MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-406A14
Chromosome	8 (Build37)
Map Location	71,970,728 - 71,971,218
singlet/doublet	singlet
Overlap gene	LOC670593
Upstream gene	4732435N03Rik, Ints10, Lpl, LOC100041138, Slc18a1, Atp6v1b2, Lzts1, EG665540, D10627, LOC665553, D130040H23Rik, LOC665561
Downstream gene	EG665578, LOC622336, LOC100041482, LOC673968, AI449175, EG636741, 1200003I07Rik, D330038O06Rik, Atp13a1, Gmip, Edg4, Pbx4, Cilp2, BC028663, Ndufa13, Tssk6, Gatad2a, LOC665649, 9130404D08Rik, Sf4, Tm6sf2, Hapln4, Ncan, Rfxank, 2310073E15Rik, 2310045N01Rik, Mef2b, Tmem161a, Slc25a42, Armc6, Sfrs14, Homer3, Ddx49, Cope, Lass1, Upf1, Comp, Crtc1
Link	Open Mouse BAC browser

Click to get alignment info.

name	4732435N03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234356 MGI:2442354
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ints10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70885 MGI:1918135
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lpl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16956 MGI:96820
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041138 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041138
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Slc18a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110877 MGI:106684
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atp6v1b2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11966 MGI:109618
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lzts1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:211134 MGI:2684762
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG665540 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665540 MGI:3643381
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	D10627 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234358 MGI:2675306
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665553 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665553
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 42 ESTs

name	D130040H23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:211135 MGI:2444324
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665561 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665561
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 8 Proteins pseudo : _no_value

name	LOC670593 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:670593
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein

name	EG665578 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665578 MGI:3649141
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 1 Protein

name	LOC622336 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622336
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	LOC100041482 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041482
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 ESTs, 4 Proteins pseudo : _no_value

name	LOC673968 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:673968
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 159 ESTs

name	AI449175 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234362 MGI:2142546
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	EG636741 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:636741 MGI:3646490
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	1200003I07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66869 MGI:1914119
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	D330038O06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330788 MGI:3584369
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atp13a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170759 MGI:2180801
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gmip (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78816 MGI:1926066
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Edg4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53978 MGI:1858422
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pbx4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80720 MGI:1931321
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cilp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68709 MGI:1915959
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC028663 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234365 MGI:2681845
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 4 Proteins

name	Ndufa13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67184 MGI:1914434
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tssk6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83984 MGI:2148775
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gatad2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234366 MGI:2384585
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665649 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665649
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 110 ESTs, 9 Proteins pseudo : _no_value

name	9130404D08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74549 MGI:1921799
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sf4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70616 MGI:1917866
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tm6sf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107770 MGI:1933210
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hapln4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330790 MGI:2679531
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ncan (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13004 MGI:104694
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rfxank (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19727 MGI:1333865
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	2310073E15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75692 MGI:1922942
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	2310045N01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72368 MGI:1919618
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 ESTs

name	Mef2b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17259 MGI:104526
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Tmem161a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234371 MGI:2384577
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc25a42 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73095 MGI:1920345
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Armc6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76813 MGI:1924063
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sfrs14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234373 MGI:2678085
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Homer3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26558 MGI:1347359
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ddx49 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234374 MGI:2136689
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cope (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59042 MGI:1891702
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lass1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93898 MGI:2136690
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Upf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19704 MGI:107995
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Comp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12845 MGI:88469
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Crtc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382056 MGI:2142523
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4732435N03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58332429 GeneID:234356 MGI:2442354
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4732435N03 gene transcript_id : NM_172753.3

name	Ints10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354624 GeneID:70885 MGI:1918135
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : integrator complex subunit 10 transcript_id : NM_027590.2

name	Lpl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126723005 GeneID:16956 MGI:96820
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lipoprotein lipase transcript_id : NM_008509.2

name	Slc18a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:79750941 GeneID:110877 MGI:106684
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 18 (vesicular monoamine), member 1 transcript_id : NM_153054.2

name	Atp6v1b2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19705577 GeneID:11966 MGI:109618
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase, H+ transporting, lysosomal V1 subunit B2 transcript_id : NM_007509.2

name	Lzts1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40786423 GeneID:211134 MGI:2684762
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine zipper, putative tumor suppressor 1 transcript_id : NM_199364.1

name	EG665540 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94383610 GeneID:665540 MGI:3643381
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG665540 transcript_id : XM_977642.1

name	D10627 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110681697 GeneID:234358 MGI:2675306
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence D10627 transcript_id : NM_001013379.2

name	LOC665553 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258877 GeneID:665553
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 42 ESTs product : similar to membrane-associated ring finger (C3HC4) 5 transcript_id : XM_001476311.1

name	D130040H23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110665706 GeneID:211135 MGI:2444324
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA D130040H23 gene transcript_id : NM_172491.2

name	LOC670593 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258865 GeneID:670593
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein product : similar to ankyrin repeat domain 26 transcript_id : XM_001475988.1

name	EG665578 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149258867 GeneID:665578 MGI:3649141
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 1 Protein product : predicted gene, EG665578 transcript_id : XM_977914.2

name	LOC673968 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258869 GeneID:673968
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 159 ESTs product : hypothetical LOC673968 transcript_id : XM_001476042.1

name	AI449175 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113930739 GeneID:234362 MGI:2142546
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AI449175 transcript_id : NM_172754.2

name	AI449175 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113930742 GeneID:234362 MGI:2142546
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AI449175 transcript_id : NM_001045553.1

name	EG636741 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149258873 GeneID:636741 MGI:3646490
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG636741 transcript_id : XM_912234.3

name	1200003I07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:90577168 GeneID:66869 MGI:1914119
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1200003I07 gene transcript_id : NM_001039965.1

name	1200003I07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:90577170 GeneID:66869 MGI:1914119
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1200003I07 gene transcript_id : NM_001039967.1

name	1200003I07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:90577172 GeneID:66869 MGI:1914119
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1200003I07 gene transcript_id : NM_181274.3

name	D330038O06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801937 GeneID:330788 MGI:3584369
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA D330038O06 gene transcript_id : NM_177899.3

name	Atp13a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:18875381 GeneID:170759 MGI:2180801
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase type 13A1 transcript_id : NM_133224.1

name	Gmip (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37674213 GeneID:78816 MGI:1926066
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Gem-interacting protein transcript_id : NM_198101.1

name	Edg4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:103472009 GeneID:53978 MGI:1858422
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor 4 transcript_id : NM_020028.3

name	Pbx4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:68299790 GeneID:80720 MGI:1931321
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pre-B-cell leukemia transcription factor 4 transcript_id : NM_001024954.1

name	Cilp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110350655 GeneID:68709 MGI:1915959
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cartilage intermediate layer protein 2 transcript_id : NM_026818.1

name	BC028663 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94383626 GeneID:234365 MGI:2681845
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 4 Proteins product : cDNA sequence BC028663 transcript_id : XM_978251.1

name	Ndufa13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:55742659 GeneID:67184 MGI:1914434
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 13 transcript_id : NM_023312.2

name	Tssk6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:14030780 GeneID:83984 MGI:2148775
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : testis-specific serine kinase 6 transcript_id : NM_032004.1

name	Gatad2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30795221 GeneID:234366 MGI:2384585
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GATA zinc finger domain containing 2A transcript_id : NM_145596.2

name	9130404D08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349348 GeneID:74549 MGI:1921799
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9130404D08 gene transcript_id : NM_028993.3

name	Sf4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130369 GeneID:70616 MGI:1917866
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : splicing factor 4 transcript_id : NM_027481.2

name	Tm6sf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366159 GeneID:107770 MGI:1933210
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane 6 superfamily member 2 transcript_id : NM_181540.3

name	Hapln4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130529 GeneID:330790 MGI:2679531
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hyaluronan and proteoglycan link protein 4 transcript_id : NM_177900.4

name	Ncan (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40789267 GeneID:13004 MGI:104694
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neurocan transcript_id : NM_007789.2

name	Rfxank (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70980522 GeneID:19727 MGI:1333865
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : regulatory factor X-associated ankyrin-containing protein transcript_id : NM_001025589.1

name	Rfxank (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70980521 GeneID:19727 MGI:1333865
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : regulatory factor X-associated ankyrin-containing protein transcript_id : NM_011266.2

name	2310073E15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70980536 GeneID:75692 MGI:1922942
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310073E15 gene transcript_id : NM_001025586.1

name	2310073E15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70980528 GeneID:75692 MGI:1922942
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310073E15 gene transcript_id : NM_001025587.1

name	2310045N01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94383628 GeneID:72368 MGI:1919618
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 ESTs product : RIKEN cDNA 2310045N01 gene, transcript variant 1 transcript_id : XM_486121.4

name	Mef2b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113865984 GeneID:17259 MGI:104526
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myocyte enhancer factor 2B transcript_id : NM_008578.2

name	Mef2b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113865986 GeneID:17259 MGI:104526
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myocyte enhancer factor 2B transcript_id : NM_001045484.1

name	Tmem161a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542193 GeneID:234371 MGI:2384577
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 161A transcript_id : NM_145597.2

name	Slc25a42 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56090651 GeneID:73095 MGI:1920345
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 25, member 42 transcript_id : NM_001007570.1

name	Armc6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113199754 GeneID:76813 MGI:1924063
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : armadillo repeat containing 6 transcript_id : NM_133972.2

name	Sfrs14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982110 GeneID:234373 MGI:2678085
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : splicing factor, arginine/serine-rich 14 transcript_id : NM_172755.2

name	Homer3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33859657 GeneID:26558 MGI:1347359
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : homer homolog 3 (Drosophila) transcript_id : NM_011984.1

name	Ddx49 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:67972434 GeneID:234374 MGI:2136689
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DEAD (Asp-Glu-Ala-Asp) box polypeptide 49 transcript_id : NM_001024922.2

name	Cope (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10946971 GeneID:59042 MGI:1891702
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coatomer protein complex, subunit epsilon transcript_id : NM_021538.1

name	Lass1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20149717 GeneID:93898 MGI:2136690
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : longevity assurance homolog 1 (S. cerevisiae) transcript_id : NM_138647.1

name	Upf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13507600 GeneID:19704 MGI:107995
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UPF1 regulator of nonsense transcripts homolog (yeast) transcript_id : NM_030680.1

name	Comp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7710009 GeneID:12845 MGI:88469
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cartilage oligomeric matrix protein transcript_id : NM_016685.1

name	Crtc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131085 GeneID:382056 MGI:2142523
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CREB regulated transcription coactivator 1 transcript_id : NM_001004062.2

name	4732435N03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58332430 CCDS:CCDS22341.1 GeneID:234356 MGI:2442354
definition	GO_component : GO:0030173 - integral to Golgi membrane [Evidence ISS]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0005622 - intracellular [Evidence ISS]; GO:0016020 - membrane [Evidence IEA]; GO:0005625 - soluble fraction [Evidence ISS] GO_function : GO:0047238 - glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity [Evidence ISS]; GO:0015020 - glucuronosyltransferase activity [Evidence ISS]; GO:0047237 - glucuronylgalactosylproteoglycan 4-beta-N-acetylgalactosaminyltransferase activity [Evidence IEA] [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA] [Evidence ISS]; GO:0008955 - peptidoglycan glycosyltransferase activity [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008283 - cell proliferation [Evidence ISS]; GO:0008037 - cell recognition [Evidence ISS]; GO:0030206 - chondroitin sulfate biosynthesis [Evidence ISS]; GO:0050653 - chondroitin sulfate proteoglycan biosynthesis, polysaccharide chain biosynthesis [Evidence ISS]; GO:0030198 - extracellular matrix organization and biogenesis [Evidence ISS]; GO:0015014 - heparan sulfate proteoglycan biosynthesis, polysaccharide chain biosynthesis [Evidence ISS]; GO:0030210 - heparin biosynthesis [Evidence ISS]; GO:0009653 - morphogenesis [Evidence ISS]; GO:0007399 - nervous system development [Evidence ISS]; GO:0046398 - UDP-glucuronate metabolism [Evidence ISS]; GO:0019276 - UDP-N-acetylgalactosamine metabolism [Evidence ISS] codon_start : 1 exception : mismatches in translation note : beta1,4 N-acetylgalactosaminyltransferase product : RIKEN cDNA 4732435N03 protein_id : NP_766341.3

name	Ints10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229115 CCDS:CCDS22342.1 GeneID:70885 MGI:1918135
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 product : integrator complex subunit 10 protein_id : NP_081866.1

name	Lpl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126723006 GeneID:16956 MGI:96820
definition	GO_component : GO:0042627 - chylomicron [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0008201 - heparin binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0005319 - lipid transporter activity [Evidence IEA]; GO:0004465 - lipoprotein lipase activity [Evidence IEA] GO_process : GO:0016042 - lipid catabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA] codon_start : 1 note : O 1-4-5 product : lipoprotein lipase protein_id : NP_032535.2

name	Slc18a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346439 CCDS:CCDS22344.1 GeneID:110877 MGI:106684
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005386 - carrier activity [Evidence IEA]; GO:0015238 - drug transporter activity [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0015893 - drug transport [Evidence IEA]; GO:0006836 - neurotransmitter transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : vesicular amine transporter 1; chromaffin granule amine transporter product : solute carrier family 18, member 1 protein_id : NP_694694.1

name	Atp6v1b2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19705578 GeneID:11966 MGI:109618
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0045261 - proton-transporting ATP synthase complex, catalytic core F(1) [Evidence IEA] GO_function : GO:0046933 - hydrogen-transporting ATP synthase activity, rotational mechanism [Evidence IEA]; GO:0046961 - hydrogen-transporting ATPase activity, rotational mechanism [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0015986 - ATP synthesis coupled proton transport [Evidence IEA]; GO:0015988 - energy coupled proton transport, against electrochemical gradient [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : ATPase, H+ transporting, lysosomal (vacuolar proton pump), beta 56/58 kDa, isoform 2; lysosomal 56/58kDa; ATPase, H+ transporting, lysosomal 56/58kD, V1 subunit B, isoform 2; ATPase, H+ transporting, V1 subunit B, isoform 2 product : vacuolar H+ATPase B2 protein_id : NP_031535.2

name	Lzts1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40786424 CCDS:CCDS22345.1 GeneID:211134 MGI:2684762
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0045786 - negative regulation of progression through cell cycle [Evidence IEA] codon_start : 1 exception : mismatches in translation note : leucine-zipper protein FEZ1; F37 esophageal cancer-related leucine zipper motif 1 product : leucine zipper, putative tumor suppressor 1 protein_id : NP_955396.1

name	EG665540 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94383611 GeneID:665540 MGI:3643381
definition	codon_start : 1 product : hypothetical protein protein_id : XP_982736.1

name	D10627 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110681698 GeneID:234358 MGI:2675306
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : zinc finger protein product : hypothetical protein LOC234358 protein_id : NP_001013397.2

name	LOC665553 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258878 GeneID:665553
definition	codon_start : 1 product : similar to membrane-associated ring finger (C3HC4) 5 protein_id : XP_001476361.1

name	D130040H23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369670 GeneID:211135 MGI:2444324
definition	codon_start : 1 product : hypothetical protein LOC211135 protein_id : NP_766079.1

name	LOC670593 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258866 GeneID:670593
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476038.1

name	EG665578 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149258868 GeneID:665578 MGI:3649141
definition	codon_start : 1 product : hypothetical protein protein_id : XP_983008.2

name	LOC673968 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258870 GeneID:673968
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476092.1

name	AI449175 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113930743 GeneID:234362 MGI:2142546
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : Kruppel-like zinc finger protein protein_id : NP_001039018.1

name	AI449175 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113930740 CCDS:CCDS22347.1 GeneID:234362 MGI:2142546
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : Kruppel-like zinc finger protein protein_id : NP_766342.2

name	EG636741 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149258874 GeneID:636741 MGI:3646490
definition	codon_start : 1 product : hypothetical protein protein_id : XP_917327.3

name	1200003I07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:90577169 GeneID:66869 MGI:1914119
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : U 2-7-1 product : hypothetical protein LOC66869 protein_id : NP_001035054.1

name	1200003I07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:90577171 GeneID:66869 MGI:1914119
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : U 2-7-1 product : hypothetical protein LOC66869 protein_id : NP_001035056.1

name	1200003I07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31559794 GeneID:66869 MGI:1914119
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : U 2-7-1 product : hypothetical protein LOC66869 protein_id : NP_851791.1

name	D330038O06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:141801938 GeneID:330788 MGI:3584369
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : hypothetical protein LOC330788 protein_id : NP_808567.2

name	Atp13a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18875382 CCDS:CCDS22349.1 GeneID:170759 MGI:2180801
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016887 - ATPase activity [Evidence IEA]; GO:0015662 - ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016820 - hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006812 - cation transport [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : cation-transporting ATPase 2 product : ATPase type 13A1 protein_id : NP_573487.1

name	Gmip (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37674214 CCDS:CCDS22350.1 GeneID:78816 MGI:1926066
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0019992 - diacylglycerol binding [Evidence IEA]; GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : Gem-interacting protein protein_id : NP_932769.1

name	Edg4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254539 GeneID:53978 MGI:1858422
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0001619 - lysosphingolipid and lysophosphatidic acid receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor 4 protein_id : NP_064412.2

name	Pbx4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:68299791 CCDS:CCDS22352.1 GeneID:80720 MGI:1931321
definition	GO_component : GO:0005634 - nucleus [Evidence IMP] [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0009790 - embryonic development [Evidence IMP]; GO:0030902 - hindbrain development [Evidence IMP]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0045898 - regulation of transcriptional preinitiation complex formation [Evidence IMP]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : pre-B-cell leukemia homeobox 4 protein_id : NP_001020125.1

name	Cilp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110350656 GeneID:68709 MGI:1915959
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : cartilage intermediate layer protein 2 protein_id : NP_081094.1

name	BC028663 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94383627 GeneID:234365 MGI:2681845
definition	codon_start : 1 product : similar to BC028663 protein protein_id : XP_983345.1

name	Ndufa13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963633 CCDS:CCDS22353.1 GeneID:67184 MGI:1914434
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0016020 - membrane [Evidence IEA]; GO:0005746 - mitochondrial electron transport chain [Evidence ISS]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence ISS] [Evidence IDA]; GO:0005654 - nucleoplasm [Evidence ISS]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence ISS] [Evidence TAS]; GO:0008137 - NADH dehydrogenase (ubiquinone) activity [Evidence IEA] [Evidence ISS]; GO:0003954 - NADH dehydrogenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0006915 - apoptosis [Evidence IDA]; GO:0030262 - apoptotic nuclear changes [Evidence ISS]; GO:0008624 - induction of apoptosis by extracellular signals [Evidence ISS]; GO:0030308 - negative regulation of cell growth [Evidence ISS]; GO:0045892 - negative regulation of transcription, DNA-dependent [Evidence ISS]; GO:0006606 - protein import into nucleus [Evidence ISS] codon_start : 1 note : genes associated with retinoid-IFN-induced mortality 19 product : NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 13 protein_id : NP_075801.1

name	Tssk6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:14030781 CCDS:CCDS22354.1 GeneID:83984 MGI:2148775
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA] [Evidence ISS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA] [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence ISS]; GO:0035092 - sperm chromatin condensation [Evidence IMP]; GO:0007283 - spermatogenesis [Evidence IEA] codon_start : 1 note : serine/threonine protein kinase SSTK product : testis-specific serine kinase 6 protein_id : NP_114393.1

name	Gatad2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30795222 CCDS:CCDS22355.1 GeneID:234366 MGI:2384585
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IEA]; GO:0016581 - NuRD complex [Evidence ISS] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0030674 - protein binding, bridging [Evidence ISS]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0016564 - transcriptional repressor activity [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006306 - DNA methylation [Evidence ISS]; GO:0045892 - negative regulation of transcription, DNA-dependent [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : p66 alpha homolog protein_id : NP_663571.2

name	9130404D08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981307 GeneID:74549 MGI:1921799
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC74549 protein_id : NP_083269.3

name	Sf4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28076967 CCDS:CCDS22356.1 GeneID:70616 MGI:1917866
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA]; GO:0005681 - spliceosome complex [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA]; GO:0006396 - RNA processing [Evidence IEA] codon_start : 1 product : splicing factor 4 protein_id : NP_081757.1

name	Tm6sf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31559811 CCDS:CCDS22357.1 GeneID:107770 MGI:1933210
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] codon_start : 1 product : transmembrane 6 superfamily member 2 protein_id : NP_853518.1

name	Hapln4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244530 GeneID:330790 MGI:2679531
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0005540 - hyaluronic acid binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 note : brain linked protein 2; link protein 4 product : brain link protein 2 protein_id : NP_808568.1

name	Ncan (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40789268 CCDS:CCDS22358.1 GeneID:13004 MGI:104694
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005540 - hyaluronic acid binding [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 note : TGFbeta-induced transcript, brain product : chondroitin sulfate proteoglycan 3 protein_id : NP_031815.2

name	2310073E15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70980537 GeneID:75692 MGI:1922942
definition	codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : hypothetical protein LOC75692 isoform 1 protein_id : NP_001020757.1

name	2310073E15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70980529 GeneID:75692 MGI:1922942
definition	codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : hypothetical protein LOC75692 isoform 2 protein_id : NP_001020758.1

name	Rfxank (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70980523 GeneID:19727 MGI:1333865
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007265 - Ras protein signal transduction [Evidence IPI]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : regulatory factor X-associated ankyrin-containing protein isoform 2 protein_id : NP_001020760.1

name	Rfxank (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755316 CCDS:CCDS22360.1 GeneID:19727 MGI:1333865
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007265 - Ras protein signal transduction [Evidence IPI]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : regulatory factor X-associated ankyrin-containing protein isoform 1 protein_id : NP_035396.1

name	2310045N01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63575389 GeneID:72368 MGI:1919618
definition	codon_start : 1 product : hypothetical protein LOC72368 isoform 1 protein_id : XP_486121.2

name	Mef2b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113865985 CCDS:CCDS22361.1 GeneID:17259 MGI:104526
definition	GO_component : GO:0005634 - nucleus [Evidence IC] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IDA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : myocyte enhancer factor 2B isoform 1 protein_id : NP_032604.2

name	Mef2b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113865987 GeneID:17259 MGI:104526
definition	GO_component : GO:0005634 - nucleus [Evidence IC] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IDA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : myocyte enhancer factor 2B isoform 2 protein_id : NP_001038949.1

name	Tmem161a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704194 GeneID:234371 MGI:2384577
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] codon_start : 1 product : hypothetical protein LOC234371 protein_id : NP_663572.1

name	Slc25a42 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56090652 GeneID:73095 MGI:1920345
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA] GO_function : GO:0005488 - binding [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : solute carrier family 25, member 42 protein_id : NP_001007571.1

name	Armc6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113199755 GeneID:76813 MGI:1924063
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : armadillo repeat containing 6 protein_id : NP_598733.2

name	Sfrs14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982111 CCDS:CCDS22362.1 GeneID:234373 MGI:2678085
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA]; GO:0006396 - RNA processing [Evidence IEA] codon_start : 1 exception : mismatches in translation product : arginine/serine-rich 14 splicing factor protein_id : NP_766343.2

name	Homer3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859658 CCDS:CCDS22363.1 GeneID:26558 MGI:1347359
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_process : GO:0007216 - metabotropic glutamate receptor signaling pathway [Evidence TAS] codon_start : 1 exception : mismatches in translation note : homer, neuronal immediate early gene, 3 product : homer homolog 3 protein_id : NP_036114.1

name	Ddx49 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67972435 CCDS:CCDS22364.1 GeneID:234374 MGI:2136689
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008026 - ATP-dependent helicase activity [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : DEAD (aspartate-glutamate-alanine-aspartate) box polypeptide 27; DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 49 product : DEAD (Asp-Glu-Ala-Asp) box polypeptide 49 protein_id : NP_001020093.2

name	Cope (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946972 CCDS:CCDS22365.1 GeneID:59042 MGI:1891702
definition	GO_component : GO:0030137 - COPI-coated vesicle [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0008565 - protein transporter activity [Evidence IEA] GO_process : GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : nonclathrin coat protein epsilon-COP product : epsilon subunit of coatomer protein complex protein_id : NP_067513.1

name	Lass1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20149718 GeneID:93898 MGI:2136690
definition	GO_function : GO:0008083 - growth factor activity [Evidence IEA] codon_start : 1 product : longevity assurance homolog 1 protein_id : NP_619588.1

name	Upf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13507601 GeneID:19704 MGI:107995
definition	GO_component : GO:0000785 - chromatin [Evidence ISS]; GO:0005737 - cytoplasm [Evidence ISS] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004004 - ATP-dependent RNA helicase activity [Evidence ISS]; GO:0003682 - chromatin binding [Evidence ISS]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0003723 - RNA binding [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence ISS]; GO:0006281 - DNA repair [Evidence ISS]; GO:0006260 - DNA replication [Evidence ISS]; GO:0000184 - mRNA catabolism, nonsense-mediated decay [Evidence IEA] [Evidence ISS]; GO:0006406 - mRNA export from nucleus [Evidence ISS]; GO:0006449 - regulation of translational termination [Evidence ISS]; GO:0006396 - RNA processing [Evidence ISS] codon_start : 1 exception : mismatches in translation function : involved in reduction of nonsense mRNA note : nonsense mRNA reducing factor 1 product : regulator of nonsense transcripts 1 protein_id : NP_109605.1

name	Comp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7710010 CCDS:CCDS22367.1 GeneID:12845 MGI:88469
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : cartilage oligomeric matrix protein protein_id : NP_057894.1

name	Crtc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51783963 GeneID:382056 MGI:2142523
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0008140 - cAMP response element binding protein binding [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : mucoepidermoid carcinoma translocated 1 protein_id : NP_001004062.1

name	LOC100041138 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041138
definition	number : 1 pseudo : _no_value

name	LOC100041138 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041138
definition	number : 2 pseudo : _no_value

name	LOC622336 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:622336
definition	number : 1 pseudo : _no_value

name	LOC665561 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149258883 GeneID:665561
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 8 Proteins product : similar to isolog of yeast sui1 and rice gos2; putative pseudo : _no_value transcript_id : XR_032687.1

name	LOC100041482 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149258884 GeneID:100041482
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 ESTs, 4 Proteins product : similar to cadherin-11 pseudo : _no_value transcript_id : XR_032700.1

name	LOC665649 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149258888 GeneID:665649
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 110 ESTs, 9 Proteins product : similar to Nucleoside diphosphate kinase B (NDK B) (NDP kinase B) (P18) pseudo : _no_value transcript_id : XR_032879.1

clone name	MSMg01-500G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-138A23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-157J11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-457N04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519L22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-401M14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-330O09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-090D17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-131A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-507H12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-147F23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-315A23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-534D21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-329B23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-346G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-212P15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-163C23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309D23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-392J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-302J06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-068J03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-438G20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-116F01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-349G18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-098L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-458B02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-398J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-110D23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381D10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-173F24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-126C15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-289P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-148F21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-398L18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-316L10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-107E15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-535C07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-062O20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-448C10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-066M06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-098F09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-138F05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-149B05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-218D05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-265F19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-267B23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-273D20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-381G04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-398E07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-509A02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-083F04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-103C17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-262F13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-300C16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-338D16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-357H10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-362E08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-367D05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-379F11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-385E15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-391B03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-406A14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-424K02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-462E03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-484P24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-490B15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-502D13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-507C12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-514L17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-530C13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-532H08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-548E10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-349G22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-519A08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-525F18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-398A13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-511N16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-449E21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-465B23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-063N04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-272E15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-329G19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-439I02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-156L10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-325O13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-117N11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-190O21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-237K08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-237A12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392P19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-489A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-512I09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-179N03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416C04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-072G04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-164C17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-211J15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-344E09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-291C09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-162F14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-540H09
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-274J16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-072L15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348I08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-270M10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-325O02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-439D14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-118M11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-146P19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-470N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-519L03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-530I03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134J23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-401O18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-390I16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-109L22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-441G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-164L03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-547E13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-501O01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-453L12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-162D16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-401P09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185I21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-002A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172E03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116J06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-176F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299J24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-011K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171L05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318I15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-272O12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131I03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-195D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337B06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234M10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262B19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191K03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-096J16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-225L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003G04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263F03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194I18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-055A20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154C24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-186M19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-120C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331A09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223D20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-180H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135D15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-325J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201F17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-324P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260I08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-254M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320A23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-334N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273A11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194P02
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-406A14.T7 (MSMg01no406_a14.b1)	MSMg01-406A14.TJ (MSMg01no406_a14.g1)
ACC	AG504326	AG504327
length	733	766
length of high quality (start - end)	504 (71 - 574)	482 (75 - 556)
definition	CHROMAT_FILE: MSMg01no406_a14.b1 PHD_FILE: MSMg01no406_a14.b1.phd.1 CHEM: term DYE: big TIME: Wed May 18 18:21:13 2005	CHROMAT_FILE: MSMg01no406_a14.g1 PHD_FILE: MSMg01no406_a14.g1.phd.1 CHEM: term DYE: big TIME: Wed May 18 18:21:13 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	plural
sequence	CCCACTATTGTGGCCGCCAAACGACTCACTATTTCCAGAGATCCGCGGAA TCTCTATGTAGCCAGATTAGATCAAACTAGCCTCTGACTTCTTAAAATTT CTGTGATCCTTCTGTGCCTGTCTACAGAGCTCTGGATTCCATATCTGTAC CCCTCCCACACACATACCTTAGTCATTCATTTCTTCATTGATTATTTTCA TTACCATCATCATTTCCTGAGGTCTGCCTTGTCTTTCCTTCCATCTCACA GACTATGACATAAGATTCCTCTTATTTTCCATTTGTGCTTAAGTCTTGGT TTATGCTGTGGTTGGCCAACTGTAATGGTTATGGAATTCTGGTGGTTTTT TTTCCCATGGTATCCTATCTTCTCCATTCTTAAAATAGAAGCTTTTGCTT TAGTATTCAATTCAGGCACCATATCCTTTAAGCATCCTCTTTTTGCTGTG CTGGCCTCTGGCATCCTTGCTGTGGATGCACACATATGATCAATGAATAA TAGAGTTTCTGGGTTCTAGACATTGTATTAGTGGCTTTATATTCCCATTT CTCTTGATCATTGCAGCAACCTTTCAACGAATATTATTCTTATCTACCTC TCTGAAATGAGCAAGCTGGGCTCTAGAGAAAGTTGTCAGCTTTTCCAAAG CTGACAAGTGTTATATTGATATCTCTACCCCCTGTTTGTTAAACGATAAC CATACACTACGCGGATGTAAGCTGCCCCCTATN	CATTGCTGTXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXXACTTTTCAGCAATTGACTATGATTGC TGACTGCTCTCCTCCCACCTTTTCTCTAGAGAAAATATGAGGAATACTTA GCTCTTAATTAAAACACAAACAAAGGTGCACGCGCACGCAAACACACAAA CACACACACACACACACTAAAAAGAATTAAAGACAAGATCGGGCATGCTC AGGGTGGTTTGGCTGTAGACACTTATGGAAGTCTAAAAGGAAGGATTCCA GGCCTGAAGGAGATAGGAACTCCAGAGAATGACCAACCACCAGAATCAAA TAACATGAACCCTCAGGGCACTCAGAGATGGAACAATGAAACAAAGAACA AACATGGGTTGGACGGATATCTCCGAGCACCTATGTAGCAGAGGGGCAGC TAGGTCTTCACATGGGTCCCAATCAACTGGAATGGGGGTATCAAAAAAAG CTGTTCATCCTAACTCAGTTTTATTCTTCTAGCTGAGCTACTTTTTCTGT CCTCATAGAGAGACGAAGTGTCAGGGTTTGGACATACAGGGAGTTCCAAA CTGCTCAAATGTGAAGCGGAGCATTTGTAAGTAATATACTGTGCCTACTG TTCGTCTCTGAATTGTTCCTCTGCTTTTCCTATATTCACCCCAACACCCA AATCCATTTTATATTTTCTCCCCCAAACCCCTTCACTTTTATGAATTGAT CCCCTTCCCCTACCCG
quality values	Open. Hide. 7 10 10 8 6 6 6 8 8 6 6 8 15 8 8 8 8 8 10 19 10 15 15 32 19 24 19 15 15 9 11 12 20 27 21 16 8 8 8 8 8 15 19 23 33 37 39 21 15 6 8 8 8 8 10 19 16 10 6 6 6 6 8 10 9 17 17 22 12 18 15 25 29 29 31 33 36 36 50 50 50 57 59 59 53 53 53 53 53 50 50 50 50 50 53 54 68 51 51 43 50 50 50 50 68 48 48 54 32 34 28 19 19 28 34 57 57 57 57 57 57 57 57 68 68 68 68 68 57 57 57 59 59 50 50 47 50 50 47 47 47 50 50 57 57 57 57 57 57 50 57 57 57 57 57 57 50 57 57 57 68 68 68 68 59 59 57 59 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 59 57 57 57 59 59 68 68 68 59 59 59 59 59 57 57 57 57 57 57 59 59 57 59 59 68 68 68 68 68 68 68 68 62 62 62 62 62 68 62 62 62 62 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 68 68 68 68 68 62 62 62 62 52 62 62 62 62 62 62 62 62 62 62 52 45 43 43 27 27 26 35 35 43 43 62 62 52 62 62 62 62 62 62 62 62 44 62 52 52 52 52 62 62 62 43 43 43 43 52 62 62 62 62 62 68 62 62 62 62 62 62 62 44 43 35 24 38 38 38 52 57 57 59 59 59 59 59 57 57 57 57 57 57 57 57 57 52 52 52 43 57 52 42 42 39 39 39 57 57 57 52 52 52 52 44 44 38 38 14 21 24 38 38 57 57 57 57 57 57 57 57 57 57 68 57 57 52 52 52 54 54 57 57 57 52 52 52 57 57 57 52 52 54 57 57 57 59 57 57 48 57 44 43 43 44 57 57 34 34 20 20 31 32 28 24 15 21 21 37 40 59 59 57 48 42 44 42 37 35 30 32 36 32 27 41 20 20 18 22 17 24 24 37 30 39 37 39 39 40 33 28 29 22 22 15 19 15 13 13 12 12 22 27 19 22 22 24 24 35 28 37 34 23 23 32 28 30 28 28 24 24 21 16 15 11 9 12 12 18 18 31 33 37 39 35 24 32 23 23 19 21 19 32 32 47 57 47 47 47 39 39 35 32 32 37 37 37 39 39 32 32 28 22 22 25 28 26 19 13 11 11 13 17 21 12 13 15 17 18 20 33 33 39 43 20 20 14 14 10 11 10 8 8 8 10 10 23 22 34 20 24 19 15 14 9 8 8 8 8 10 10 19 21 18 15 10 10 8 8 8 8 11 13 8 8 10 10 13 13 10 10 10 15 11 11 9 12 9 9 8 10 11 8 8 8 10 10 12 9 9 11 11 8 10 8 11 12 22 15 10 8 8 10 6 6 6 6 8 8 14 14 14 17 13 10 9 9 9 17 25 26 26 15 13 12 10 10 8 8 8 8 10 11 11 13 12 10 10 10 10 10 9 15 8 8 8 8 8 11 8 8 8 8 8 8 10 10 10 11 9 9 12 9 10 10 12 3 0	Open. Hide. 8 10 8 8 8 8 8 8 13 11 10 9 10 15 25 18 16 31 27 27 37 37 37 31 31 37 37 31 21 13 8 6 6 6 6 6 13 9 16 16 25 23 37 37 31 32 41 23 23 20 21 21 26 26 26 14 12 23 15 9 9 9 9 10 9 18 18 25 17 20 20 20 24 29 36 36 36 57 35 35 28 31 31 42 43 50 50 53 53 53 53 57 53 68 68 68 68 53 53 53 53 53 53 57 59 57 57 57 57 53 53 53 53 35 30 30 31 31 31 59 59 37 21 21 8 6 6 8 19 23 59 59 33 31 31 31 35 35 38 38 57 36 36 37 37 50 50 59 59 59 59 50 50 53 53 68 68 68 68 54 54 59 57 57 57 57 68 68 68 68 57 57 57 57 59 59 59 68 68 59 59 59 57 57 57 57 57 48 48 48 48 57 57 57 59 57 57 57 43 44 44 57 57 57 57 57 57 57 43 43 43 59 59 59 59 59 59 59 59 59 59 59 59 50 50 50 50 50 50 54 57 57 57 57 57 57 57 57 57 57 57 59 57 68 57 57 57 57 57 57 57 57 59 68 68 68 68 59 59 59 57 57 57 57 57 57 52 52 57 57 57 57 57 59 59 59 59 59 57 57 57 57 57 57 57 52 52 59 57 57 57 57 57 57 57 57 57 57 57 62 62 62 62 62 62 62 43 39 43 57 57 57 57 57 43 43 39 39 43 43 43 43 35 39 43 57 57 57 57 57 57 57 57 57 57 59 59 59 68 59 44 43 31 31 42 44 52 52 52 57 57 57 57 59 59 59 57 52 52 52 52 57 57 52 52 52 59 43 35 35 43 38 38 50 43 35 38 38 52 37 37 57 52 54 57 57 57 57 57 48 48 48 44 50 47 48 57 57 48 54 54 57 57 57 57 47 43 43 47 47 48 48 54 48 44 37 37 44 57 48 48 46 59 44 36 36 23 23 23 28 36 43 42 42 32 30 25 25 25 26 26 33 34 34 30 28 28 31 36 43 57 43 43 37 43 43 43 40 43 43 43 43 39 39 28 28 28 28 30 32 35 30 28 28 28 30 37 37 34 24 27 30 30 30 33 43 41 41 30 32 34 37 30 30 30 32 32 37 37 43 36 40 28 24 24 29 29 39 42 43 48 47 42 39 32 31 23 23 28 37 42 33 36 43 42 39 39 39 42 42 43 47 43 37 40 35 35 35 47 47 48 48 48 38 33 33 33 33 36 36 28 33 13 11 8 8 8 11 12 23 15 18 18 23 15 18 15 22 9 9 9 9 10 11 10 11 8 8 8 10 12 19 15 15 14 13 13 21 15 15 12 10 10 8 8 10 10 10 12 13 10 10 10 10 10 10 10 9 9 11 11 12 15 10 8 8 8 8 8 8 11 11 12 15 12 11 15 9 9 7 8 8 8 8 8 9 13 9 9 9 8 8 10 10 8 8 8 8 8 8 8 11 10 8 8 8 8 8 8 10 9 6 10 6 6 8 10 8 8 8 10 9 12 12 11 12 12 15 11 11 11 13 12 10 10 10 10 10 10 19 19 14 8 8 8 8 8 8 9 11 11 11 11 11 11 11 11 15 15 11 11 13 10 12 10 16 14 11 12 11 11 10 10 9 9 9 9 11 8 8 8 8 10 8 8 8 11 12 13 6 6 6 6 8 8 10 8 8 8 8 11 13 17 17 14 15 14 16 21 15 14 13 8 10 10 8

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no406_a14.g1 MSMg01no406_a14.g1 CHROMAT_FILE:
MSMg01no406_a14.g1 PHD_FILE: MSMg01no406_a14.g1.phd.1 CHEM: term DYE:
big TIME: Wed May 18 18:21:13 2005
         (482 letters)



>mm_chr8_71970528_71971409
          Length = 882

 Score =  826 bits (427), Expect = 0.0
 Identities = 471/491 (95%), Gaps = 10/491 (2%)
 Strand = Plus / Plus

                                                                       
Query: 1   acttttcagcaattgactatgattgctgactgctctcctcccaccttttctctagagaaa 60
           |||||||||||||||||||||||||||||||||||  ||||||||||||||| |||| ||
Sbjct: 201 acttttcagcaattgactatgattgctgactgctcagctcccaccttttctcaagaggaa 260

                                                                       
Query: 61  atatgaggaatacttagctcttaattaaaacacaaacaaaggtgcacgcgcacgcaa--- 117
           |||||||||||||||||||||||||||||||||||||||| |||||| | |||||||   
Sbjct: 261 atatgaggaatacttagctcttaattaaaacacaaacaaaagtgcacacacacgcaaaca 320

                                                                       
Query: 118 ---acacacaaac----acacacacacacacactaaaaagaattaaagacaagatcgggc 170
              ||||||||||    |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 321 cacacacacaaacacaaacacacacacacacactaaaaagaattaaagacaagatcgggc 380

                                                                       
Query: 171 atgctcagggtggtttggctgtagacacttatggaagtctaaaaggaaggattccaggcc 230
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 381 atgctcagggtggtttggctgtagacacttatggaagtctaaaaggaaggattccaggcc 440

                                                                       
Query: 231 tgaaggagataggaactccagagaatgaccaaccaccagaatcaaataacatgaaccctc 290
           ||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||
Sbjct: 441 tgaaggagataggaactccagaggatgaccaactaccagaatcaaataacatgaaccctc 500

                                                                       
Query: 291 agggcactcagagatggaacaatgaaacaaagaacaaacatgggttggacggatatctcc 350
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 501 agggcactcagagatggaacaatgaaacaaagaacaaacatgggttggacggatatctcc 560

                                                                       
Query: 351 gagcacctatgtagcagaggggcagctaggtcttcacatgggtcccaatcaactggaatg 410
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 561 gagcacctatgtagcagaggggcagctaggtcttcacatgggtcccaatcaactggaatg 620

                                                                       
Query: 411 ggggtatcaaaaaaagctgttcatcctaactcagttttattcttctagctgagctacttt 470
           |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 621 ggggtatcaaaaaaagctgttcatcctacctcagttttattcttctagctgagctacttt 680

                      
Query: 471 ttctgtcctca 481
           |||||||||||
Sbjct: 681 ttctgtcctca 691


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 22
Number of extensions: 2
Number of successful extensions: 2
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 482
Length of database: 882
Length adjustment: 10
Effective length of query: 472
Effective length of database: 872
Effective search space:   411584
Effective search space used:   411584
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information