-202 product : ribosomal protein L13 protein_id : NP_058018.2

name	Cpne7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:25470894 CCDS:CCDS22748.1 GeneID:102278 MGI:2142747
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : copine 7 protein protein_id : NP_733785.1

name	Sult5a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10181192 CCDS:CCDS22749.1 GeneID:57429 MGI:1931463
definition	GO_function : GO:0008146 - sulfotransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : sulfotransferase-related protein SULT-X1; sulfotransferase related gene X1 product : sulfotransferase family 5A, member 1 protein_id : NP_065589.1

name	LOC100043251 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149259112 GeneID:100043251
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480371.1

name	Dpep1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681217 CCDS:CCDS22750.1 GeneID:13479 MGI:94917
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0016805 - dipeptidase activity [Evidence IEA]; GO:0008239 - dipeptidyl-peptidase activity [Evidence IEA]; GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004237 - membrane dipeptidase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : dipeptidase 1 (renal) protein_id : NP_031902.1

name	Chmp1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704220 GeneID:234852 MGI:1920159
definition	GO_component : GO:0000794 - condensed nuclear chromosome [Evidence ISS]; GO:0005769 - early endosome [Evidence ISS]; GO:0012505 - endomembrane system [Evidence ISS]; GO:0016020 - membrane [Evidence IEA]; GO:0005815 - microtubule organizing center [Evidence ISS]; GO:0016363 - nuclear matrix [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence ISS] [Evidence IPI] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0016458 - gene silencing [Evidence ISS]; GO:0007076 - mitotic chromosome condensation [Evidence ISS]; GO:0045749 - negative regulation of S phase of mitotic cell cycle [Evidence ISS]; GO:0045892 - negative regulation of transcription, DNA-dependent [Evidence ISS]; GO:0015031 - protein transport [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : procollagen (type III) N-endopeptidase protein_id : NP_663581.1

name	4732415M23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124301188 GeneID:320869 MGI:2444920
definition	codon_start : 1 product : hypothetical protein LOC320869 protein_id : NP_796253.2

name	Cdk10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37595744 CCDS:CCDS22751.1 GeneID:234854 MGI:2448549
definition	GO_component : GO:0005622 - intracellular [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; cyclin dependent kinase 10 product : cyclin-dependent kinase 10 isoform 1 protein_id : NP_919428.1

name	Cdk10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37595740 GeneID:234854 MGI:2448549
definition	GO_component : GO:0005622 - intracellular [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : non-AUG (CUG) translation initiation codon; isoform 2 is encoded by transcript variant 2; cyclin dependent kinase 10 product : cyclin-dependent kinase 10 isoform 2 protein_id : NP_919426.1 transl_except : (pos:125750247..125750249,aa:Met)

name	Spata2L (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27753958 CCDS:CCDS22752.1 GeneID:78779 MGI:1926029
definition	codon_start : 1 product : spermatogenesis associated 2-like protein_id : NP_084452.2

name	1300018I17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149259114 GeneID:72325 MGI:1914143
definition	codon_start : 1 product : hypothetical protein LOC72325 isoform 7 protein_id : XP_907804.3

name	Zfp276 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10048420 GeneID:57247 MGI:1888495
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc finger protein 276 protein_id : NP_065243.1

name	Fanca (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8393352 CCDS:CCDS22753.1 GeneID:14087 MGI:1341823
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006281 - DNA repair [Evidence IEA]; GO:0008585 - female gonad development [Evidence IMP]; GO:0008584 - male gonad development [Evidence IMP]; GO:0007140 - male meiosis [Evidence IMP]; GO:0042127 - regulation of cell proliferation [Evidence IMP]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 exception : mismatches in translation product : Fanconi anemia, complementation group A protein_id : NP_058621.1

name	Spire2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27151755 CCDS:CCDS22754.1 GeneID:234857 MGI:2446256
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : spir-2 protein protein_id : NP_758491.1

name	Tcf25 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83776561 GeneID:66855 MGI:1914105
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0003700 - transcription factor activity [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007507 - heart development [Evidence ISS]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; nuclear localized protein 1 product : nuclear localized protein 1 isoform a protein_id : NP_001032966.1

name	Tcf25 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83776565 GeneID:66855 MGI:1914105
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0003700 - transcription factor activity [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007507 - heart development [Evidence ISS]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; nuclear localized protein 1 product : nuclear localized protein 1 isoform b protein_id : NP_080080.2

name	Tcf25 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83776553 CCDS:CCDS22755.1 GeneID:66855 MGI:1914105
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0003700 - transcription factor activity [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007507 - heart development [Evidence ISS]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform c is encoded by transcript variant 3; nuclear localized protein 1 product : nuclear localized protein 1 isoform c protein_id : NP_001032967.1

name	Mc1r (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124339841 CCDS:CCDS22756.1 GeneID:17199 MGI:99456
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019233 - sensory perception of pain [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : tobacco darkening; extension recessive yellow product : melanocortin 1 receptor protein_id : NP_032585.2

name	Tubb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963615 CCDS:CCDS22757.1 GeneID:22152 MGI:107813
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA]; GO:0015630 - microtubule cytoskeleton [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0043234 - protein complex [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005200 - structural constituent of cytoskeleton [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007018 - microtubule-based movement [Evidence IEA]; GO:0007017 - microtubule-based process [Evidence IEA]; GO:0051258 - protein polymerization [Evidence IEA] codon_start : 1 product : tubulin, beta 3 protein_id : NP_075768.1

name	Def8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16905081 CCDS:CCDS22759.1 GeneID:23854 MGI:1346331
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : differentially expressed in FDCP 8 protein_id : NP_473387.1

name	Afg3l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66792806 CCDS:CCDS22760.1 GeneID:114896 MGI:1928277
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004222 - metalloendopeptidase activity [Evidence ISS] [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0030163 - protein catabolism [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : AFG3(ATPase family gene 3)-like 1 protein_id : NP_473411.2

name	Dbndd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13605926 CCDS:CCDS22761.1 GeneID:72185 MGI:1919435
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 product : dysbindin (dystrobrevin binding protein 1) domain containing 1 protein_id : NP_082422.1

name	Gas8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126157525 GeneID:104346 MGI:1202386
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0019861 - flagellum [Evidence IEA]; GO:0009434 - flagellum (sensu Eukaryota) [Evidence IDA]; GO:0005874 - microtubule [Evidence IEA] [Evidence IDA] GO_function : GO:0016829 - lyase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0030317 - sperm motility [Evidence TAS] [Evidence IEP] codon_start : 1 note : growth arrest specific 11; growth arrest specific protein 11; beta growth arrest specific protein 11 product : growth arrest specific 8 protein_id : NP_061343.2

name	Rhou (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19923060 CCDS:CCDS22762.1 GeneID:69581 MGI:1916831
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence IMP]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence IDA]; GO:0000082 - G1/S transition of mitotic cell cycle [Evidence IDA]; GO:0016601 - Rac protein signal transduction [Evidence IDA]; GO:0008360 - regulation of cell shape [Evidence IDA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 note : Wnt1 responsive Cdc42 homolog product : ras homolog gene family, member U protein_id : NP_598716.1

name	LOC100042484 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149259067 GeneID:100042484
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478350.1

name	LOC100042490 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149259069 GeneID:100042490
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478360.1

name	Rab4a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679595 GeneID:19341 MGI:105069
definition	GO_component : GO:0005768 - endosome [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008565 - protein transporter activity [Evidence IDA] GO_process : GO:0015031 - protein transport [Evidence IDA]; GO:0030100 - regulation of endocytosis [Evidence IDA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation function : roled in the intracellular vesicular transport, endocytosis or secretary process product : RAB4A, member RAS oncogene family protein_id : NP_033029.1

name	1700054N08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625952 CCDS:CCDS22763.1 GeneID:73420 MGI:1920670
definition	codon_start : 1 product : hypothetical protein LOC73420 protein_id : NP_082812.1

name	Acta1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33563240 CCDS:CCDS22764.1 GeneID:11459 MGI:87902
definition	GO_component : GO:0005884 - actin filament [Evidence ISS]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0001725 - stress fiber [Evidence ISS]; GO:0005865 - striated muscle thin filament [Evidence TAS] GO_function : GO:0043531 - ADP binding [Evidence ISS]; GO:0005524 - ATP binding [Evidence ISS] [Evidence IEA]; GO:0017022 - myosin binding [Evidence ISS]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] [Evidence IEA]; GO:0005200 - structural constituent of cytoskeleton [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA]; GO:0030240 - muscle thin filament assembly [Evidence ISS]; GO:0048741 - skeletal muscle fiber development [Evidence IDA] codon_start : 1 product : actin, alpha 1, skeletal muscle protein_id : NP_033736.1

name	Nup133 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26986607 CCDS:CCDS22765.1 GeneID:234865 MGI:2442620
definition	GO_component : GO:0005643 - nuclear pore [Evidence IEA] [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005487 - nucleocytoplasmic transporter activity [Evidence ISS]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006406 - mRNA export from nucleus [Evidence ISS]; GO:0015031 - protein transport [Evidence IEA]; GO:0050658 - RNA transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : nucleoporin 133 protein_id : NP_758492.1

name	Abcb10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9506367 CCDS:CCDS22766.1 GeneID:56199 MGI:1860508
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016887 - ATPase activity [Evidence IEA]; GO:0042626 - ATPase activity, coupled to transmembrane movement of substances [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005215 - transporter activity [Evidence ISS] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : Abc-mitochondrial erythroid; ATP-binding cassette, sub-family B (MDR/TAP), member 12 product : ATP-binding cassette, sub-family B, member 10 protein_id : NP_062425.1

name	Taf5l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527184 CCDS:CCDS22767.1 GeneID:102162 MGI:1919039
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor protein_id : NP_598727.1

name	AK122209 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71274162 CCDS:CCDS22768.1 GeneID:382038 MGI:2681124
definition	codon_start : 1 product : hypothetical protein LOC382038 protein_id : NP_001025047.1

name	LOC100042535 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149259071 GeneID:100042535
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478440.1

name	(CDS detail)
type	promoter
link
xref
definition	note : D box

name	LOC100042530 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042530
definition	number : 1 pseudo : _no_value

name	(CDS detail)
type	misc_binding
link
xref
definition	bound_moiety : Sp1

name	(CDS detail)
type	misc_binding
link
xref
definition	bound_moiety : Sp1

name	Rn5s-ps1 (CDS detail)
type	misc_feature
link	vega ensembl
xref
definition	note : 5S rRNA pseudogene pseudo : _no_value

name	LOC100043296 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149259115 GeneID:100043296
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 28 ESTs, 2 Proteins product : similar to ribosomal protein L35 pseudo : _no_value transcript_id : XR_034676.1

clone name	MSMg01-317B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-408L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-058I16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-061P20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-543L12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-376G21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-134O05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-308I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-055A08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-297K06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-296D13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-263I10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-109P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-131I02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-065A05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-493D12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-076H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-079M05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-107P02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-169L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-487B21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-506M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-051J18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-407I03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-180B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423H15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-417O08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-065K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-531F09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-080K11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-083E22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-480F11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-144F09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-526M01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-337E03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-048P22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-049A02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-441F21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-105G16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-481N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-479E11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-122C03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-156M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-070M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-075A23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-409F01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-333M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-179F10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-377K24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-143G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-476F22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-528O05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-493E01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-475I20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381P18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-336P09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-546L23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536J17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-131O07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-389C13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-542B17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-411L21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-307H14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-178J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-397P15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505P15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-377B04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-462D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-394C24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-512H20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-214C01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-300M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-398P04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-343B23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-406N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-082C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154N05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-112O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022K04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255K23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324A07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-200I05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-029C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172K05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092M18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149N19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081C18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-082H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274N11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-170F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185F14
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-276D16.b	B6Ng01-276D16.g
ACC	GA077062	GA077063
length	1,106	1,149
definition	B6Ng01-276D16.b	B6Ng01-276D16.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(125,732,326 - 125,733,420)	(125,625,717 - 125,626,830)
sequence	gaattctccacagagagttatacgagtttatgtcactgcctgagtagcct gaaggaggttctgtgtgctttctgtgagttgacagtcccccacaagccgg ggcagggttggtgagcattaattgtcttgtcagccttctactctggggga gggtacaggttagggtgttactagaggtgatggacactttaggaaacctg ttgcagcctcccctcgcacacagggccaggtcctgggtggggctttaggg ggattcctccctgggctgctgcagtttctaacagcccacagtgtctgact ggaattacgctttgaggctttgtgccttagcacagggttgaaacaagcac aggcagagaagaggtcctgggctaaagggtgaactccacctgtgcatctc aggatgtatggcttctgcttagttcacagcgaagcagctggagaaactgg ccaagaaggccgagaaggactccaaggctgagcaggccaaagtgaagaag gtgcgtaattcctctggtccgggttcctttctccccatcccctgtccttt attttattttatttcatttcattattgagattgagtgctgtagtcgaggt tgacctggaactgtactgtgtagctcaggctaacctccgatgtgactcac cctgcatcggcttcagctttggtaaactgtaggcaggagccaccatcccc tgctgtctccctccggggtgctctgcatcttatctttgcacgactcttcc ttccagcgctgtgatttaatctcactgattccagagtgtcagtgtgtttg ctttcatacttgagagcgaccctgagggaggagtaactgtcctcctctgc cctcccccgcccaagcccacggtgacgtccagagcagcccaggtgcatgg cccttcatgcctcctccttcctcttccagcatcctgaactgggcaaggca tgggcctccaaggctgtccctgctccagtgacatcagctggcttcccctt cctttcaaggctgcagcccaggtgtcatgggtcgggccaggaggtgggta agcatccttaaggatacaacaggagcagaccttttagcagaatgttgcca gctctt	gaattcagtattgtatttcgtcacacctgatttccccccgaggagttaag tcagggctaaaggagttatctaagtaaatgggggagtttggggctggaga aatgactcagtagttacgatcactggctgcttgctgtttcagaagttcaa ttctcagcacccaggaactccggtagtaggggatccgacgcacagccatg aaaccagggagacactcatacaaataaagtaaaaataaataaaaatctta aagtggggggggaagtctggaatgggggtgcgtgcttcagttctggggaa acataaattccaggcaaatctataataaattttcctgggtggacggggaa aaaacactggatctaggagggagaaagagttttaggggtttaattcatag gtgcgcccctgagcacgccggagatacccacactgcgaagttaggaacca gcgagaataaccaacccgacggctagaaaggcgatggtccgccggcgggc gggttcgcgtgacgtcacttccctttcgcctgattttgattggcgtttga gattggccggactccctacaagcccagggtgctttgcggtgcccggtcct ttccgctcggccgttctcctgtataggaggtgagtctctgccgccgccgg tcccatcgtggtccatcgggctccatcgccctccatccgctgtcatcggc gaagagaggccgcacggacagccatggaggagcccgggcgccgacagcac ggagccagggcaggggcgggaggacccgggacggggttggggaccctggc cttgactcgcccgccctcctctcccctcgcggccttaggcagccatggcg cccagccggaaatggcatgatactggaagccccactttccacaaaggatt ggcagcagcgaggtggacaacttgggttcaaccagcccggcgcgcaagat tccggcaggtattagatcgcgcggtggctcgcgttgggcttcaaggggcg gggaacgcgcgtgggggcagggaggttgacgggctgatgctttttcctgc aggcgcaaggacccggcaaggtcgaaaagcgcgtcgcattggccttcggt ccggcggtccgggcccaatcaggaccattcgttgaagggtgccctacag
quality values	Open. Hide. 49 31 20 32 58 62 62 62 41 26 43 39 62 49 54 49 62 62 62 56 62 62 49 62 62 62 62 62 62 56 44 43 43 38 18 21 32 31 28 28 32 33 29 38 49 62 62 62 62 62 62 59 62 62 62 59 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 59 46 44 56 59 59 59 51 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 59 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 44 49 44 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 43 43 62 62 43 43 62 62 62 62 47 54 62 62 62 62 56 62 56 62 56 62 47 62 62 62 62 49 47 62 62 54 56 62 62 62 62 62 62 54 42 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 54 54 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 54 58 58 58 58 58 58 46 58 58 54 58 54 58 58 58 54 58 58 58 58 52 58 58 58 54 52 54 58 58 58 58 58 58 46 45 54 58 58 58 54 58 58 58 58 58 58 54 52 54 54 51 58 51 58 58 49 51 49 17 47 49 58 46 58 58 48 58 58 58 51 58 58 58 51 58 58 50 49 58 58 51 50 16 58 54 46 47 49 47 58 58 51 51 51 44 39 58 51 51 39 34 58 54 51 46 49 50 51 58 49 50 52 51 38 30 51 58 39 50 52 39 58 58 58 49 37 58 50 51 58 58 50 58 58 53 53 28 58 50 50 30 58 46 30 53 47 50 50 49 41 53 52 34 31 22 37 58 49 54 49 47 52 45 30 37 29 37 31 37 21 54 54 54 50 51 42 39 41 53 49 49 37 53 42 51 51 53 52 40 49 26 32 44 49 42 42 40 51 34 44 49 41 49 37 40 54 37 44 46 37 29 47 41 53 53 41 33 31 31 31 54 52 31 53 52 40 53 38 40 40 42 35 33 22 30 26 52 37 37 54 23 28 32 31 40 39 35 32 51 34 53 31 46 40 35 34 36 53 44 34 31 52 34 40 21 33 34 51 12 40 24 45 28 22 11 46 35 41 31 31 18 46 38 51 26 33 45 19 33 31 28 31 31 45 30 29 30 8 14 45 43 31 31 31 31 32 21 17 18 41 41 40 43 29 28 40 25 20 30 16 24 41 42 31 22 18 28 26 42 30 26 25 42 31 15 31 26 46 26 32 41 20 28 36 33 31 30 35 19 32 22 27 35 25 28 8 41 13 32 41 31 30 32 31 18 25 39 25 28 31 31 37 31 31 16 25 11 22 20 33 14 29 33 23 24 18 16 13 25 25 31 34 35 21 18 11 36 19 22 21 31 11 35 16 30 16 11 44 13 13 19 33 13 15 13 14 32 21 21 14 12 26 30 40 22 14 19 32 32 19 17 23 20 12 21 32 22 24 33 32 32 21 32 21 29 26 18 34 33 19 31 31 30 9 14 24 18 8 38 18 18 11 7 21 16 3 7 14 28 28 16 27 30 20 5 4 6 3 7 13 16 26 15 16 27 15 6 11 14 29 31 5 8 13 6 7 19 10 8 5 8 34 23 10 27 7 19 4 11 32 8 18 5 17 6 20 4 6 18 10 7 21 8 7 13 8 6 4 8 5 19 9 5 19 6 10 15 28 24 9 16 5 3 4 5 13 21 16 13 10 15 9 13 11 4 4 14 14 11 24 12	Open. Hide. 62 47 56 42 62 47 37 62 62 62 49 26 31 14 15 24 39 46 32 28 28 24 25 28 39 51 59 62 59 59 62 62 62 62 62 62 62 62 62 59 59 59 62 59 59 62 62 62 62 62 62 62 59 62 62 59 48 30 45 48 28 48 54 54 43 54 56 59 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 59 59 62 62 62 62 59 62 62 62 62 62 59 59 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 54 62 62 59 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 59 59 59 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 59 49 49 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 56 62 62 62 62 62 62 62 62 47 37 47 62 56 62 56 43 56 56 46 56 56 62 56 62 62 62 62 62 62 62 62 62 46 62 62 62 54 56 62 62 47 47 62 62 62 62 62 62 62 56 56 56 56 56 56 49 62 56 62 56 62 56 62 62 62 56 62 62 62 62 49 47 62 62 62 62 62 62 54 62 62 62 62 62 62 62 52 52 46 46 62 62 62 51 48 52 54 62 41 48 54 62 62 49 54 62 62 62 62 62 62 62 62 62 42 62 62 62 62 54 62 62 58 58 58 58 54 58 58 45 48 54 58 58 54 58 58 53 42 54 58 58 45 41 58 54 58 54 54 54 54 58 58 58 54 58 54 58 52 54 54 52 52 50 52 58 52 58 54 54 54 52 52 52 54 44 52 58 54 54 48 54 54 49 47 48 54 58 52 52 41 40 40 52 52 52 42 40 58 54 42 54 52 54 50 49 49 58 50 50 53 52 48 48 46 29 49 50 41 45 46 51 48 50 49 58 47 58 50 52 52 50 47 50 50 48 58 34 38 58 43 50 50 34 49 37 58 52 50 53 34 28 53 50 50 58 58 48 37 28 43 42 49 46 37 46 50 50 51 35 39 35 50 37 42 42 50 48 51 40 46 46 54 51 33 46 39 31 36 50 22 54 22 50 27 50 22 50 30 50 50 43 40 42 28 40 32 38 37 31 24 52 51 46 39 21 43 32 18 41 52 32 52 49 46 38 37 37 42 29 47 38 31 52 49 37 49 39 37 51 21 41 39 30 38 54 54 31 40 42 54 51 50 38 42 54 44 22 12 51 28 10 44 38 34 42 42 39 22 37 54 54 32 54 17 27 54 54 37 22 17 47 41 21 22 51 31 41 45 22 23 41 34 53 34 28 18 40 19 14 20 32 32 31 18 33 31 40 34 17 36 40 18 33 31 34 31 31 28 26 24 39 30 27 19 29 26 32 30 16 38 27 31 32 46 22 30 30 40 41 31 23 31 51 19 51 14 46 9 26 29 30 30 31 31 31 34 31 32 35 31 9 19 32 32 31 31 51 40 33 21 17 21 42 31 25 24 6 9 17 42 26 20 33 19 18 31 31 36 18 32 29 36 38 31 37 16 16 10 11 7 13 24 31 9 7 8 13 20 25 18 39 23 35 23 27 31 17 14 31 27 17 25 27 13 14 22 15 9 12 16 31 17 32 30 20 13 9 9 18 8 13 11 31 16 20 8 18 10 11 7 6 18 31 21 22 31 19 10 6 16 20 19 30 21 29 22 16 12 18 9 9 10 38 24 13 9 13 25 10 13 26 29 41 11 7 13 33 24 19 18 16 7 15 33 11 11 8 6 11 36 33 36 26 18 13 9 25 19 32 10 30 6 10 13 25 9 8 25 9 8 14 21 10 10 7 18 17 31 33 39 14 9 12 16 16 11 5 6 21 8 8 10 8 8 10 10 5 6 9 9 9 16 4 5 11 28 24 7 7 9 17 28 25 8 15 13 13 14 9 22 6 3 3 8 10 6 3 3 3 3 4 4 4 7 18 5 13 7 1 3 4 5 12 21 6 14 9 25 15 11 20 19 5 7 25 18 13 14 4 2 8 16 6 4 6 5 6 4 4 7 8 12 5 15 9 6 2 3 13 6 7 9 7 5 6

Alignment Information

BAC End 1

BAC End 2

seq1: chr8_125732326_125733420
seq2: B6Ng01-276D16.b_45_1150 (reverse)

seq1  AAGAGCTGGGCAACA-TCTGGCTAAAGGTCTGCT-CTG-TGTAT-CTTTA  46
      ||||||| ||||||| ||||   ||||||||||| ||| ||||| ||| |
seq2  AAGAGCT-GGCAACATTCTGCTAAAAGGTCTGCTCCTGTTGTATCCTTAA  49

seq1  GGATGCCTTCCCACCTC--TGCCCGA-CCATGACACCCTGGGCTGCAGCC  93
      |||||| | ||||||||   |||||| |||||||| ||||||||||||||
seq2  GGATGCTTACCCACCTCCTGGCCCGACCCATGACA-CCTGGGCTGCAGCC  98

seq1  CTGAA--GGAGGGGAAGCCAGCTGATGTCACTGGAGCAGGGACAGCC-TG  140
       ||||  | |||||||||||||||||||||||||||||||||||||| ||
seq2  TTGAAAGGAAGGGGAAGCCAGCTGATGTCACTGGAGCAGGGACAGCCTTG  148

seq1  GAGG-CCATGCCTTG-CCAGTTCAGGATGCTGGAAGAGGAAGGAGGAGGC  188
      |||| |||||||||| ||||||||||||||||||||||||||||||||||
seq2  GAGGCCCATGCCTTGCCCAGTTCAGGATGCTGGAAGAGGAAGGAGGAGGC  198

seq1  ATGAA-GGCCATGCACCTGGGCTGCTCTGGACGTCACCGTGGGCTTGGGC  237
      ||||| ||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGAAGGGCCATGCACCTGGGCTGCTCTGGACGTCACCGTGGGCTTGGGC  248

seq1  GGGGGAGGGCAGAGGAGGACAGTTACTCCTCCCTCAGGGTCGCTCTCAAG  287
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGGGAGGGCAGAGGAGGACAGTTACTCCTCCCTCAGGGTCGCTCTCAAG  298

seq1  TATGAAAGCAAACACACTGACACTCTGGAATCAGTGAGATTAAATCACAG  337
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATGAAAGCAAACACACTGACACTCTGGAATCAGTGAGATTAAATCACAG  348

seq1  CGCTGGAAGGAAGAGTCGTGCAAAGATAAGATGCAGAGCACCCCGGAGGG  387
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGCTGGAAGGAAGAGTCGTGCAAAGATAAGATGCAGAGCACCCCGGAGGG  398

seq1  AGACAGCAGGGGATGGTGGCTCCTGCCTACAGTTTACCAAAGCTGAAGCC  437
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGACAGCAGGGGATGGTGGCTCCTGCCTACAGTTTACCAAAGCTGAAGCC  448

seq1  GATGCAGGGTGAGTCACATCGGAGGTTAGCCTGAGCTACACAGTACAGTT  487
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATGCAGGGTGAGTCACATCGGAGGTTAGCCTGAGCTACACAGTACAGTT  498

seq1  CCAGGTCAACCTCGACTACAGCACTCAATCTCAATAATGAAATGAAATAA  537
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGGTCAACCTCGACTACAGCACTCAATCTCAATAATGAAATGAAATAA  548

seq1  AATAAAATAAAGGACAGGGGATGGGGAGAAAGGAACCCGGACCAGAGGAA  587
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATAAAATAAAGGACAGGGGATGGGGAGAAAGGAACCCGGACCAGAGGAA  598

seq1  TTACGCACCTTCTTCACTTTGGCCTGCTCAGCCTTGGAGTCCTTCTCGGC  637
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTACGCACCTTCTTCACTTTGGCCTGCTCAGCCTTGGAGTCCTTCTCGGC  648

seq1  CTTCTTGGCCAGTTTCTCCAGCTGCTTCGCTGTGAACTAAGCAGAAGCCA  687
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCTTGGCCAGTTTCTCCAGCTGCTTCGCTGTGAACTAAGCAGAAGCCA  698

seq1  TACATCCTGAGATGCACAGGTGGAGTTCACCCTTTAGCCCAGGACCTCTT  737
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACATCCTGAGATGCACAGGTGGAGTTCACCCTTTAGCCCAGGACCTCTT  748

seq1  CTCTGCCTGTGCTTGTTTCAACCCTGTGCTAAGGCACAAAGCCTCAAAGC  787
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTGCCTGTGCTTGTTTCAACCCTGTGCTAAGGCACAAAGCCTCAAAGC  798

seq1  GTAATTCCAGTCAGACACTGTGGGCTGTTAGAAACTGCAGCAGCCCAGGG  837
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAATTCCAGTCAGACACTGTGGGCTGTTAGAAACTGCAGCAGCCCAGGG  848

seq1  AGGAATCCCCCTAAAGCCCCACCCAGGACCTGGCCCTGTGTGCGAGGGGA  887
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGAATCCCCCTAAAGCCCCACCCAGGACCTGGCCCTGTGTGCGAGGGGA  898

seq1  GGCTGCAACAGGTTTCCTAAAGTGTCCATCACCTCTAGTAACACCCTAAC  937
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCTGCAACAGGTTTCCTAAAGTGTCCATCACCTCTAGTAACACCCTAAC  948

seq1  CTGTACCCTCCCCCAGAGTAGAAGGCTGACAAGACAATTAATGCTCACCA  987
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTACCCTCCCCCAGAGTAGAAGGCTGACAAGACAATTAATGCTCACCA  998

seq1  ACCCTGCCCCGGCTTGTGGGGGACTGTCAACTCACAGAAAGCACACAGAA  1037
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCCTGCCCCGGCTTGTGGGGGACTGTCAACTCACAGAAAGCACACAGAA  1048

seq1  CCTCCTTCAGGCTACTCAGGCAGTGACATAAACTCGTATAACTCTCTGTG  1087
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCCTTCAGGCTACTCAGGCAGTGACATAAACTCGTATAACTCTCTGTG  1098

seq1  GAGAATTC  1095
      ||||||||
seq2  GAGAATTC  1106

seq1: chr8_125625717_125626830
seq2: B6Ng01-276D16.g_67_1215

seq1  GAATTCAGTATTGTATTTCGTCACACCTGATTTCCCCCCGAGGAGTTAAG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAGTATTGTATTTCGTCACACCTGATTTCCCCCCGAGGAGTTAAG  50

seq1  TCAGGGCTAAAGGAGTTATCTAAGTAAATGGGGGAGTTTGGGGCTGGAGA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGGGCTAAAGGAGTTATCTAAGTAAATGGGGGAGTTTGGGGCTGGAGA  100

seq1  AATGACTCAGTAGTTACGATCACTGGCTGCTTGCTGTTTCAGAAGTTCAA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATGACTCAGTAGTTACGATCACTGGCTGCTTGCTGTTTCAGAAGTTCAA  150

seq1  TTCTCAGCACCCAGGAACTCCGGTAGTAGGGGATCCGACGCACAGCCATG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTCAGCACCCAGGAACTCCGGTAGTAGGGGATCCGACGCACAGCCATG  200

seq1  AAACCAGGGAGACACTCATACAAATAAAGTAAAAATAAATAAAAATCTTA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACCAGGGAGACACTCATACAAATAAAGTAAAAATAAATAAAAATCTTA  250

seq1  AAGTGGGGGGGGAAGTCTGGAATGGGGGTGCGTGCTTCAGTTCTGGGGAA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGTGGGGGGGGAAGTCTGGAATGGGGGTGCGTGCTTCAGTTCTGGGGAA  300

seq1  ACATAAATTCCAGGCAAATCTATAATAAATTTTCCTGGGTGGACGGGGAA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATAAATTCCAGGCAAATCTATAATAAATTTTCCTGGGTGGACGGGGAA  350

seq1  AAAACACTGGATCTAGGAGGGAGAAAGAGTTTTAGGGGTTTAATTCATAG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAACACTGGATCTAGGAGGGAGAAAGAGTTTTAGGGGTTTAATTCATAG  400

seq1  GTGCGCCCCTGAGCACGCCGGAGATACCCACACTGCGAAGTTAGGAACCA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGCGCCCCTGAGCACGCCGGAGATACCCACACTGCGAAGTTAGGAACCA  450

seq1  GCGAGAATAACCAACCCGACGGCTAGAAAGGCGATGGTCCGCCGGCGGGC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCGAGAATAACCAACCCGACGGCTAGAAAGGCGATGGTCCGCCGGCGGGC  500

seq1  GGGTTCGCGTGACGTCACTTCCCTTTCGCCTGATTTTGATTGGCGTTTGA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGTTCGCGTGACGTCACTTCCCTTTCGCCTGATTTTGATTGGCGTTTGA  550

seq1  GATTGGCCGGACTCCCTACAAGCCCAGGGTGCTTTGCGGTGCCCGGTCCT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATTGGCCGGACTCCCTACAAGCCCAGGGTGCTTTGCGGTGCCCGGTCCT  600

seq1  TTCCGCTCGGCCGTTCTCCTGTATAGGAGGTGAGTCTCTGCCGCCGCCGG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCGCTCGGCCGTTCTCCTGTATAGGAGGTGAGTCTCTGCCGCCGCCGG  650

seq1  TCCCATCGTGGTCCATCGGGCTCCATCGCCCTCCATCCGCTGTCATCGGC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCCATCGTGGTCCATCGGGCTCCATCGCCCTCCATCCGCTGTCATCGGC  700

seq1  GAAGAGAGGCCGCACGGACAGCCATGGAGGAGCCCGGGCGCCGACAGCAC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAGAGAGGCCGCACGGACAGCCATGGAGGAGCCCGGGCGCCGACAGCAC  750

seq1  GGAGCCAGGGCAGGGGCGGGAGGACCCGGGACGGGGTTGGGGACCCTGGC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAGCCAGGGCAGGGGCGGGAGGACCCGGGACGGGGTTGGGGACCCTGGC  800

seq1  CTTGACTCG-CCGCCCTCCTCT-CCCTCGCGGCCTTAGGCAGCCATGGCG  848
      ||||||||| |||||||||||| |||||||||||||||||||||||||||
seq2  CTTGACTCGCCCGCCCTCCTCTCCCCTCGCGGCCTTAGGCAGCCATGGCG  850

seq1  CCCAGCCGG-AATGGCATGATACT-GAAGCCCCAC-TTCCAC-AAGGATT  894
      ||||||||| |||||||||||||| |||||||||| |||||| |||||||
seq2  CCCAGCCGGAAATGGCATGATACTGGAAGCCCCACTTTCCACAAAGGATT  900

seq1  GGCAGCAGCGA-GTGGAC-ACTT-GGTTCAACCAG-CCGGCGCGCAAGAT  940
      ||||||||||| |||||| |||| ||||||||||| ||||||||||||||
seq2  GGCAGCAGCGAGGTGGACAACTTGGGTTCAACCAGCCCGGCGCGCAAGAT  950

seq1  --CCGCAGGTA-TAGATCGCGC-GTGGCTCGCG-TGGGCTCCA--GGGCG  983
        | ||||||| |||||||||| |||||||||| |||||| ||  |||||
seq2  TCCGGCAGGTATTAGATCGCGCGGTGGCTCGCGTTGGGCTTCAAGGGGCG  1000

seq1  GGG-ACGCGCGT-GGGGCA-GGAGG-TGAC-GGCTG-TGC-TTTTCCTGC  1026
      ||| |||||||| |||||| ||||| |||| ||||| ||| |||||||||
seq2  GGGAACGCGCGTGGGGGCAGGGAGGTTGACGGGCTGATGCTTTTTCCTGC  1050

seq1  AGGCGCAAGG-CCCGGCA--GGCG-AAAGCGCGTCGCATCGCCCCTCGCC  1072
      |||||||||| |||||||  | || |||||||||||||| | || |||  
seq2  AGGCGCAAGGACCCGGCAAGGTCGAAAAGCGCGTCGCATTGGCCTTCGGT  1100

seq1  CCG--CGTCC-GGCCCCATCAGGCCCA-TCG-TGA--GGTGCCCTACAG  1114
      |||   |||| ||||| |||||| ||| ||| |||  ||||||||||||
seq2  CCGGCGGTCCGGGCCCAATCAGGACCATTCGTTGAAGGGTGCCCTACAG  1149

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information