MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-106I21
Chromosome	8 (Build37)
Map Location	4,709,868 - 4,710,481
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Clec4g, Cd209a, LOC664870, Cd209e, Cd209d, Cd209b, Cd209c, LOC664888, EG384770, EG664905, LOC664915, LOC664922, LOC631071, Cd209f, Cd209g, B130050I23Rik, BC068157, Lrrc8e, Map2k7, LOC100039590, Snapc2, Ctxn1, Timm44, Elavl1, Ccl25, LOC664977, Ppia-ps8_36.1, Lass4, Vmn2r-ps89, EG633533, BC003267, LOC665021, EG623133, EG665044, EG623223
Downstream gene	LOC100040234, Shcbp1, EG622568, LOC669393, EG631359, LOC100039687, LOC436026, Slc10a2, LOC434275, LOC623409, LOC669429
Link	Open Mouse BAC browser

Click to get alignment info.

name	Clec4g (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75863 MGI:1923113
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd209a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170786 MGI:2157942
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC664870 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664870
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 24 ESTs

name	Cd209e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170780 MGI:2157948
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd209d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170779 MGI:2157947
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd209b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69165 MGI:1916415
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Cd209c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170776 MGI:2157945
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC664888 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664888
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 70 ESTs, 3 Proteins pseudo : _no_value

name	EG384770 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384770 MGI:3644319
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	EG664905 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:664905 MGI:3647493
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins

name	LOC664915 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664915
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	LOC664922 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664922
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 37 Proteins pseudo : _no_value

name	LOC631071 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:631071
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 223 ESTs, 4 Proteins

name	Cd209f (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69142 MGI:1916392
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs, 3 Proteins

name	Cd209g (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70192 MGI:1917442
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs, 4 Proteins

name	B130050I23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213027 MGI:2442167
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC068157 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73072 MGI:3605626
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lrrc8e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72267 MGI:1919517
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Map2k7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26400 MGI:1346871
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100039590 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039590
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	Snapc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102209 MGI:1914861
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ctxn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330695 MGI:88566
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Timm44 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21856 MGI:1343262
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Elavl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15568 MGI:1100851
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccl25 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20300 MGI:1099448
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC664977 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664977
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 ESTs, 7 Proteins pseudo : _no_value

name	Ppia-ps8_36.1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:606543
definition	note : peptidylprolyl isomerase A pseudogene 8_36.1 pseudo : _no_value

name	Lass4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67260 MGI:1914510
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vmn2r-ps89 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:674360
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 Proteins pseudo : _no_value

name	EG633533 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:633533 MGI:3643234
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	BC003267 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233987 MGI:2385298
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665021 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665021
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 ESTs, 60 Proteins pseudo : _no_value

name	EG623133 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:623133 MGI:3648540
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 77 ESTs, 5 Proteins

name	EG665044 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665044 MGI:3645338
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs

name	EG623223 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:623223 MGI:3643419
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	LOC100040234 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040234
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 184 ESTs, 13 Proteins pseudo : _no_value

name	Shcbp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20419 MGI:1338802
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG622568 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622568 MGI:3647382
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins

name	LOC669393 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:669393
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 4 Proteins

name	EG631359 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:631359 MGI:3648110
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 884 ESTs, 10 Proteins

name	LOC100039687 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039687
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	LOC436026 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:436026
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins pseudo : _no_value

name	Slc10a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20494 MGI:1201406
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC434275 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:434275
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 46 ESTs, 1 Protein pseudo : _no_value

name	LOC623409 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:623409
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	LOC669429 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:669429
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 359 ESTs, 10 Proteins pseudo : _no_value

name	Clec4g (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142353398 GeneID:75863 MGI:1923113
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : C-type lectin domain family 4, member g transcript_id : NM_029465.2

name	Cd209a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142371806 GeneID:170786 MGI:2157942
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD209a antigen transcript_id : NM_133238.3

name	LOC664870 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258349 GeneID:664870
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 24 ESTs product : similar to WTAP protein transcript_id : XM_001473582.1

name	Cd209e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24475796 GeneID:170780 MGI:2157948
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD209e antigen transcript_id : NM_130905.2

name	Cd209d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24475791 GeneID:170779 MGI:2157947
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD209d antigen transcript_id : NM_130904.2

name	Cd209b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802954 GeneID:69165 MGI:1916415
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD209b antigen transcript_id : NM_026972.3

name	Cd209b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83699405 GeneID:69165 MGI:1916415
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD209b antigen transcript_id : NM_001037800.1

name	Cd209c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802778 GeneID:170776 MGI:2157945
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD209c antigen transcript_id : NM_130903.3

name	EG384770 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149258331 GeneID:384770 MGI:3644319
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : predicted gene, EG384770 transcript_id : XM_357856.4

name	EG664905 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149258332 GeneID:664905 MGI:3647493
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins product : predicted gene, EG664905 transcript_id : XM_973357.2

name	LOC631071 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258353 GeneID:631071
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 223 ESTs, 4 Proteins product : similar to RIKEN cDNA 2610208M17 gene transcript_id : XM_001473773.1

name	Cd209f (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94383006 GeneID:69142 MGI:1916392
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs, 3 Proteins product : CD209f antigen, transcript variant 1 transcript_id : XM_284386.5

name	Cd209g (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149258334 GeneID:70192 MGI:1917442
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs, 4 Proteins product : CD209g antigen transcript_id : XM_284376.6

name	B130050I23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111074547 GeneID:213027 MGI:2442167
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA B130050I23 gene transcript_id : NM_001039578.2

name	BC068157 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46402166 GeneID:73072 MGI:3605626
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC068157 transcript_id : NM_207203.1

name	Lrrc8e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51890210 GeneID:72267 MGI:1919517
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine rich repeat containing 8 family, member E transcript_id : NM_028175.1

name	Map2k7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110347550 GeneID:26400 MGI:1346871
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitogen activated protein kinase kinase 7 transcript_id : NM_011944.2

name	Map2k7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110347548 GeneID:26400 MGI:1346871
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitogen activated protein kinase kinase 7 transcript_id : NM_001042557.1

name	LOC100039590 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258336 GeneID:100039590
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : similar to transforming growth factor, beta receptor III (betaglycan, 300kDa) transcript_id : XM_001473149.1

name	Snapc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527187 GeneID:102209 MGI:1914861
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small nuclear RNA activating complex, polypeptide 2 transcript_id : NM_133968.1

name	Ctxn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34304000 GeneID:330695 MGI:88566
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cortexin 1 transcript_id : NM_183315.1

name	Timm44 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19705562 GeneID:21856 MGI:1343262
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : translocase of inner mitochondrial membrane 44 transcript_id : NM_011592.1

name	Elavl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134032046 GeneID:15568 MGI:1100851
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R) transcript_id : NM_010485.3

name	Ccl25 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892127 GeneID:20300 MGI:1099448
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine (C-C motif) ligand 25 transcript_id : NM_009138.2

name	Lass4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366644 GeneID:67260 MGI:1914510
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : longevity assurance homolog 4 (S. cerevisiae) transcript_id : NM_026058.3

name	BC003267 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345833 GeneID:233987 MGI:2385298
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC003267 transcript_id : NM_145591.3

name	EG623133 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94383010 GeneID:623133 MGI:3648540
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 77 ESTs, 5 Proteins product : predicted gene, EG623133 transcript_id : XM_887570.2

name	EG665044 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94383012 GeneID:665044 MGI:3645338
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs product : predicted gene, EG665044 transcript_id : XM_974151.1

name	EG623223 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94383014 GeneID:623223 MGI:3643419
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : predicted gene, EG623223 transcript_id : XM_897595.2

name	Shcbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803091 GeneID:20419 MGI:1338802
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Shc SH2-domain binding protein 1 transcript_id : NM_011369.2

name	EG622568 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94383019 GeneID:622568 MGI:3647382
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins product : predicted gene, EG622568 transcript_id : XM_889268.2

name	LOC669393 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258339 GeneID:669393
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 4 Proteins product : similar to ribosomal protein L22 transcript_id : XM_001473319.1

name	EG631359 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149258367 GeneID:631359 MGI:3648110
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 884 ESTs, 10 Proteins product : predicted gene, EG631359 transcript_id : XM_905139.3

name	LOC100039687 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258341 GeneID:100039687
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : similar to pol protein transcript_id : XM_001473341.1

name	Slc10a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893012 GeneID:20494 MGI:1201406
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 10, member 2 transcript_id : NM_011388.2

name	Clec4g (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037435 CCDS:CCDS22072.1 GeneID:75863 MGI:1923113
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : C-type lectin domain family 4, member g protein_id : NP_083741.1

name	Cd209a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18875404 CCDS:CCDS22073.1 GeneID:170786 MGI:2157942
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005537 - mannose binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006897 - endocytosis [Evidence IEA] codon_start : 1 product : CD209a antigen protein_id : NP_573501.1

name	LOC664870 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258350 GeneID:664870
definition	codon_start : 1 product : similar to WTAP protein protein_id : XP_001473632.1

name	Cd209e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18777739 CCDS:CCDS22074.1 GeneID:170780 MGI:2157948
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006897 - endocytosis [Evidence IEA] codon_start : 1 product : Cd209e antigen protein_id : NP_570975.1

name	Cd209d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18777736 CCDS:CCDS22075.1 GeneID:170779 MGI:2157947
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005537 - mannose binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006897 - endocytosis [Evidence IEA] codon_start : 1 product : CD209d antigen protein_id : NP_570974.1

name	Cd209b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83699406 CCDS:CCDS22076.1 GeneID:69165 MGI:1916415
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0016021 - integral to membrane [Evidence TAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005537 - mannose binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0030247 - polysaccharide binding [Evidence IDA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence ISS] [Evidence IEA]; GO:0001872 - zymosan binding [Evidence IDA] GO_process : GO:0016045 - detection of bacterium [Evidence IDA]; GO:0001879 - detection of yeast [Evidence IDA]; GO:0006897 - endocytosis [Evidence IEA]; GO:0006910 - phagocytosis, recognition [Evidence IDA]; GO:0050766 - positive regulation of phagocytosis [Evidence IDA]; GO:0042535 - positive regulation of tumor necrosis factor-alpha biosynthesis [Evidence IDA] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : CD209b antigen isoform b protein_id : NP_001032889.1

name	Cd209b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83699398 CCDS:CCDS22077.1 GeneID:69165 MGI:1916415
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0016021 - integral to membrane [Evidence TAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005537 - mannose binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0030247 - polysaccharide binding [Evidence IDA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence ISS] [Evidence IEA]; GO:0001872 - zymosan binding [Evidence IDA] GO_process : GO:0016045 - detection of bacterium [Evidence IDA]; GO:0001879 - detection of yeast [Evidence IDA]; GO:0006897 - endocytosis [Evidence IEA]; GO:0006910 - phagocytosis, recognition [Evidence IDA]; GO:0050766 - positive regulation of phagocytosis [Evidence IDA]; GO:0042535 - positive regulation of tumor necrosis factor-alpha biosynthesis [Evidence IDA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : CD209b antigen isoform a protein_id : NP_081248.2

name	Cd209c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18777733 CCDS:CCDS22078.1 GeneID:170776 MGI:2157945
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005537 - mannose binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] codon_start : 1 product : CD209c antigen protein_id : NP_570973.1

name	EG384770 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38089095 GeneID:384770 MGI:3644319
definition	codon_start : 1 product : similar to Lman2l protein protein_id : XP_357856.1

name	EG664905 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149258333 GeneID:664905 MGI:3647493
definition	codon_start : 1 product : similar to SIGNR2 protein_id : XP_978451.2

name	LOC631071 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258354 GeneID:631071
definition	codon_start : 1 product : similar to RIKEN cDNA 2610208M17 gene protein_id : XP_001473823.1

name	Cd209f (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82916367 GeneID:69142 MGI:1916392
definition	codon_start : 1 product : CD209f antigen isoform 1 protein_id : XP_284386.3

name	Cd209g (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149258335 GeneID:70192 MGI:1917442
definition	codon_start : 1 product : CD209g antigen protein_id : XP_284376.6

name	B130050I23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111074548 GeneID:213027 MGI:2442167
definition	codon_start : 1 note : ecotropic viral integration site 5-like product : hypothetical protein LOC213027 protein_id : NP_001034667.2

name	BC068157 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46402167 GeneID:73072 MGI:3605626
definition	codon_start : 1 product : hypothetical protein LOC73072 protein_id : NP_997086.1

name	Lrrc8e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51890211 CCDS:CCDS22079.1 GeneID:72267 MGI:1919517
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : leucine rich repeat containing 8 family, member E protein_id : NP_082451.1

name	Map2k7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110347549 GeneID:26400 MGI:1346871
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; protein kinase, mitogen activated, kinase 7; MAP kinase kinase 7 product : mitogen activated protein kinase kinase 7 isoform 1 protein_id : NP_001036022.1

name	Map2k7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110347551 GeneID:26400 MGI:1346871
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 function : activates JNK group of MAP kinases note : isoform 2 is encoded by transcript variant 2; protein kinase, mitogen activated, kinase 7; MAP kinase kinase 7 product : mitogen activated protein kinase kinase 7 isoform 2 protein_id : NP_036074.2

name	LOC100039590 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258337 GeneID:100039590
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473199.1

name	Snapc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527188 CCDS:CCDS22081.1 GeneID:102209 MGI:1914861
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : small nuclear RNA activating complex, polypeptide 2 protein_id : NP_598729.1

name	Ctxn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34304001 GeneID:330695 MGI:88566
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : cortexin product : cortexin 1 protein_id : NP_899138.1

name	Timm44 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19705563 CCDS:CCDS22083.1 GeneID:21856 MGI:1343262
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005744 - mitochondrial inner membrane presequence translocase complex [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0015450 - protein translocase activity [Evidence IEA] GO_process : GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0006605 - protein targeting [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : translocator of inner mitochondrial membrane 44 protein_id : NP_035722.1

name	Elavl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542602 CCDS:CCDS22084.1 GeneID:15568 MGI:1100851
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0048255 - mRNA stabilization [Evidence IMP] codon_start : 1 note : HU-antigen A product : ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R) protein_id : NP_034615.2

name	Ccl25 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677881 CCDS:CCDS22085.1 GeneID:20300 MGI:1099448
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0008009 - chemokine activity [Evidence IDA]; GO:0005125 - cytokine activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006935 - chemotaxis [Evidence IDA]; GO:0006955 - immune response [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IEA]; GO:0050900 - leukocyte migration [Evidence IDA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : small inducible cytokine A25; small inducible chemokine 25 product : chemokine (C-C motif) ligand 25 protein_id : NP_033164.1

name	Lass4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31541930 CCDS:CCDS22086.1 GeneID:67260 MGI:1914510
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA] GO_process : GO:0046513 - ceramide biosynthesis [Evidence IDA]; GO:0008610 - lipid biosynthesis [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : longevity assurance homolog 4 protein_id : NP_080334.2

name	BC003267 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704192 GeneID:233987 MGI:2385298
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : hypothetical protein LOC233987 protein_id : NP_663566.1

name	EG623133 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94383011 GeneID:623133 MGI:3648540
definition	codon_start : 1 product : hypothetical protein protein_id : XP_892663.2

name	EG665044 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94383013 GeneID:665044 MGI:3645338
definition	codon_start : 1 product : hypothetical protein protein_id : XP_979245.1

name	EG623223 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82916419 GeneID:623223 MGI:3643419
definition	codon_start : 1 product : hypothetical protein protein_id : XP_902688.1

name	Shcbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755508 CCDS:CCDS22088.1 GeneID:20419 MGI:1338802
definition	GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0042169 - SH2 domain binding [Evidence IDA] codon_start : 1 product : Shc SH2-domain binding protein 1 protein_id : NP_035499.1

name	EG622568 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149258366 GeneID:622568 MGI:3647382
definition	codon_start : 1 product : similar to protein kinase inhibitor gamma protein_id : XP_894361.2

name	LOC669393 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258340 GeneID:669393
definition	codon_start : 1 product : similar to ribosomal protein L22 protein_id : XP_001473369.1

name	EG631359 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82916218 GeneID:631359 MGI:3648110
definition	codon_start : 1 product : hypothetical protein protein_id : XP_910232.1

name	LOC100039687 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258342 GeneID:100039687
definition	codon_start : 1 product : similar to pol protein protein_id : XP_001473391.1

name	Slc10a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755530 CCDS:CCDS22089.1 GeneID:20494 MGI:1201406
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA] GO_function : GO:0005386 - carrier activity [Evidence IEA]; GO:0031402 - sodium ion binding [Evidence IEA]; GO:0015293 - symporter activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : solute carrier family 10, member 2 protein_id : NP_035518.1

name	LOC664915 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664915
definition	number : 1 pseudo : _no_value

name	Vmn2r-ps89 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674360
definition	number : 3 pseudo : _no_value

name	Vmn2r-ps89 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674360
definition	number : 2 pseudo : _no_value

name	Vmn2r-ps89 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674360
definition	number : 1 pseudo : _no_value

name	EG633533 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:633533
definition	number : 1 pseudo : _no_value

name	EG633533 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:633533
definition	number : 2 pseudo : _no_value

name	EG633533 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:633533
definition	number : 3 pseudo : _no_value

name	LOC436026 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:436026
definition	number : 1 pseudo : _no_value

name	LOC623409 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:623409
definition	number : 1 pseudo : _no_value

name	LOC664888 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149258351 GeneID:664888
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 70 ESTs, 3 Proteins product : similar to exportin, tRNA (nuclear export receptor for tRNAs) pseudo : _no_value transcript_id : XR_031349.1

name	LOC664922 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149258352 GeneID:664922
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 37 Proteins product : similar to rac gtpase pseudo : _no_value transcript_id : XR_031369.1

name	LOC664977 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149258338 GeneID:664977
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 ESTs, 7 Proteins product : similar to ribosomal protein L32 pseudo : _no_value transcript_id : XR_031087.1

name	LOC665021 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149258362 GeneID:665021
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 ESTs, 60 Proteins product : similar to putative serine/threonine kinase NDR54 pseudo : _no_value transcript_id : XR_031561.1

name	LOC100040234 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149258365 GeneID:100040234
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 184 ESTs, 13 Proteins product : similar to high-mobility group box 1 pseudo : _no_value transcript_id : XR_031593.1

name	LOC434275 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149258368 GeneID:434275
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 46 ESTs, 1 Protein product : similar to 1700023B02Rik protein pseudo : _no_value transcript_id : XR_031660.1

name	LOC669429 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149258343 GeneID:669429
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 359 ESTs, 10 Proteins product : similar to neuroleukin pseudo : _no_value transcript_id : XR_031193.1

clone name	MSMg01-533D22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-389C19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-418I02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-411H14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-321I18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-196I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-170N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-320O01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-498B19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-371G19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-506H02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-307D21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-270E24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-443D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-461E16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-278P12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-100E12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-158F12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-532L11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-426C20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-426C21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-155O10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-480D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-151A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-079G15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-076K22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423K08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-338B23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-093L07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-315P19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-360H04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-493A23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-414E03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-508N12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-177K05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-424G06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-106I21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-139L13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-269N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-509H04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-186N02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-266A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-091M18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-522N04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-379M10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-540P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-130I05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-086K21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-433O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-337B11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-384B02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-324N14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157M18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-145D07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-324E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-541E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-486O23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-404A23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-304E20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-261P21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-482C24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-508J09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-166A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-132C13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-365M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-181C20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-374A18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-184C23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-498P23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-419H02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-133A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-057M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-337L01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-541F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036G04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209C08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187H16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-028B04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-128O11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-185A11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-098O15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350I11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238C19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-012G16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-291D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261I15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-338K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077N19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036P20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-212H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338C04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-012J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017O06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-029I16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-170D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305N12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003A09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203O12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-347H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-276O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237A14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302F02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348O02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-235G06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222F21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-156J19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-248B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335O23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-167L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170J08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-059F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031M04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241E14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291C17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-219B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217O19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323O22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304D12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-024O02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-111N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159K01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-145E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-104C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116I09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-346L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-303F12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-312G03
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-106I21.T7 (MSMg01no106_i21.b1)	MSMg01-106I21.TJ (MSMg01no106_i21.g1)
ACC	AG320609	AG320610
length	713	1,754
length of high quality (start - end)	339 (83 - 421)	617 (103 - 719)
definition	CHROMAT_FILE: MSMg01no106_i21.b1 PHD_FILE: MSMg01no106_i21.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 18:07:10 2005	CHROMAT_FILE: MSMg01no106_i21.g1 PHD_FILE: MSMg01no106_i21.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 18:07:10 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	plural
sequence	AAGACGAGGGAACTCXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXTCCAA GAGGATCCGCGGAATTCTCACCTGTCCCAAACCAAAAGGCTGAGAAACAC CTGAAAAAATGTTCAACATCCTAAATCATCAGAGAAATGCAAATCAAAAC AACCCTGAGATTCCATCTCACACCAGTCAGAATGGCTAAGATCAAAAATT CAGGTGACAGCAGATGCTGGCGAGAATGTGGAGAAAGAGGAACACTCCTC CATTGTTGGTGGGATTGCAAGCTTGTACAACCACTCTGGAAATCAGTCTG GCAGTTCCTCAGAAAATTGGACATAGTACTACTGGAGGATCCCGCAATTA CCTCTCCTGGGCATATATCCAGAATATATCCCAACCGGTAAGAAGGACAC ATGCTCCACTATGTTCATAGGAGCCTTATTTATAATAGCCAGAAGCTGGA AAGAATTCAGTTGTCTCTCATCAGAGGAATGGATACAACAAATGTGCTAC ATTTACTCAATGGAGCACTACTCACCTATTAACATGAATGACTCCCTCCA TTTTCCTATGTCAACGATTGGAATTGGAGGTCATCTTCCCGCAGTGAGTA ACCCATATCTTCTATATCTCCCCCGACCTGCCCTCCTCGATACGTGCACA TTACCCCCTAAACTTAGTTTAGCCCGATTTACTCGGTTCATTACGTCCAC CTATCTCCCCGTA	TCCCCCCCTTTTTTGAAGAGCXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXTCTCTGTAGACCAGACTTCCCTGTAAGC ACAGAGATCCTCTTGCCTCTGCCTCCCAAGTGCTGGAACCCAAGGCATGA GCCACTAACACCTGGACACACCTCAACTCTATTCCACCTCCTTAGAAACT CTCACACTTCATGCATATACTTTTTGGACTACAATATATTCTTAGTAATT AGCCTTTTCCTCCTAAGCAACATCATTCTTCATAATTTTTTTTCTTCTGA GTTCTACTTGATCCAACGTGTACAGTGACTTCAGAATACTACTGGTTAAG GTATGCACCATAAATATTCTTGTAGACAGTTCAAAGTTTAATATTGCTTT TTTTAACCAGTTGAATACTCACTATCTTTTAATTTGTATGTTTAAGCCAT TCATGTTGAATGTATTTTTTATGTGTTTAATATTAAAATCTGTGGCAGGT CAAAGAAGGGACAGACTGACACTGGCCTCACCTCTGTACTATAGATCTGT GAGGAAGCAGTTCAACTCTTAAACAGGAGCCCCAAGCAGCTTGTCATTCA TTCTCATCACCATGAACTCCTCATACCTGATTCTATCTTTATAATATCAA AACATCACCTTTTAGTTTTACACAGAGCCTTGTGTACAATAACTGTTCAA TGTAGACCATGTCACCTGTACTTTTGGAATAGGATGAACCATACTTATAC ATATTAGGCTGCATTTAAATCTCAAAAACATTAATTTTATATGGCTCTGC CTAACACTAAACTACTAAAAAATATTATAAATTCCCTTCTTGAAAGACTT CCAGGCTAAGAGTCAAGAATACTGAATTTGAAATGAAAAATTTGGTACTT AAGATGGAAAGTTAAAAATCAAATTTTCATTATCAGTTTATTTTTCCAAA AAAAATTTTTTTGGCAACATTTATGGTCCGGCAAATTTATGCCAATTTGA CACAACTGGGATCTTCTCAGAGGAAAAAACCACAATTAACCACCGACCGT AAAAAGGAACCATAAGCTAGCCTTTAAAAAATTTTCTTCTCACCCTTTGA TATGGAAAGGCCCAAACATTGGGGATAGGGGCCCTCCCGTGGGTGGGGTT CCTTTTGTTCTAAAAAAACCGTTCTAATGTCCCCATGAATAAAGTTATAG TTGACCCCCCTAATACAATTTTAGACCGGTTTGATGTTTCCTCTCTCTAA TAAAATATAATTGGGGAAACTTCAAGTCGGTTGGAAAAATAATCTTCAAA TTCCTTTTTCTGATTGTTTGTTCGCGCTAAAATAATAAAATAACAGTACA CGTCTTACTTTATTTTTATAANAATCTAAATTCGATCCCCCCTCTCCAAN TATTGGTGTCTATTCTTCTTCTACTTTAGAAAATAAATATATATCTCCTC CTCCTCTCTAATTATTATTCATTCATGTATCTTTTCTATATATTTTTCAT TCCTANTCCTCTTCACATTTCTCTTCTCTTTTCATCTATCTTATCTTCAT CTATCATTCTACCAATCTCNATTATCTCTCTCTAACTTTTATACTCCTTT AACTCTTATATATTTAATTCTCTAATCTCTTACTTCTTTCCTCTTTCTTC TTTCTTTATTTTACTCTCGAGCATATTAATATAACTTTTNTTGTCTCATT CAACTATTCTCATACTTCCTCTTCATTTACNTTTCTGTTTAACTCTATCT TCCA
quality values	Open. Hide. 6 6 6 6 6 6 6 6 6 6 10 9 9 9 10 9 8 8 8 10 11 22 28 29 27 25 22 15 21 12 3 0 3 15 23 28 41 28 28 25 20 19 15 9 9 10 12 10 10 12 18 18 21 18 17 17 13 17 28 30 39 36 36 36 48 41 33 33 33 30 23 21 12 11 11 8 11 8 8 8 8 17 15 21 24 26 43 43 37 47 39 39 39 40 43 43 57 57 47 47 47 47 47 43 43 48 57 48 40 40 40 40 41 42 50 50 48 50 48 48 57 57 57 57 50 50 42 48 19 16 9 12 9 12 10 12 19 19 27 32 43 57 48 42 42 37 37 39 57 57 57 57 57 57 57 59 59 41 42 41 50 50 50 57 57 57 57 57 57 57 57 57 57 57 57 57 57 52 52 37 37 50 50 47 37 43 43 43 24 36 22 36 32 50 43 52 52 52 52 50 50 52 43 43 42 37 52 52 57 57 43 39 39 42 57 57 57 43 33 29 29 33 43 43 52 43 43 43 52 52 52 52 52 52 52 52 52 52 52 50 50 47 47 47 50 57 57 59 57 57 57 57 50 57 43 46 46 50 37 37 37 37 37 37 42 42 47 57 57 57 57 57 46 57 43 43 43 57 57 48 48 48 48 47 57 47 40 36 28 25 25 37 32 42 35 35 35 39 34 30 17 17 17 34 34 54 47 47 40 37 30 30 28 32 28 36 39 39 39 42 42 39 39 39 30 35 35 29 28 26 18 15 14 13 13 15 18 28 31 36 41 40 39 37 27 25 22 20 20 19 23 23 43 46 46 47 37 34 28 23 23 23 23 34 41 32 39 28 28 20 28 21 14 14 12 12 16 19 35 34 30 30 28 28 28 28 24 14 15 15 24 23 30 32 32 43 42 36 30 25 25 30 32 32 23 28 20 19 19 27 29 39 39 31 29 22 20 19 19 15 16 18 18 15 24 18 20 20 20 28 19 19 14 10 10 10 8 12 10 19 19 20 20 20 23 32 34 30 28 23 23 19 21 15 12 11 11 9 12 9 11 10 16 23 28 30 24 19 17 17 18 18 18 13 13 13 14 15 17 17 22 18 18 15 15 8 8 8 8 8 8 12 21 18 18 12 10 10 12 12 13 12 19 13 13 12 12 12 12 21 24 23 17 14 14 14 21 26 32 19 15 15 10 10 10 11 11 9 9 12 9 9 9 11 11 11 11 16 21 15 12 11 10 10 11 12 13 10 10 10 10 10 11 10 10 10 13 12 10 9 9 9 9 9 10 15 18 12 12 12 11 11 12 12 16 12 13 18 11 11 9 9 9 9 16 13 11 11 11 8 8 6 6 8 6 8 8 8 9 9 10 11 11 8 8 8 8 8 8 10 9 9 9 8 10 8 8 8 10 15 12 9 9 9 8 8 8 8 8 10 12 15 13 12 12 14 15 10 8 10 8 8 8 8 8 8 8 8 8 8 12 15 17 19 18 15 19 15 10 10 10 8 6 6 10 8 8 8 8 8 8 11 11 14 13 14 14 17 17 10 9 11 16 10 13 8 8 6 6 8 6 8 8 8 8 10 8 8 8 8 8 8 9 10 10 12 10 11 10 10 10 10 10	Open. Hide. 8 8 8 8 8 8 7 6 13 11 12 10 15 10 7 7 6 6 8 8 8 6 6 6 6 6 6 8 8 8 9 7 8 6 8 6 3 0 3 8 8 8 9 6 8 6 6 8 8 10 9 8 13 17 17 22 24 24 26 30 29 35 35 35 30 28 28 35 42 37 33 36 36 33 33 12 12 8 13 15 28 28 28 28 28 29 21 15 8 9 7 8 9 8 8 8 8 9 9 11 11 18 18 27 33 28 28 31 31 35 35 35 35 35 35 35 42 37 37 37 37 35 35 36 36 36 53 35 31 31 31 29 28 25 21 12 10 10 10 10 10 11 18 20 34 34 37 37 41 37 47 47 38 36 36 36 36 37 50 50 40 42 40 36 36 40 48 50 59 68 68 48 48 42 39 33 32 36 36 42 47 51 68 68 68 50 50 50 51 50 50 50 50 47 57 57 57 57 68 68 68 68 68 68 51 51 51 50 50 50 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 57 68 68 68 68 68 68 68 51 51 51 51 50 50 50 50 50 51 57 68 68 68 68 68 68 68 57 57 57 57 57 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 68 68 68 57 57 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 62 62 62 62 62 62 68 68 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 68 68 68 68 62 62 62 62 62 52 52 62 62 62 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 57 57 57 59 59 57 57 57 59 59 59 59 59 59 59 59 59 59 59 59 59 59 68 68 57 57 57 57 57 57 57 57 57 57 68 68 68 68 68 68 59 59 57 54 54 54 54 57 59 59 59 59 59 59 59 59 59 59 59 57 50 42 37 24 30 19 18 19 13 13 13 15 15 24 32 37 43 43 43 43 43 38 38 47 47 47 48 48 42 42 28 35 39 43 39 47 48 57 57 57 57 57 57 57 57 59 59 44 44 42 30 30 44 44 59 59 57 54 48 47 41 42 41 41 41 48 43 43 43 43 48 48 48 48 57 57 43 43 48 48 48 48 59 57 57 43 43 37 37 28 33 37 39 39 48 48 48 48 48 46 40 37 37 37 37 32 34 34 38 41 59 59 59 59 59 48 48 48 48 48 48 48 48 48 48 48 57 48 57 48 50 50 48 48 48 43 39 35 35 28 36 22 28 24 28 28 34 31 33 33 32 30 31 31 41 43 59 47 47 34 34 23 28 23 34 30 30 15 19 19 32 26 36 34 33 39 39 39 37 46 46 39 39 39 37 31 30 15 9 11 11 8 8 8 15 19 32 29 25 32 29 29 30 32 20 20 18 18 26 16 15 10 9 9 11 15 25 25 35 35 39 39 39 38 34 37 27 27 15 15 12 15 16 8 10 8 8 8 11 13 18 22 22 22 21 21 19 25 20 15 18 18 18 20 33 34 32 23 23 16 14 14 16 15 21 10 11 11 17 23 30 28 28 27 26 20 13 8 8 8 8 11 14 22 19 25 25 30 25 25 24 19 16 15 16 15 18 19 19 19 15 17 15 14 16 11 21 16 14 11 12 12 10 13 8 9 10 15 21 19 19 22 22 22 22 22 22 22 30 30 28 28 18 12 16 19 17 16 12 17 13 8 8 8 8 8 8 8 8 8 8 15 13 14 14 23 15 19 13 14 14 12 10 14 20 19 15 10 10 9 9 9 9 11 14 11 15 10 8 8 9 10 12 16 11 12 13 21 16 22 18 20 24 27 24 22 27 32 26 19 18 14 9 9 9 8 8 10 8 8 8 8 8 8 12 12 9 9 9 11 19 14 19 18 22 21 21 9 9 9 14 11 13 28 28 20 18 22 18 20 12 10 8 8 8 8 16 12 15 15 14 10 8 8 8 8 8 13 14 21 21 32 9 9 9 9 14 22 37 22 15 9 8 8 8 9 9 9 12 12 10 6 8 8 10 10 10 9 8 8 8 13 10 8 8 9 14 10 11 11 13 11 11 17 18 14 8 8 8 8 8 8 8 9 8 8 8 8 8 9 10 10 6 6 8 8 10 8 8 8 6 6 6 9 9 14 28 26 12 15 6 6 6 8 8 8 10 10 6 8 8 8 8 8 9 9 7 9 9 9 9 14 10 9 8 8 8 10 10 8 6 6 6 6 8 8 8 8 8 8 8 16 16 21 14 14 17 21 21 14 14 10 11 9 9 10 8 10 8 8 8 8 11 15 16 10 10 8 8 8 10 8 10 14 14 10 15 9 9 10 8 19 11 12 11 18 12 8 8 8 8 8 8 8 10 8 8 10 8 16 16 8 8 8 10 14 11 11 9 9 11 9 9 9 15 13 17 14 14 13 13 13 14 10 12 10 8 8 6 6 8 8 12 13 16 15 18 12 8 8 8 8 8 8 9 9 9 8 8 6 6 8 8 8 8 8 8 8 11 12 12 12 12 8 8 6 6 8 8 12 11 8 8 8 8 9 11 13 9 10 8 8 8 6 6 8 8 8 11 11 10 10 10 10 11 10 8 8 6 6 8 8 8 8 8 8 11 15 11 11 11 12 8 8 7 7 8 8 9 9 12 12 15 13 8 10 10 7 7 8 8 12 12 12 11 11 11 10 10 8 8 8 6 6 8 8 8 8 8 8 8 8 8 8 12 15 21 12 8 8 8 10 10 8 10 10 10 10 10 8 8 8 8 6 7 12 7 14 10 10 10 11 8 8 6 9 10 15 6 6 6 8 8 9 9 8 8 10 8 8 9 11 10 8 6 6 6 6 8 6 6 6 8 8 8 8 8 6 6 8 6 6 8 12 7 7 10 8 8 9 9 9 9 13 25 23 12 9 8 8 3 0 3 11 10 8 7 8 7 6 6 8 6 6 8 8 8 8 8 9 9 8 8 8 8 8 8 8 3 0 3 8 8 8 8 8 8 8 8 6 6 12 12 12 9 9 8 8 8 8 10 8 8 8 8 11 8 8 8 8 10 10 16 15 15 9 8 8 8 13 10 8 8 9 9 9 10 10 10 8 8 8 8 8 6 6 10 8 9 9 10 11 14 10 10 9 8 8 6 6 6 6 10 10 8 8 8 8 8 8 8 8 10 12 8 8 8 8 8 8 9 10 8 9 9 8 6 8 6 6 8 8 8 8 3 0 3 8 8 10 10 13 10 8 6 6 6 6 7 6 6 8 8 8 10 10 8 8 8 8 8 8 7 6 8 6 8 9 8 8 8 10 10 8 8 8 8 8 6 8 8 8 8 8 10 9 9 10 10 9 9 9 11 12 10 10 10 10 3 0 3 8 10 10 8 8 8 9 10 13 8 8 8 8 8 8 11 10 8 8 8 8 6 6 6 6 8 10 10 8 8 6 6 8 13 13 8 8 8 6 6 6 6 8 8 8 8 8 8 13 10 9 8 8 6 6 6 6 10 15 10 8 9 8 7 6 7 8 8 10 8 9 9 13 11 8 6 6 7 7 9 10 9 9 7 8 8 9 9 8 7 6 9 7 8 8 8 7 6 6 6 6 6 6 6 8 8 8 8 6 6 6 8 8 8 8 9 9 3 0 3 15 8 8 11 10 6 6 8 8 17 8 8 6 7 8 8 10 10 8 6 6 8 8 10 10 8 8 8 8 8 8 8 6 6 8 8 9 9 3 0 3 11 11 11 9 9 9 8 8 8 8 8 8 8 8 8 8 8 8 8 9 8 8

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no106_i21.g1 MSMg01no106_i21.g1 CHROMAT_FILE:
MSMg01no106_i21.g1 PHD_FILE: MSMg01no106_i21.g1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 18:07:10 2005
         (617 letters)



>mm_chr8_4709668_4710684
          Length = 1017

 Score =  919 bits (475), Expect = 0.0
 Identities = 583/619 (94%), Gaps = 7/619 (1%)
 Strand = Plus / Plus

                                                                       
Query: 1   agagatcctcttgcctctgcctcccaagtgctggaacccaaggcatgagccactaacacc 60
           ||||||||||||||||||| |||| |||||||||||   |||||||||||||||||||||
Sbjct: 201 agagatcctcttgcctctgtctcctaagtgctggaattaaaggcatgagccactaacacc 260

                                                                       
Query: 61  tggacacacctcaactctattccacctccttagaaactctcacacttcatgcatatactt 120
           ||||||||| |  || |||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 261 tggacacacttgtacactattccacctccttagaaactctcacactccatgcatatactt 320

                                                                       
Query: 121 tttggacta-caatatattcttagtaattagccttttcctcctaagcaacatcattcttc 179
           ||||||| | | ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 321 tttggac-agctatatattcttagtaattagccttttcctcctaagcaacatcattcttc 379

                                                                       
Query: 180 ataattttttttcttctgagttctacttgatccaacgtgtacagtgacttcagaatacta 239
           ||| |||||||||||||||||||||||||||||||| |||  ||||||||||||||||||
Sbjct: 380 atatttttttttcttctgagttctacttgatccaacatgtttagtgacttcagaatacta 439

                                                                       
Query: 240 ctggttaaggtatgcaccataaatattcttgtagacagttcaaagtttaatattgctttt 299
           |||||||||||||| |||||||||||||||||||||||| |||||||||||||||| |||
Sbjct: 440 ctggttaaggtatgtaccataaatattcttgtagacagtacaaagtttaatattgc-ttt 498

                                                                       
Query: 300 tttaaccagttgaatactcactatcttttaatttgtatgtttaagccattcatgttgaat 359
           || |||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||
Sbjct: 499 ttaaaccagttgaatactcactatcttttaattggtatgtttaagccattcatgttggat 558

                                                                       
Query: 360 gtattttttatgtgtttaatattaaaatctgtggcaggtc-aaagaagggacagactgac 418
           |||||||||||||||||||||||||||||||||||||| | ||||| |||||||||||||
Sbjct: 559 gtattttttatgtgtttaatattaaaatctgtggcagg-ctaaagacgggacagactgac 617

                                                                       
Query: 419 actggcctcacctctgtactatagatctgtgaggaagcagttcaactcttaaacaggagc 478
           |||||||| ||||||||||| | |||||||||||||||||||||||||| ||||||||| 
Sbjct: 618 actggccttacctctgtactgtggatctgtgaggaagcagttcaactctcaaacaggaga 677

                                                                       
Query: 479 cccaagcagcttgtcattcattctcatcaccatgaactcctcatacctgattctatcttt 538
           ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 678 cccaagcagcttgacattcattctcatcaccatgaactcctcatacctgattctatcttt 737

                                                                       
Query: 539 ataatatcaaaacatcaccttttagttttacacagagccttgtgtacaataactgttcaa 598
           ||||||||||||||||| |||| ||||||||||||||||| |||||||||||||||||||
Sbjct: 738 ataatatcaaaacatcatcttt-agttttacacagagcct-gtgtacaataactgttcaa 795

                              
Query: 599 tgtagaccatgtcacctgt 617
           |||| ||||||||||||||
Sbjct: 796 tgtacaccatgtcacctgt 814


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 23
Number of extensions: 3
Number of successful extensions: 3
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 617
Length of database: 1017
Length adjustment: 10
Effective length of query: 607
Effective length of database: 1007
Effective search space:   611249
Effective search space used:   611249
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information