MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-349I22
Chromosome	8 (Build37)
Map Location	73,344,382 - 73,345,494
singlet/doublet	singlet
Overlap gene	Il12rb1
Upstream gene	Gmip, Edg4, Pbx4, Cilp2, BC028663, Ndufa13, Tssk6, Gatad2a, LOC665649, 9130404D08Rik, Sf4, Tm6sf2, Hapln4, Ncan, Rfxank, 2310073E15Rik, 2310045N01Rik, Mef2b, Tmem161a, Slc25a42, Armc6, Sfrs14, Homer3, Ddx49, Cope, Lass1, Upf1, Comp, Crtc1, Klhl26, Tmem59l, Crlf1, 2810428I15Rik, Uba52, Fkbp8, Ell, Isyna1, Ssbp4, Lrrc25, Gdf15, Pgpep1, Lsm4, Jund1, 2410018E23Rik, LOC100041434, Pde4c, Rab3a, BC051227, Ifi30, Pik3r2, LOC100041971, Mast3
Downstream gene	Arrdc2, Kcnn1, LOC100042011, Ccdc124, Slc5a5, Rpl18a, Snora68, Mtap1s, LOC100042057, LOC665858, LOC384645, LOC100041583, EG621377, 2410004L22Rik, Myo9b, 2010315L10Rik, Ocel1, Nr2f6, Ushbp1, 5430437P03Rik, Ankrd41, Abhd8, Mrpl34, 1500034J01Rik, Tmem16h, Gtpbp3, Plvap, LOC665928, Bst2, 1110012M11Rik, BC033932, Txnl6, Slc27a1, Pgls, Bcnp1, Glt25d1, Unc13a, Jak3, Insl3, B3gnt3, LOC100042289, Fcho1, EG665991, LOC665996
Link	Open Mouse BAC browser

Click to get alignment info.

name	Gmip (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78816 MGI:1926066
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Edg4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53978 MGI:1858422
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pbx4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80720 MGI:1931321
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cilp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68709 MGI:1915959
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC028663 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234365 MGI:2681845
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 4 Proteins

name	Ndufa13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67184 MGI:1914434
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tssk6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83984 MGI:2148775
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gatad2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234366 MGI:2384585
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665649 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665649
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 110 ESTs, 9 Proteins pseudo : _no_value

name	9130404D08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74549 MGI:1921799
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sf4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70616 MGI:1917866
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tm6sf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107770 MGI:1933210
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hapln4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330790 MGI:2679531
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ncan (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13004 MGI:104694
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rfxank (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19727 MGI:1333865
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	2310073E15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75692 MGI:1922942
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	2310045N01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72368 MGI:1919618
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 ESTs

name	Mef2b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17259 MGI:104526
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Tmem161a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234371 MGI:2384577
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc25a42 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73095 MGI:1920345
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Armc6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76813 MGI:1924063
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sfrs14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234373 MGI:2678085
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Homer3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26558 MGI:1347359
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ddx49 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234374 MGI:2136689
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cope (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59042 MGI:1891702
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lass1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93898 MGI:2136690
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Upf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19704 MGI:107995
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Comp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12845 MGI:88469
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Crtc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382056 MGI:2142523
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klhl26 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234378 MGI:2443079
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Tmem59l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67937 MGI:1915187
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Crlf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12931 MGI:1340030
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2810428I15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66462 MGI:1913712
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Uba52 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22186 MGI:98887
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fkbp8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14232 MGI:1341070
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ell (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13716 MGI:109377
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Isyna1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71780 MGI:1919030
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ssbp4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76900 MGI:1924150
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lrrc25 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:211228 MGI:2445284
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gdf15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23886 MGI:1346047
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pgpep1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66522 MGI:1913772
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lsm4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50783 MGI:1354692
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Jund1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16478 MGI:96648
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2410018E23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:637079 MGI:1916991
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 2 Proteins

name	LOC100041434 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041434
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs

name	Pde4c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110385 MGI:99556
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rab3a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19339 MGI:97843
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC051227 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234384 MGI:2681846
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ifi30 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:65972 MGI:2137648
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pik3r2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18709 MGI:1098772
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041971 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041971
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Mast3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546071 MGI:2683541
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 57 ESTs, 17 Proteins

name	Il12rb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16161 MGI:104579
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arrdc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70807 MGI:1918057
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kcnn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:84036 MGI:1933993
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042011 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042011
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Ccdc124 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234388 MGI:1916403
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc5a5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:114479 MGI:2149330
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpl18a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76808 MGI:1924058
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snora68 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104370 MGI:2148181
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mtap1s (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:270058 MGI:2443304
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042057 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042057
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST pseudo : _no_value

name	LOC665858 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665858
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC384645 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:384645
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein pseudo : _no_value

name	LOC100041583 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041583
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	EG621377 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:621377 MGI:3648141
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins

name	2410004L22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76478 MGI:1923728
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Myo9b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17925 MGI:106624
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2010315L10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67023 MGI:1914273
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Ocel1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77090 MGI:1924340
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nr2f6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13864 MGI:1352453
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ushbp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234395 MGI:1922920
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5430437P03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68251 MGI:1915501
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ankrd41 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234396 MGI:1918775
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 11 ESTs, 1 Protein

name	Abhd8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64296 MGI:1918946
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrpl34 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94065 MGI:2137227
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1500034J01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66498 MGI:1913748
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 147 ESTs, 3 Proteins

name	Tmem16h (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382014 MGI:2687327
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 209 ESTs, 9 Proteins

name	Gtpbp3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70359 MGI:1917609
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Plvap (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:84094 MGI:1890497
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665928 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665928
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 37 ESTs, 37 Proteins pseudo : _no_value

name	Bst2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69550 MGI:1916800
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1110012M11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73711 MGI:1920961
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC033932 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434325 MGI:3525074
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 13 ESTs, 1 Protein

name	Txnl6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234404 MGI:1924446
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc27a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26457 MGI:1347098
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pgls (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66171 MGI:1913421
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bcnp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100037278 MGI:3686743
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 ESTs, 1 Protein

name	Glt25d1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234407 MGI:1924348
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Unc13a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382018 MGI:3051532
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Jak3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16453 MGI:99928
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Insl3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16336 MGI:108427
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	B3gnt3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72297 MGI:2152535
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042289 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042289
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 226 ESTs, 21 Proteins pseudo : _no_value

name	Fcho1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74015 MGI:1921265
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG665991 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665991 MGI:3645671
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins

name	LOC665996 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665996
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Gmip (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37674213 GeneID:78816 MGI:1926066
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Gem-interacting protein transcript_id : NM_198101.1

name	Edg4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:103472009 GeneID:53978 MGI:1858422
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor 4 transcript_id : NM_020028.3

name	Pbx4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:68299790 GeneID:80720 MGI:1931321
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pre-B-cell leukemia transcription factor 4 transcript_id : NM_001024954.1

name	Cilp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110350655 GeneID:68709 MGI:1915959
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cartilage intermediate layer protein 2 transcript_id : NM_026818.1

name	BC028663 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94383626 GeneID:234365 MGI:2681845
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 4 Proteins product : cDNA sequence BC028663 transcript_id : XM_978251.1

name	Ndufa13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:55742659 GeneID:67184 MGI:1914434
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 13 transcript_id : NM_023312.2

name	Tssk6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:14030780 GeneID:83984 MGI:2148775
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : testis-specific serine kinase 6 transcript_id : NM_032004.1

name	Gatad2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30795221 GeneID:234366 MGI:2384585
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GATA zinc finger domain containing 2A transcript_id : NM_145596.2

name	9130404D08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349348 GeneID:74549 MGI:1921799
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9130404D08 gene transcript_id : NM_028993.3

name	Sf4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130369 GeneID:70616 MGI:1917866
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : splicing factor 4 transcript_id : NM_027481.2

name	Tm6sf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366159 GeneID:107770 MGI:1933210
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane 6 superfamily member 2 transcript_id : NM_181540.3

name	Hapln4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130529 GeneID:330790 MGI:2679531
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hyaluronan and proteoglycan link protein 4 transcript_id : NM_177900.4

name	Ncan (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40789267 GeneID:13004 MGI:104694
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neurocan transcript_id : NM_007789.2

name	Rfxank (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70980522 GeneID:19727 MGI:1333865
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : regulatory factor X-associated ankyrin-containing protein transcript_id : NM_001025589.1

name	Rfxank (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70980521 GeneID:19727 MGI:1333865
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : regulatory factor X-associated ankyrin-containing protein transcript_id : NM_011266.2

name	2310073E15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70980536 GeneID:75692 MGI:1922942
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310073E15 gene transcript_id : NM_001025586.1

name	2310073E15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70980528 GeneID:75692 MGI:1922942
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310073E15 gene transcript_id : NM_001025587.1

name	2310045N01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94383628 GeneID:72368 MGI:1919618
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 ESTs product : RIKEN cDNA 2310045N01 gene, transcript variant 1 transcript_id : XM_486121.4

name	Mef2b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113865984 GeneID:17259 MGI:104526
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myocyte enhancer factor 2B transcript_id : NM_008578.2

name	Mef2b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113865986 GeneID:17259 MGI:104526
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myocyte enhancer factor 2B transcript_id : NM_001045484.1

name	Tmem161a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542193 GeneID:234371 MGI:2384577
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 161A transcript_id : NM_145597.2

name	Slc25a42 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56090651 GeneID:73095 MGI:1920345
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 25, member 42 transcript_id : NM_001007570.1

name	Armc6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113199754 GeneID:76813 MGI:1924063
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : armadillo repeat containing 6 transcript_id : NM_133972.2

name	Sfrs14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982110 GeneID:234373 MGI:2678085
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : splicing factor, arginine/serine-rich 14 transcript_id : NM_172755.2

name	Homer3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33859657 GeneID:26558 MGI:1347359
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : homer homolog 3 (Drosophila) transcript_id : NM_011984.1

name	Ddx49 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:67972434 GeneID:234374 MGI:2136689
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DEAD (Asp-Glu-Ala-Asp) box polypeptide 49 transcript_id : NM_001024922.2

name	Cope (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10946971 GeneID:59042 MGI:1891702
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coatomer protein complex, subunit epsilon transcript_id : NM_021538.1

name	Lass1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20149717 GeneID:93898 MGI:2136690
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : longevity assurance homolog 1 (S. cerevisiae) transcript_id : NM_138647.1

name	Upf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13507600 GeneID:19704 MGI:107995
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UPF1 regulator of nonsense transcripts homolog (yeast) transcript_id : NM_030680.1

name	Comp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7710009 GeneID:12845 MGI:88469
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cartilage oligomeric matrix protein transcript_id : NM_016685.1

name	Crtc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131085 GeneID:382056 MGI:2142523
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CREB regulated transcription coactivator 1 transcript_id : NM_001004062.2

name	Klhl26 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:25286712 GeneID:234378 MGI:2443079
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kelch-like 26 (Drosophila) transcript_id : NM_172052.1

name	Klhl26 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383777 GeneID:234378 MGI:2443079
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kelch-like 26 (Drosophila) transcript_id : NM_178771.3

name	Tmem59l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130703 GeneID:67937 MGI:1915187
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 59-like transcript_id : NM_182991.2

name	Crlf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130761 GeneID:12931 MGI:1340030
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytokine receptor-like factor 1 transcript_id : NM_018827.2

name	2810428I15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803534 GeneID:66462 MGI:1913712
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2810428I15 gene transcript_id : NM_025577.2

name	Uba52 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802399 GeneID:22186 MGI:98887
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin A-52 residue ribosomal protein fusion product 1 transcript_id : NM_019883.3

name	Fkbp8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6857786 GeneID:14232 MGI:1341070
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FK506 binding protein 8 transcript_id : NM_010223.1

name	Ell (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124358952 GeneID:13716 MGI:109377
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : elongation factor RNA polymerase II transcript_id : NM_007924.2

name	Isyna1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12963756 GeneID:71780 MGI:1919030
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myo-inositol 1-phosphate synthase A1 transcript_id : NM_023627.1

name	Ssbp4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19526995 GeneID:76900 MGI:1924150
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : single stranded DNA binding protein 4 transcript_id : NM_133772.1

name	Lrrc25 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347603 GeneID:211228 MGI:2445284
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine rich repeat containing 25 transcript_id : NM_153074.3

name	Gdf15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753967 GeneID:23886 MGI:1346047
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : growth differentiation factor 15 transcript_id : NM_011819.1

name	Pgpep1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373774 GeneID:66522 MGI:1913772
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pyroglutamyl-peptidase I transcript_id : NM_023217.3

name	Lsm4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142376589 GeneID:50783 MGI:1354692
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LSM4 homolog, U6 small nuclear RNA associated (S. cerevisiae) transcript_id : NM_015816.2

name	Jund1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41352710 GeneID:16478 MGI:96648
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Jun proto-oncogene related gene d1 transcript_id : NM_010592.3

name	2410018E23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149258879 GeneID:637079 MGI:1916991
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 2 Proteins product : RIKEN cDNA 2410018E23 gene transcript_id : XM_979362.2

name	LOC100041434 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258881 GeneID:100041434
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs product : similar to mucin 2 precursor transcript_id : XM_001476374.1

name	Pde4c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130951 GeneID:110385 MGI:99556
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphodiesterase 4C, cAMP specific transcript_id : NM_201607.2

name	Rab3a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142346487 GeneID:19339 MGI:97843
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB3A, member RAS oncogene family transcript_id : NM_009001.4

name	BC051227 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130711 GeneID:234384 MGI:2681846
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC051227 transcript_id : NM_183170.2

name	Ifi30 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125628656 GeneID:65972 MGI:2137648
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interferon gamma inducible protein 30 transcript_id : NM_023065.3

name	Pik3r2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679320 GeneID:18709 MGI:1098772
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatidylinositol 3-kinase, regulatory subunit, polypeptide 2 (p85 beta) transcript_id : NM_008841.1

name	LOC100041971 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258896 GeneID:100041971
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : hypothetical protein LOC100041971 transcript_id : XM_001477714.1

name	Mast3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94383614 GeneID:546071 MGI:2683541
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 52 ESTs, 17 Proteins product : microtubule associated serine/threonine kinase 3, transcript variant 2 transcript_id : XM_888290.2

name	Il12rb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680398 GeneID:16161 MGI:104579
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 12 receptor, beta 1 transcript_id : NM_008353.1

name	Arrdc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037218 GeneID:70807 MGI:1918057
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : arrestin domain containing 2 transcript_id : NM_027560.1

name	Kcnn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:14161695 GeneID:84036 MGI:1933993
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium intermediate/small conductance calcium-activated channel, subfamily N, member 1 transcript_id : NM_032397.1

name	LOC100042011 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258898 GeneID:100042011
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : hypothetical protein LOC100042011 transcript_id : XM_001477857.1

name	Ccdc124 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893353 GeneID:234388 MGI:1916403
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 124 transcript_id : NM_026964.3

name	Slc5a5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:17298677 GeneID:114479 MGI:2149330
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 5 (sodium iodide symporter), member 5 transcript_id : NM_053248.1

name	Rpl18a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803580 GeneID:76808 MGI:1924058
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Ribosomal protein L18A transcript_id : NM_029751.3

name	Mtap1s (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802735 GeneID:270058 MGI:2443304
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : microtubule-associated protein 1S transcript_id : NM_173013.2

name	LOC665858 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258885 GeneID:665858
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : similar to ankyrin repeat domain 26 transcript_id : XM_001476565.1

name	2410004L22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802841 GeneID:76478 MGI:1923728
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2410004L22 gene transcript_id : NM_029621.2

name	Myo9b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124053458 GeneID:17925 MGI:106624
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myosin IXb transcript_id : NM_015742.2

name	2010315L10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348354 GeneID:67023 MGI:1914273
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2010315L10 gene transcript_id : NM_025917.2

name	2010315L10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119360275 GeneID:67023 MGI:1914273
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2010315L10 gene transcript_id : NM_029768.3

name	Ocel1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037486 GeneID:77090 MGI:1924340
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : occludin/ELL domain containing 1 transcript_id : NM_029865.1

name	Nr2f6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112807198 GeneID:13864 MGI:1352453
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear receptor subfamily 2, group F, member 6 transcript_id : NM_010150.2

name	Ushbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31340881 GeneID:234395 MGI:1922920
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Usher syndrome 1C binding protein 1 transcript_id : NM_181418.2

name	5430437P03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30794445 GeneID:68251 MGI:1915501
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5430437P03 gene transcript_id : NM_026636.1

name	Ankrd41 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149258903 GeneID:234396 MGI:1918775
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs, 1 Protein product : ankyrin repeat domain 41, transcript variant 2 transcript_id : XM_001478177.1

name	Ankrd41 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149258901 GeneID:234396 MGI:1918775
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs, 1 Protein product : ankyrin repeat domain 41, transcript variant 1 transcript_id : XM_001478168.1

name	Abhd8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803545 GeneID:64296 MGI:1918946
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : abhydrolase domain containing 8 transcript_id : NM_022419.2

name	Mrpl34 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114145576 GeneID:94065 MGI:2137227
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein L34 transcript_id : NM_053162.2

name	1500034J01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149258889 GeneID:66498 MGI:1913748
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 147 ESTs, 3 Proteins product : RIKEN cDNA 1500034J01 gene transcript_id : XM_001476732.1

name	Tmem16h (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94383629 GeneID:382014 MGI:2687327
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 209 ESTs, 9 Proteins product : transmembrane protein 16H, transcript variant 1 transcript_id : XM_889480.2

name	Gtpbp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130758 GeneID:70359 MGI:1917609
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GTP binding protein 3 transcript_id : NM_032544.3

name	Plvap (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:14161697 GeneID:84094 MGI:1890497
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : plasmalemma vesicle associated protein transcript_id : NM_032398.1

name	Bst2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366701 GeneID:69550 MGI:1916800
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bone marrow stromal cell antigen 2 transcript_id : NM_198095.2

name	1110012M11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27753999 GeneID:73711 MGI:1920961
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110012M11 gene transcript_id : NM_028617.2

name	BC033932 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149258905 GeneID:434325 MGI:3525074
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 13 ESTs, 1 Protein product : cDNA sequence BC033932 transcript_id : XM_486124.5

name	Txnl6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21704203 GeneID:234404 MGI:1924446
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thioredoxin-like 6 transcript_id : NM_145598.1

name	Slc27a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129963 GeneID:26457 MGI:1347098
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 27 (fatty acid transporter), member 1 transcript_id : NM_011977.3

name	Pgls (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370963 GeneID:66171 MGI:1913421
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 6-phosphogluconolactonase transcript_id : NM_025396.2

name	Bcnp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149258906 GeneID:100037278 MGI:3686743
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 ESTs, 1 Protein product : BCNP1 homolog transcript_id : XM_001478428.1

name	Glt25d1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387811 GeneID:234407 MGI:1924348
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glycosyltransferase 25 domain containing 1 transcript_id : NM_146211.2

name	Unc13a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71274169 GeneID:382018 MGI:3051532
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : unc-13 homolog A (C. elegans) transcript_id : NM_001029873.1

name	Jak3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372856 GeneID:16453 MGI:99928
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Janus kinase 3 transcript_id : NM_010589.4

name	Insl3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133922576 GeneID:16336 MGI:108427
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : insulin-like 3 transcript_id : NM_013564.5

name	B3gnt3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982624 GeneID:72297 MGI:2152535
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 3 transcript_id : NM_028189.2

name	Fcho1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27754000 GeneID:74015 MGI:1921265
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FCH domain only 1 transcript_id : NM_028715.2

name	EG665991 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94383649 GeneID:665991 MGI:3645671
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins product : predicted gene, EG665991 transcript_id : XM_980754.1

name	Gmip (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37674214 CCDS:CCDS22350.1 GeneID:78816 MGI:1926066
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0019992 - diacylglycerol binding [Evidence IEA]; GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : Gem-interacting protein protein_id : NP_932769.1

name	Edg4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254539 GeneID:53978 MGI:1858422
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0001619 - lysosphingolipid and lysophosphatidic acid receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor 4 protein_id : NP_064412.2

name	Pbx4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:68299791 CCDS:CCDS22352.1 GeneID:80720 MGI:1931321
definition	GO_component : GO:0005634 - nucleus [Evidence IMP] [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0009790 - embryonic development [Evidence IMP]; GO:0030902 - hindbrain development [Evidence IMP]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0045898 - regulation of transcriptional preinitiation complex formation [Evidence IMP]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : pre-B-cell leukemia homeobox 4 protein_id : NP_001020125.1

name	Cilp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110350656 GeneID:68709 MGI:1915959
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : cartilage intermediate layer protein 2 protein_id : NP_081094.1

name	BC028663 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94383627 GeneID:234365 MGI:2681845
definition	codon_start : 1 product : similar to BC028663 protein protein_id : XP_983345.1

name	Ndufa13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963633 CCDS:CCDS22353.1 GeneID:67184 MGI:1914434
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0016020 - membrane [Evidence IEA]; GO:0005746 - mitochondrial electron transport chain [Evidence ISS]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence ISS] [Evidence IDA]; GO:0005654 - nucleoplasm [Evidence ISS]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence ISS] [Evidence TAS]; GO:0008137 - NADH dehydrogenase (ubiquinone) activity [Evidence IEA] [Evidence ISS]; GO:0003954 - NADH dehydrogenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0006915 - apoptosis [Evidence IDA]; GO:0030262 - apoptotic nuclear changes [Evidence ISS]; GO:0008624 - induction of apoptosis by extracellular signals [Evidence ISS]; GO:0030308 - negative regulation of cell growth [Evidence ISS]; GO:0045892 - negative regulation of transcription, DNA-dependent [Evidence ISS]; GO:0006606 - protein import into nucleus [Evidence ISS] codon_start : 1 note : genes associated with retinoid-IFN-induced mortality 19 product : NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 13 protein_id : NP_075801.1

name	Tssk6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:14030781 CCDS:CCDS22354.1 GeneID:83984 MGI:2148775
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA] [Evidence ISS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA] [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence ISS]; GO:0035092 - sperm chromatin condensation [Evidence IMP]; GO:0007283 - spermatogenesis [Evidence IEA] codon_start : 1 note : serine/threonine protein kinase SSTK product : testis-specific serine kinase 6 protein_id : NP_114393.1

name	Gatad2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30795222 CCDS:CCDS22355.1 GeneID:234366 MGI:2384585
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IEA]; GO:0016581 - NuRD complex [Evidence ISS] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0030674 - protein binding, bridging [Evidence ISS]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0016564 - transcriptional repressor activity [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006306 - DNA methylation [Evidence ISS]; GO:0045892 - negative regulation of transcription, DNA-dependent [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : p66 alpha homolog protein_id : NP_663571.2

name	9130404D08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981307 GeneID:74549 MGI:1921799
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC74549 protein_id : NP_083269.3

name	Sf4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28076967 CCDS:CCDS22356.1 GeneID:70616 MGI:1917866
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA]; GO:0005681 - spliceosome complex [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA]; GO:0006396 - RNA processing [Evidence IEA] codon_start : 1 product : splicing factor 4 protein_id : NP_081757.1

name	Tm6sf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31559811 CCDS:CCDS22357.1 GeneID:107770 MGI:1933210
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] codon_start : 1 product : transmembrane 6 superfamily member 2 protein_id : NP_853518.1

name	Hapln4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244530 GeneID:330790 MGI:2679531
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0005540 - hyaluronic acid binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 note : brain linked protein 2; link protein 4 product : brain link protein 2 protein_id : NP_808568.1

name	Ncan (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40789268 CCDS:CCDS22358.1 GeneID:13004 MGI:104694
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005540 - hyaluronic acid binding [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 note : TGFbeta-induced transcript, brain product : chondroitin sulfate proteoglycan 3 protein_id : NP_031815.2

name	2310073E15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70980537 GeneID:75692 MGI:1922942
definition	codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : hypothetical protein LOC75692 isoform 1 protein_id : NP_001020757.1

name	2310073E15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70980529 GeneID:75692 MGI:1922942
definition	codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : hypothetical protein LOC75692 isoform 2 protein_id : NP_001020758.1

name	Rfxank (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70980523 GeneID:19727 MGI:1333865
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007265 - Ras protein signal transduction [Evidence IPI]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : regulatory factor X-associated ankyrin-containing protein isoform 2 protein_id : NP_001020760.1

name	Rfxank (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755316 CCDS:CCDS22360.1 GeneID:19727 MGI:1333865
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007265 - Ras protein signal transduction [Evidence IPI]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : regulatory factor X-associated ankyrin-containing protein isoform 1 protein_id : NP_035396.1

name	2310045N01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63575389 GeneID:72368 MGI:1919618
definition	codon_start : 1 product : hypothetical protein LOC72368 isoform 1 protein_id : XP_486121.2

name	Mef2b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113865985 CCDS:CCDS22361.1 GeneID:17259 MGI:104526
definition	GO_component : GO:0005634 - nucleus [Evidence IC] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IDA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : myocyte enhancer factor 2B isoform 1 protein_id : NP_032604.2

name	Mef2b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113865987 GeneID:17259 MGI:104526
definition	GO_component : GO:0005634 - nucleus [Evidence IC] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IDA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : myocyte enhancer factor 2B isoform 2 protein_id : NP_001038949.1

name	Tmem161a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704194 GeneID:234371 MGI:2384577
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] codon_start : 1 product : hypothetical protein LOC234371 protein_id : NP_663572.1

name	Slc25a42 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56090652 GeneID:73095 MGI:1920345
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA] GO_function : GO:0005488 - binding [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : solute carrier family 25, member 42 protein_id : NP_001007571.1

name	Armc6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113199755 GeneID:76813 MGI:1924063
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : armadillo repeat containing 6 protein_id : NP_598733.2

name	Sfrs14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982111 CCDS:CCDS22362.1 GeneID:234373 MGI:2678085
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA]; GO:0006396 - RNA processing [Evidence IEA] codon_start : 1 exception : mismatches in translation product : arginine/serine-rich 14 splicing factor protein_id : NP_766343.2

name	Homer3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859658 CCDS:CCDS22363.1 GeneID:26558 MGI:1347359
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_process : GO:0007216 - metabotropic glutamate receptor signaling pathway [Evidence TAS] codon_start : 1 exception : mismatches in translation note : homer, neuronal immediate early gene, 3 product : homer homolog 3 protein_id : NP_036114.1

name	Ddx49 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67972435 CCDS:CCDS22364.1 GeneID:234374 MGI:2136689
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008026 - ATP-dependent helicase activity [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : DEAD (aspartate-glutamate-alanine-aspartate) box polypeptide 27; DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 49 product : DEAD (Asp-Glu-Ala-Asp) box polypeptide 49 protein_id : NP_001020093.2

name	Cope (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946972 CCDS:CCDS22365.1 GeneID:59042 MGI:1891702
definition	GO_component : GO:0030137 - COPI-coated vesicle [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0008565 - protein transporter activity [Evidence IEA] GO_process : GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : nonclathrin coat protein epsilon-COP product : epsilon subunit of coatomer protein complex protein_id : NP_067513.1

name	Lass1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20149718 GeneID:93898 MGI:2136690
definition	GO_function : GO:0008083 - growth factor activity [Evidence IEA] codon_start : 1 product : longevity assurance homolog 1 protein_id : NP_619588.1

name	Upf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13507601 GeneID:19704 MGI:107995
definition	GO_component : GO:0000785 - chromatin [Evidence ISS]; GO:0005737 - cytoplasm [Evidence ISS] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004004 - ATP-dependent RNA helicase activity [Evidence ISS]; GO:0003682 - chromatin binding [Evidence ISS]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0003723 - RNA binding [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence ISS]; GO:0006281 - DNA repair [Evidence ISS]; GO:0006260 - DNA replication [Evidence ISS]; GO:0000184 - mRNA catabolism, nonsense-mediated decay [Evidence IEA] [Evidence ISS]; GO:0006406 - mRNA export from nucleus [Evidence ISS]; GO:0006449 - regulation of translational termination [Evidence ISS]; GO:0006396 - RNA processing [Evidence ISS] codon_start : 1 exception : mismatches in translation function : involved in reduction of nonsense mRNA note : nonsense mRNA reducing factor 1 product : regulator of nonsense transcripts 1 protein_id : NP_109605.1

name	Comp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7710010 CCDS:CCDS22367.1 GeneID:12845 MGI:88469
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : cartilage oligomeric matrix protein protein_id : NP_057894.1

name	Crtc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51783963 GeneID:382056 MGI:2142523
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0008140 - cAMP response element binding protein binding [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : mucoepidermoid carcinoma translocated 1 protein_id : NP_001004062.1

name	Klhl26 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:25286713 GeneID:234378 MGI:2443079
definition	codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : kelch-like 26 isoform 1 protein_id : NP_742049.1

name	Klhl26 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31044491 GeneID:234378 MGI:2443079
definition	codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : kelch-like 26 isoform 2 protein_id : NP_848886.1

name	Tmem59l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33695141 CCDS:CCDS22368.1 GeneID:67937 MGI:1915187
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : brain-specific membrane-anchored protein protein_id : NP_892036.1

name	Crlf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9055196 CCDS:CCDS22369.1 GeneID:12931 MGI:1340030
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : cytokine receptor like molecule 3 product : cytokine receptor-like factor 1 protein_id : NP_061297.1

name	2810428I15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385020 CCDS:CCDS22370.1 GeneID:66462 MGI:1913712
definition	codon_start : 1 product : hypothetical protein LOC66462 protein_id : NP_079853.1

name	Uba52 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9845265 CCDS:CCDS22371.1 GeneID:22186 MGI:98887
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0006464 - protein modification [Evidence IEA] codon_start : 1 note : ubiquitin/60S ribosomal fusion protein product : ubiquitin A-52 residue ribosomal protein fusion product 1 protein_id : NP_063936.1

name	Fkbp8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6857787 GeneID:14232 MGI:1341070
definition	GO_component : GO:0030176 - integral to endoplasmic reticulum membrane [Evidence IDA]; GO:0005740 - mitochondrial envelope [Evidence IDA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0016853 - isomerase activity [Evidence IEA]; GO:0003755 - peptidyl-prolyl cis-trans isomerase activity [Evidence IEA] GO_process : GO:0001708 - cell fate specification [Evidence IMP]; GO:0009953 - dorsal/ventral pattern formation [Evidence IMP]; GO:0001747 - eye development (sensu Mammalia) [Evidence IMP]; GO:0006457 - protein folding [Evidence IEA]; GO:0007224 - smoothened signaling pathway [Evidence IGI] [Evidence IMP] codon_start : 1 exception : mismatches in translation note : FK506-binding protein 38 product : FK506 binding protein 8 protein_id : NP_034353.1

name	Ell (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124358953 CCDS:CCDS22372.1 GeneID:13716 MGI:109377
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003746 - translation elongation factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : eleven-nineteen lysine-rich leukemia product : elongation factor RNA polymerase II protein_id : NP_031950.2

name	Isyna1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963757 CCDS:CCDS22373.1 GeneID:71780 MGI:1919030
definition	GO_function : GO:0016853 - isomerase activity [Evidence IEA] codon_start : 1 product : myo-inositol 1-phosphate synthase A1 protein_id : NP_076116.1

name	Ssbp4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526996 CCDS:CCDS22374.1 GeneID:76900 MGI:1924150
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003697 - single-stranded DNA binding [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : single stranded DNA binding protein 4 protein_id : NP_598533.1

name	Lrrc25 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346481 CCDS:CCDS22375.1 GeneID:211228 MGI:2445284
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : monocyte and plasmacytoid activated molecule product : leucine rich repeat containing 25 protein_id : NP_694714.1

name	Gdf15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753968 CCDS:CCDS22376.1 GeneID:23886 MGI:1346047
definition	GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0008083 - growth factor activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : macrophage inhibiting cytokine-1 product : growth differentiation factor 15 protein_id : NP_035949.1

name	Pgpep1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963583 CCDS:CCDS22377.1 GeneID:66522 MGI:1913772
definition	GO_function : GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004219 - pyroglutamyl-peptidase I activity [Evidence ISS] [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence ISS] [Evidence IEA] codon_start : 1 product : putative pyroglutamyl-peptidase I protein_id : NP_075706.1

name	Lsm4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7657317 GeneID:50783 MGI:1354692
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005681 - spliceosome complex [Evidence ISS] GO_function : GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0016071 - mRNA metabolism [Evidence IEA]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy function : putative role in U6 snRNP assembly and function note : U6 snRNA-associated SM-like protein 4 product : LSM4 homolog, U6 small nuclear RNA associated protein_id : NP_056631.1

name	Jund1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754404 GeneID:16478 MGI:96648
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0046983 - protein dimerization activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0050875 - cellular physiological process [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : JunD-FL isoform product : jun D proto-oncogene protein_id : NP_034722.1

name	2410018E23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149258880 GeneID:637079 MGI:1916991
definition	codon_start : 1 product : similar to KIAA1683 protein protein_id : XP_984456.2

name	LOC100041434 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258882 GeneID:100041434
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476424.1

name	Pde4c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:42475542 CCDS:CCDS22378.1 GeneID:110385 MGI:99556
definition	GO_function : GO:0004115 - 3',5'-cyclic-AMP phosphodiesterase activity [Evidence IEA]; GO:0004114 - 3',5'-cyclic-nucleotide phosphodiesterase activity [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : phosphodiesterase 4C, cAMP specific protein_id : NP_963901.1

name	Rab3a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679593 CCDS:CCDS22379.1 GeneID:19339 MGI:97843
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0008021 - synaptic vesicle [Evidence IDA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] [Evidence IPI] GO_process : GO:0006887 - exocytosis [Evidence IEA]; GO:0017157 - regulation of exocytosis [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : RAB3A, member RAS oncogene family protein_id : NP_033027.1

name	BC051227 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34147205 CCDS:CCDS22380.1 GeneID:234384 MGI:2681846
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] codon_start : 1 product : hypothetical protein LOC234384 protein_id : NP_898993.1

name	Ifi30 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125628657 GeneID:65972 MGI:2137648
definition	GO_component : GO:0005764 - lysosome [Evidence IDA] GO_function : GO:0015036 - disulfide oxidoreductase activity [Evidence TAS] GO_process : GO:0019886 - antigen processing and presentation of exogenous peptide antigen via MHC class II [Evidence IMP] codon_start : 1 exception : unclassified translation discrepancy note : lysosomal thiol reductase IP30; lysosomal thio reductase IP30 product : interferon gamma inducible protein 30 protein_id : NP_075552.2

name	Pik3r2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679321 CCDS:CCDS22381.1 GeneID:18709 MGI:1098772
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005942 - phosphoinositide 3-kinase complex [Evidence NAS] [Evidence IEA] GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0016303 - phosphatidylinositol 3-kinase activity [Evidence IMP]; GO:0035014 - phosphoinositide 3-kinase regulator activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008286 - insulin receptor signaling pathway [Evidence NAS]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0019987 - negative regulation of anti-apoptosis [Evidence IMP]; GO:0042325 - regulation of phosphorylation [Evidence NAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation product : phosphatidylinositol 3-kinase, regulatory subunit, polypeptide 2 (p85 beta) protein_id : NP_032867.1

name	LOC100041971 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258897 GeneID:100041971
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477764.1

name	Mast3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94383615 GeneID:546071 MGI:2683541
definition	codon_start : 1 product : microtubule associated serine/threonine kinase 3 isoform 2 protein_id : XP_893383.2

name	Il12rb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680399 CCDS:CCDS22382.1 GeneID:16161 MGI:104579
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004896 - hematopoietin/interferon-class (D200-domain) cytokine receptor activity [Evidence IEA]; GO:0004907 - interleukin receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007166 - cell surface receptor linked signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation product : interleukin 12 receptor, beta 1 protein_id : NP_032379.1

name	Arrdc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037219 GeneID:70807 MGI:1918057
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : induced by lysergic acid diethylamide-1 product : arrestin domain containing 2 protein_id : NP_081836.1

name	Kcnn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:14161696 GeneID:84036 MGI:1933993
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015269 - calcium-activated potassium channel activity [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IDA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0016286 - small conductance calcium-activated potassium channel activity [Evidence ISS] [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : small conductance calcium-activated potassium channel protein 1 product : potassium intermediate/small conductance calcium-activated channel, subfamily N, member 1 protein_id : NP_115773.1

name	LOC100042011 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258899 GeneID:100042011
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477907.1

name	Ccdc124 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47059143 CCDS:CCDS22384.1 GeneID:234388 MGI:1916403
definition	codon_start : 1 product : coiled-coil domain containing 124 protein_id : NP_081240.1

name	Slc5a5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:17298678 CCDS:CCDS22385.1 GeneID:114479 MGI:2149330
definition	GO_function : GO:0031402 - sodium ion binding [Evidence IEA]; GO:0008507 - sodium:iodide symporter activity [Evidence IDA]; GO:0015293 - symporter activity [Evidence IDA] GO_process : GO:0006811 - ion transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : solute carrier family 5 (sodium iodide symporter), member 5 protein_id : NP_444478.1

name	Rpl18a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037465 CCDS:CCDS22386.1 GeneID:76808 MGI:1924058
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA] codon_start : 1 product : Ribosomal protein L18A protein_id : NP_084027.1

name	Mtap1s (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370520 CCDS:CCDS22387.1 GeneID:270058 MGI:2443304
definition	GO_component : GO:0043025 - cell soma [Evidence IDA]; GO:0005829 - cytosol [Evidence ISS]; GO:0030425 - dendrite [Evidence IDA]; GO:0005874 - microtubule [Evidence IDA]; GO:0005634 - nucleus [Evidence ISS]; GO:0048471 - perinuclear region [Evidence ISS] GO_function : GO:0051015 - actin filament binding [Evidence IDA]; GO:0048487 - beta-tubulin binding [Evidence ISS]; GO:0003677 - DNA binding [Evidence ISS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0042802 - identical protein binding [Evidence IDA]; GO:0008017 - microtubule binding [Evidence IDA] GO_process : GO:0006915 - apoptosis [Evidence ISS]; GO:0007420 - brain development [Evidence IEP]; GO:0001578 - microtubule bundle formation [Evidence ISS]; GO:0000226 - microtubule cytoskeleton organization and biogenesis [Evidence IDA]; GO:0007399 - nervous system development [Evidence IEP]; GO:0048812 - neurite morphogenesis [Evidence ISS] codon_start : 1 exception : mismatches in translation note : microtubule-associated protein 8 product : BPY2 interacting protein 1 protein_id : NP_766601.1

name	LOC665858 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258886 GeneID:665858
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476615.1

name	2410004L22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386422 CCDS:CCDS22389.1 GeneID:76478 MGI:1923728
definition	codon_start : 1 exception : mismatches in translation product : RIKEN cDNA 2410004L22 protein_id : NP_083897.1

name	Myo9b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124053459 GeneID:17925 MGI:106624
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0016459 - myosin [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0019992 - diacylglycerol binding [Evidence IEA]; GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0003774 - motor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : myosin IXb protein_id : NP_056557.2

name	2010315L10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21630259 CCDS:CCDS22390.1 GeneID:67023 MGI:1914273
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence ISS] [Evidence IEA] [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0005764 - lysosome [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006888 - ER to Golgi vesicle-mediated transport [Evidence IMP]; GO:0007041 - lysosomal transport [Evidence IMP]; GO:0030163 - protein catabolism [Evidence IMP]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; mouse embryonic development factor 2 product : hypothetical protein LOC67023 isoform 1 protein_id : NP_080193.1

name	2010315L10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21630273 GeneID:67023 MGI:1914273
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence ISS] [Evidence IEA] [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0005764 - lysosome [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006888 - ER to Golgi vesicle-mediated transport [Evidence IMP]; GO:0007041 - lysosomal transport [Evidence IMP]; GO:0030163 - protein catabolism [Evidence IMP]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; mouse embryonic development factor 2 product : hypothetical protein LOC67023 isoform 2 protein_id : NP_084044.1

name	Ocel1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037487 CCDS:CCDS22391.1 GeneID:77090 MGI:1924340
definition	GO_function : GO:0003746 - translation elongation factor activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : occludin/ELL domain containing 1 protein_id : NP_084141.1

name	Nr2f6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112807199 CCDS:CCDS22392.1 GeneID:13864 MGI:1352453
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0004879 - ligand-dependent nuclear receptor activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003707 - steroid hormone receptor activity [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0050965 - detection of temperature stimulus during sensory perception of pain [Evidence IMP]; GO:0043153 - entrainment of circadian clock by photoperiod [Evidence IMP]; GO:0048666 - neuron development [Evidence IMP]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : avian erythroblastic leukemia viral (v-erb-a) oncogene homolog-like 2 product : nuclear receptor subfamily 2, group F, member 6 protein_id : NP_034280.2

name	Ushbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31088878 CCDS:CCDS22393.1 GeneID:234395 MGI:1922920
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0030165 - PDZ domain binding [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : AIE-75 binding protein protein_id : NP_852083.1

name	5430437P03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794446 GeneID:68251 MGI:1915501
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC68251 protein_id : NP_080912.1

name	Ankrd41 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149258904 GeneID:234396 MGI:1918775
definition	codon_start : 1 product : ankyrin repeat domain 41 isoform 2 protein_id : XP_001478227.1

name	Ankrd41 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149258902 GeneID:234396 MGI:1918775
definition	codon_start : 1 product : ankyrin repeat domain 41 isoform 1 protein_id : XP_001478218.1

name	Abhd8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11967947 GeneID:64296 MGI:1918946
definition	GO_function : GO:0004301 - epoxide hydrolase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation function : expression of this gene product inhibits the growth of E. coli product : abhydrolase domain containing 8 protein_id : NP_071864.1

name	Mrpl34 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716449 GeneID:94065 MGI:2137227
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005762 - mitochondrial large ribosomal subunit [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence TAS] codon_start : 1 product : mitochondrial ribosomal protein L34 protein_id : NP_444392.1

name	1500034J01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149258890 GeneID:66498 MGI:1913748
definition	codon_start : 1 product : hypothetical protein LOC66498 protein_id : XP_001476782.1

name	Tmem16h (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82917876 GeneID:382014 MGI:2687327
definition	codon_start : 1 product : similar to Tmem16h protein isoform 1 protein_id : XP_894573.1

name	Gtpbp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33414589 GeneID:70359 MGI:1917609
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA] codon_start : 1 product : GTP binding protein 3 protein_id : NP_115933.2

name	Plvap (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:14161698 CCDS:CCDS22396.1 GeneID:84094 MGI:1890497
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 exception : mismatches in translation product : plasmalemma vesicle associated protein protein_id : NP_115774.1

name	Bst2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37674242 CCDS:CCDS22397.1 GeneID:69550 MGI:1916800
definition	codon_start : 1 note : DAMP-1 protein homolog product : DAMP-1 protein protein_id : NP_932763.1

name	1110012M11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312058 CCDS:CCDS22398.1 GeneID:73711 MGI:1920961
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 product : hypothetical protein LOC73711 protein_id : NP_082893.1

name	BC033932 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82917885 GeneID:434325 MGI:3525074
definition	codon_start : 1 product : similar to BC033932 protein protein_id : XP_486124.2

name	Txnl6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704204 GeneID:234404 MGI:1924446
definition	GO_function : GO:0015035 - protein disulfide oxidoreductase activity [Evidence IEA] codon_start : 1 product : thioredoxin-like 6 protein_id : NP_663573.1

name	Slc27a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755546 GeneID:26457 MGI:1347098
definition	GO_component : GO:0031410 - cytoplasmic vesicle [Evidence TAS]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence TAS] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0004467 - long-chain-fatty-acid-CoA ligase activity [Evidence TAS]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006631 - fatty acid metabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0006869 - lipid transport [Evidence IEA]; GO:0001676 - long-chain fatty acid metabolism [Evidence TAS]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : fatty acid transport protein product : solute carrier family 27, member 1 protein_id : NP_036107.1

name	Pgls (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384778 CCDS:CCDS22400.1 GeneID:66171 MGI:1913421
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA] codon_start : 1 product : 6-phosphogluconolactonase protein_id : NP_079672.1

name	Bcnp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149258907 GeneID:100037278 MGI:3686743
definition	codon_start : 1 product : similar to LOC498604 protein protein_id : XP_001478478.1

name	Glt25d1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122765 CCDS:CCDS22401.1 GeneID:234407 MGI:1924348
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0009103 - lipopolysaccharide biosynthesis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : glycosyltransferase 25 domain containing 1 protein_id : NP_666323.1

name	Unc13a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71274170 CCDS:CCDS22402.1 GeneID:382018 MGI:3051532
definition	GO_function : GO:0019992 - diacylglycerol binding [Evidence IDA] GO_process : GO:0050435 - beta-amyloid metabolism [Evidence IMP]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0016188 - synaptic vesicle maturation [Evidence IMP] codon_start : 1 exception : mismatches in translation product : unc-13 homolog A protein_id : NP_001025044.1

name	Jak3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46559418 CCDS:CCDS22403.1 GeneID:16453 MGI:99928
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004718 - Janus kinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0048535 - lymph node development [Evidence TAS]; GO:0018108 - peptidyl-tyrosine phosphorylation [Evidence IDA]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 product : Janus kinase 3 protein_id : NP_034719.2

name	Insl3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56119092 CCDS:CCDS22404.1 GeneID:16336 MGI:108427
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005179 - hormone activity [Evidence IEA] GO_process : GO:0001701 - embryonic development (sensu Mammalia) [Evidence IMP]; GO:0008584 - male gonad development [Evidence IMP]; GO:0007582 - physiological process [Evidence IEA] codon_start : 1 note : relaxin like factor; Ley I-L product : insulin-like 3 protein_id : NP_038592.3

name	B3gnt3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982625 CCDS:CCDS22405.1 GeneID:72297 MGI:2152535
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] codon_start : 1 exception : mismatches in translation note : core 1 beta-1,3-N-acetylglucosaminyltransferase product : UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 3 protein_id : NP_082465.2

name	Fcho1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27754001 GeneID:74015 MGI:1921265
definition	codon_start : 1 exception : mismatches in translation product : FCH domain only 1 protein_id : NP_082991.2

name	EG665991 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94383650 GeneID:665991 MGI:3645671
definition	codon_start : 1 product : similar to F2rl3 protein protein_id : XP_985848.1

name	LOC100041583 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041583
definition	number : 2 pseudo : _no_value

name	LOC100041583 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041583
definition	number : 1 pseudo : _no_value

name	EG621377 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:621377
definition	number : 1

name	EG621377 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:621377
definition	number : 2

name	EG621377 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:621377
definition	number : 3

name	LOC665996 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665996
definition	number : 1 pseudo : _no_value

name	LOC665996 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665996
definition	number : 2 pseudo : _no_value

name	LOC665649 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149258888 GeneID:665649
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 110 ESTs, 9 Proteins product : similar to Nucleoside diphosphate kinase B (NDK B) (NDP kinase B) (P18) pseudo : _no_value transcript_id : XR_032879.1

name	Snora68 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:86604691 GeneID:104370 MGI:2148181
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small nucleolar RNA, H/ACA box 68 transcript_id : NR_002901.1

name	LOC100042057 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149258900 GeneID:100042057
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100042057 pseudo : _no_value transcript_id : XR_033490.1

name	LOC384645 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149258887 GeneID:384645
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : hypothetical LOC384645 pseudo : _no_value transcript_id : XR_032831.1

name	LOC665928 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149258891 GeneID:665928
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 37 ESTs, 37 Proteins product : similar to LOC298795 protein pseudo : _no_value transcript_id : XR_032903.1

name	LOC100042289 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149258908 GeneID:100042289
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 226 ESTs, 21 Proteins product : similar to H3 histone, family 3A pseudo : _no_value transcript_id : XR_033709.1

clone name	MSMg01-423N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-179N03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416C04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-072G04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-164C17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-211J15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-344E09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-291C09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-162F14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-540H09
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-274J16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-072L15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348I08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-270M10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-325O02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-439D14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-118M11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-146P19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-470N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-519L03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-530I03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134J23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-401O18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-390I16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-109L22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-441G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-164L03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-547E13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-501O01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-453L12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-162D16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-401P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-350I22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-116K06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-465B22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-100A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-111C13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-074D24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-160G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-159F06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-093P15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-063G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-324A12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-088D04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466M13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-392P01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-132M24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-448M10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-125G05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-352G22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-322D19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-394G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-396I01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-451P12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340G02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-344I20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-505F01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-388C08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-530C13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-539G08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-469B09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-355K04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-481G15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-504I24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-459E22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-384P03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-438J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-393M15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-063K11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-130P12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-323A12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-421P15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-302I14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-502F12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-378G07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381D15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-112D11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-138O11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-307I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-295K11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-328M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-504I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502P16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-337H08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-385O21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-430P03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-064M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-135A10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-405F09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-379F24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-505F01
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-297O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-180H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135D15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-325J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201F17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-324P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260I08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-254M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320A23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-334N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273A11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194P02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-057K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104P17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-349I22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-049F19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-100E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208H19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-301I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265C19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056E13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144P15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187B10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022K11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196M12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-289L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-338F12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-098K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233P10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-070K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046O19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187B10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144D05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-303K12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144P15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280O21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087J19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-152E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177C24
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-349I22.b	B6Ng01-349I22.g
ACC	GA130518	GA130519
length	1,104	1,198
definition	B6Ng01-349I22.b	B6Ng01-349I22.g
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattcactgactctgtcccccctctttttaggcttggcagtggtgcaac cctgaggacttcccggaggtgttgtacccgcgagatgcgctggtggtcga gatgcccggagacagaggcgacgggacagagtcgccccaggccgcccctg agtgcgccctggacacaaggcggcccttggagactcagaggcagaggcag gtgcaggcactgtcagaggccaggcgcctgggcctggctagggaggactg tccccgtggtgacctggcccacgtgacactcccgctgctcctgggaggtg tgacccagggagcctctgtacttgacgatctttggaggacccataagact gcggagccgggaccgcccactttggggcaagaggcctgactgttgcatct ccagcctgctccctcctcaggagcccctaaactgcaacagctggtcataa tggctgtcctattttatagatgtgattcttgaggcccagagaaggtgact gtcttgcctgatgtcacacagcgtttgcaggacgcagacccaggcctttc tcccggttctgtagcacccttctcttctcccacccactccctccagcgcc tatagccacaccgcctgtgaggggaacatggaaacctccaagaaggggaa agtgcttcatgcagctttgcttggtatcctcagggcaaggctggacccta tcactggtctgtttatttttgggggggtccttccagtctgaggggacatg gtcagtcacaggctcagtttgcctccagcgtccttggctggggtcacaga atgactctagagcgtcataaattaggttacctaaaaagcagggcctagac attcacgggaagtttatacgtctggactcagtttccctattagagtattg ggcacttaataaatgggcctttcccagagactgagaaactaaatctgggc cgtcgtgtgcacgtctgtcatcccatacccagagcagctgcagaaagatg agctttgactgcaaagcgagtccgaggtagcctgggctacatgagaccct gtctgagacagtgtgacaggtcactagatcgagaataagacctggtagta caga	gaattctcagaacagagaacatacagatcgccagagcagccagggcttct gaaatttccccagcagctcctccaggacatgcaacacagcgcagatcctt ctgaaatttccccagcagctcctccaggacatgcaacacagcgcagatcc ttctgaaatttccccagcagctcctccaggacatgcaacacagcgcagat ccttcacaacctggactatgactttctctcctatacgcgatggcttggac gctctgcctcatcatgaaagctggtctctgttcaggatctttgtacacct atttcttctgcctaaaacttactttaggccttcacattgagatgttaaat acctagctctttggtataatggaccataggggacaattaaatatatctaa acatctctaaaggataggtctttcctgtaagtaccgtattagtgcttatt tttccttaatttccagggcagtttgactccataattgctagacctgtccc tggtgtcacgctgccttactggagcactaccagactgccatctggctgaa ctacctatataaaataagctggctaaccaatgggttaccaaacaggcaag aaaatcaaaagtaagtatttctgattttatacatgctacagtaggaagtg caactttcactaccagatgcccagagcaccttcatgagacaaggggccgg aaatagcagcaaacaattcagggacaatgggttagtgttcagccaggtgc actgccagaggatttgcttggggctgcacagggaccttcagacttcccag tttttgtgcagcatatgcatgctaatgatggtggtcactgtttgtaatga atttacctggtgtcacatagacacactacaccctaaagcattgtaaagag gtagtggcatagtaactgagttatgcagcataagagttattccccaaatt ggaaaggaattggtgtcagctgtactagaagctgaacaacaattacagtg gttgttgtggtagagcatgaagccacaaaaattggacagtgtaataaagc aaggggggaataaatgttgcttacagaccacttcttgataagagtgatac gctgactgttaaaagccaatccctattctgatgatgtttgcatggaccaa tgtttgtgtttgcggcttagagccttgggagaatagagttgaggagag
quality values	Open. Hide. 58 54 20 31 58 38 31 62 62 62 47 62 62 62 62 54 62 49 62 62 62 62 62 62 62 62 49 62 62 39 36 30 29 34 43 45 38 24 28 40 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 59 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 56 56 48 59 62 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 59 62 62 62 54 62 62 62 62 59 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 54 62 62 45 54 49 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 54 58 58 58 54 58 58 58 54 54 58 58 58 58 58 58 54 58 58 58 58 54 54 58 58 49 54 54 52 58 52 42 54 54 58 58 58 58 58 58 52 58 41 52 58 58 58 54 58 58 58 52 47 58 54 54 54 52 54 58 54 58 54 58 58 52 58 50 54 49 52 54 58 58 49 58 54 51 48 41 48 48 45 43 52 52 50 48 50 48 51 58 48 50 43 51 50 51 50 49 49 49 50 58 54 58 58 51 44 39 58 58 58 58 58 42 50 58 58 58 48 49 48 41 50 53 42 39 42 47 46 58 54 37 58 58 48 58 58 58 50 52 58 51 58 51 38 50 50 58 54 38 39 52 58 58 49 50 49 50 50 58 50 39 53 52 50 44 54 52 47 29 58 58 24 43 40 46 54 44 47 50 49 29 33 33 34 50 52 51 41 49 50 50 44 46 40 45 53 54 52 54 42 53 37 54 54 54 41 54 54 54 54 54 49 42 40 39 33 46 42 32 39 30 38 33 42 52 45 54 18 54 54 52 40 24 25 40 47 36 28 42 42 37 33 40 35 52 41 29 36 40 33 32 34 32 46 49 32 52 42 34 31 33 40 26 32 45 35 21 27 41 32 20 21 46 32 32 29 49 47 46 31 37 29 35 37 30 36 31 31 32 31 31 32 32 41 31 31 36 24 30 40 31 34 31 31 26 51 25 32 34 18 6 19 33 28 32 26 31 31 31 47 47 47 31 31 31 13 10 32 17 31 29 31 31 31 32 31 25 24 27 29 32 34 30 46 25 24 27 23 36 48 36 31 30 20 37 17 31 31 29 29 32 27 26 31 31 20 27 33 47 31 30 41 27 22 31 42 19 32 19 33 32 31 32 23 28 20 6 10 17 17 25 30 30 14 21 33 31 48 26 21 31 44 31 11 27 10 36 16 37 33 19 23 31 35 12 22 21 32 29 26 18 33 41 29 22 31 18 47 22 30 18 21 9 31 12 11 11 19 32 32 24 20 4 4 7 22 23 24 21 26 27 31 23 14 22 23 32 21 11 6 7 4 16 22 17 14 12 25 8 6 11 23 13 22 16 15 20 12 8 28 47 27 28 16 18 14 20 8 27 17 28 6 10 3 9 27 26 27 20 33 28 18 18 8 7 6 13 14 26 10 7 3 3 5 9 5 13 6 9 19 28 19 5 14 20 24 20 20 10 26 6 13 7 15 9 6 11 11 16 14 13 7 9 4 5 6 6 5 10 6 8 2 5 4 6 9 11 13 5 21 4 10 3 3 3 2 6 9 8 7 6 13 9 13 6 15 7 10 12 7 12 3 8 11 18 6 8 5 6 7	Open. Hide. 46 38 51 47 62 62 62 47 47 51 56 45 51 25 30 33 27 29 33 51 62 62 62 62 59 62 59 59 62 62 62 59 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 54 54 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 58 58 45 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 49 58 58 58 58 58 54 58 58 58 54 54 52 54 54 54 58 52 58 58 58 58 54 58 54 58 58 58 58 48 54 54 58 54 54 58 52 52 52 54 54 58 58 58 54 58 58 58 58 54 58 51 58 47 58 58 54 53 58 58 58 49 41 44 49 58 58 58 58 58 58 50 47 49 58 44 43 40 58 51 58 58 58 49 48 46 37 35 39 49 46 54 47 52 58 51 54 58 50 58 58 58 49 53 53 51 58 58 58 51 51 53 58 49 51 51 51 58 54 52 58 38 48 25 58 58 51 53 53 50 49 41 51 58 54 49 40 51 52 39 39 52 47 58 58 51 50 51 58 50 49 43 50 58 54 58 42 50 41 38 49 40 28 33 50 53 37 51 39 51 44 47 45 54 39 50 35 38 41 47 50 39 32 47 53 54 34 53 39 46 51 29 49 54 49 40 44 26 49 54 54 50 41 49 39 52 45 42 53 52 52 34 33 24 37 52 54 37 37 13 49 39 27 32 30 51 33 49 54 54 30 33 34 43 37 54 28 52 34 37 34 42 51 24 42 54 24 35 35 32 34 28 40 27 32 17 32 53 32 41 20 12 53 32 33 35 53 34 53 53 52 41 29 39 35 31 23 40 32 31 53 33 22 21 33 31 32 31 35 24 42 28 18 10 18 41 29 31 33 51 51 51 51 32 34 29 42 31 31 31 36 33 38 33 31 42 31 26 33 35 35 31 27 31 31 42 33 31 41 51 18 46 31 26 30 26 32 28 30 7 46 8 31 33 42 23 21 32 22 32 38 47 32 25 26 38 24 42 46 16 38 29 31 18 27 18 30 24 14 30 31 21 32 14 31 33 33 31 21 9 46 17 25 21 46 29 16 23 26 36 33 31 31 31 48 31 21 31 24 36 33 30 17 14 31 28 17 27 36 32 23 31 26 19 31 31 27 28 18 26 25 21 25 25 29 31 30 32 28 33 21 25 24 28 24 35 32 26 21 36 21 37 22 5 10 47 35 8 14 13 34 14 44 13 14 33 11 25 14 19 21 25 20 25 14 27 24 27 23 32 32 23 24 32 21 22 15 25 28 19 31 32 27 21 25 21 11 15 19 15 11 30 25 25 29 18 21 6 22 26 12 8 24 25 9 21 15 21 33 8 25 12 20 16 5 15 21 9 16 20 26 23 11 6 4 7 34 34 34 15 15 7 14 17 6 11 7 7 7 22 15 24 15 19 11 29 21 9 14 8 6 5 13 18 21 47 14 14 5 4 8 47 22 11 13 6 15 14 28 13 10 7 28 11 9 10 6 11 8 5 13 5 5 5 13 2 1 2 3 5 5 16 5 4 12 10 12 10 17 9 22 13 6 6 6 16 5 3 3 18 28 26 23 6 7 9 20 23 7 8 12 7 4 7 5 7 13 8 10 17 4 6 8 4 7 5 7 10 1 1 3 2 2 5 21 4 5 5 16 9 9 4 19 9 6 4 10 9 4 8 8 6 4 3 3 5 3 2 3 3 3 2 4 10 13 5 3 3 3 4 4 3 6 5 9 4 6 6 6 6 5 3 6 7 5 4 4

Alignment Information

BAC End 1

BAC End 2

seq1: chr8_73344382_73345494
seq2: B6Ng01-349I22.b_43_1146

seq1  GAATTCACTGACTCTGTCCCCCCTCTTTTTAGGCTTGGCAGTGGTGCAAC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCACTGACTCTGTCCCCCCTCTTTTTAGGCTTGGCAGTGGTGCAAC  50

seq1  CCTGAGGACTTCCCGGAGGTGTTGTACCCGCGAGATGCGCTGGTGGTCGA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGAGGACTTCCCGGAGGTGTTGTACCCGCGAGATGCGCTGGTGGTCGA  100

seq1  GATGCCCGGAGACAGAGGCGACGGGACAGAGTCGCCCCAGGCCGCCCCTG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATGCCCGGAGACAGAGGCGACGGGACAGAGTCGCCCCAGGCCGCCCCTG  150

seq1  AGTGCGCCCTGGACACAAGGCGGCCCTTGGAGACTCAGAGGCAGAGGCAG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGCGCCCTGGACACAAGGCGGCCCTTGGAGACTCAGAGGCAGAGGCAG  200

seq1  GTGCAGGCACTGTCAGAGGCCAGGCGCCTGGGCCTGGCTAGGGAGGACTG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGCAGGCACTGTCAGAGGCCAGGCGCCTGGGCCTGGCTAGGGAGGACTG  250

seq1  TCCCCGTGGTGACCTGGCCCACGTGACACTCCCGCTGCTCCTGGGAGGTG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCCCGTGGTGACCTGGCCCACGTGACACTCCCGCTGCTCCTGGGAGGTG  300

seq1  TGACCCAGGGAGCCTCTGTACTTGACGATCTTTGGAGGACCCATAAGACT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGACCCAGGGAGCCTCTGTACTTGACGATCTTTGGAGGACCCATAAGACT  350

seq1  GCGGAGCCGGGACCGCCCACTTTGGGGCAAGAGGCCTGACTGTTGCATCT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCGGAGCCGGGACCGCCCACTTTGGGGCAAGAGGCCTGACTGTTGCATCT  400

seq1  CCAGCCTGCTCCCTCCTCAGGAGCCCCTAAACTGCAACAGCTGGTCATAA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGCCTGCTCCCTCCTCAGGAGCCCCTAAACTGCAACAGCTGGTCATAA  450

seq1  TGGCTGTCCTATTTTATAGATGTGATTCTTGAGGCCCAGAGAAGGTGACT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGCTGTCCTATTTTATAGATGTGATTCTTGAGGCCCAGAGAAGGTGACT  500

seq1  GTCTTGCCTGATGTCACACAGCGTTTGCAGGACGCAGACCCAGGCCTTTC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCTTGCCTGATGTCACACAGCGTTTGCAGGACGCAGACCCAGGCCTTTC  550

seq1  TCCCGGTTCTGTAGCACCCTTCTCTTCTCCCACCCACTCCCTCCAGCGCC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCCGGTTCTGTAGCACCCTTCTCTTCTCCCACCCACTCCCTCCAGCGCC  600

seq1  TATAGCCACACCGCCTGTGAGGGGAACATGGAAACCTCCAAGAAGGGGAA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATAGCCACACCGCCTGTGAGGGGAACATGGAAACCTCCAAGAAGGGGAA  650

seq1  AGTGCTTCATGCAGCTTTGCTTGGTATCCTCAGGGCAAGGCTGGACCCTA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGCTTCATGCAGCTTTGCTTGGTATCCTCAGGGCAAGGCTGGACCCTA  700

seq1  TCACTGGTCTGTTTATTTTTGGGGGGGTCCTTCCAGTCTGAGGGGACATG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCACTGGTCTGTTTATTTTTGGGGGGGTCCTTCCAGTCTGAGGGGACATG  750

seq1  GTCAGTCACAGGCTCAGTTTGCCTCCAGCGTCCTTGGCTGGGGTCACAGA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCAGTCACAGGCTCAGTTTGCCTCCAGCGTCCTTGGCTGGGGTCACAGA  800

seq1  ATGACTCTAGAGCGTCATAAATTAGGTTACCTAAAAAGCAGGGCCTAGAC  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGACTCTAGAGCGTCATAAATTAGGTTACCTAAAAAGCAGGGCCTAGAC  850

seq1  ATTCACGGGAAGTTTATACGTCTGGACTCAGTTTCCCTATTAGAGTATTG  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTCACGGGAAGTTTATACGTCTGGACTCAGTTTCCCTATTAGAGTATTG  900

seq1  GGCACTTAATAAATGGGCC-TTCCCAGAGACTGAGAAACTAAATCT-GGC  948
      ||||||||||||||||||| |||||||||||||||||||||||||| |||
seq2  GGCACTTAATAAATGGGCCTTTCCCAGAGACTGAGAAACTAAATCTGGGC  950

seq1  CGTCGTGGTGCACGTCTGTCATCCCAATACCCAGGAGGCAGCTGCAGAAA  998
      |||||| |||||||||||||||||| ||||||||   |||||||||||||
seq2  CGTCGT-GTGCACGTCTGTCATCCC-ATACCCAG--AGCAGCTGCAGAAA  996

seq1  GATGAGCTTGGACTGCAAAGCGAGTCCGAGGGTAGCCTGGGCTACATGAG  1048
      ||||||||| ||||||||||||||||||| ||||||||||||||||||||
seq2  GATGAGCTTTGACTGCAAAGCGAGTCCGA-GGTAGCCTGGGCTACATGAG  1045

seq1  ACCCTGTCTGGAGGACAGTGTGGACA-GTCACCTAGAATTCCGAG-ATAA  1096
      ||||||||||   |||||||| |||| |||| |||||    |||| ||||
seq2  ACCCTGTCTG--AGACAGTGT-GACAGGTCA-CTAGA---TCGAGAATAA  1088

seq1  GACCTGGGTAGTACAGA  1113
      ||||| |||||||||||
seq2  GACCT-GGTAGTACAGA  1104

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information