MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-491D10
Chromosome	8 (Build37)
Map Location	23,513,150 - 23,513,770
singlet/doublet	singlet
Overlap gene	none
Upstream gene	LOC100041843, LOC100040678, EG665927, LOC100040693, Defcr20, LOC100041890, LOC100041895, EG626682, LOC100040706, EG665956, LOC635093, Defcr26, Defcr17, LOC100041952, Defcr-ps1, AY761184, LOC100040729, Defcr24, LOC100040739, Defb1, Defb50, Defb2, Defb10, Defb9, Defb11, Defb15, Defb35, Defb13, C86695, Ccdc70, Atp7b, Alg11, Nek5, Nek3, Ckap2, Vps36, Rpl30-ps2, Thsd1, Tpte, Slc25a15
Downstream gene	LOC547006, Mrps31, AI316807, Slc20a2, LOC100040803, Vdac3, Dkk4, Polb, Ikbkb, Plat, Ap3m2, Myst3, LOC100042253, Ank1, Nkx6-3, Agpat6, Gins4, Golga7
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100041843 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041843
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	LOC100040678 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040678
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 4 Proteins

name	EG665927 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665927 MGI:3645033
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 5 ESTs, 4 Proteins

name	LOC100040693 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040693
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins

name	Defcr20 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68009 MGI:1915259
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041890 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041890
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 11 ESTs, 17 Proteins

name	LOC100041895 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041895
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs, 17 Proteins

name	EG626682 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:626682 MGI:3646688
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins

name	LOC100040706 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040706
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 7 Proteins

name	EG665956 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665956 MGI:3648003
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 5 ESTs, 4 Proteins

name	LOC635093 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:635093
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Defcr26 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:626708 MGI:3630390
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Defcr17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23855 MGI:1345152
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 41 ESTs, 17 Proteins

name	LOC100041952 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041952
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs, 17 Proteins

name	Defcr-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13217 MGI:99593
definition	gene_synonym : Crypi note : defensin-related cryptdin pseudogene 1 pseudo : _no_value

name	AY761184 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382000 MGI:3611585
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040729 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040729
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins

name	Defcr24 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:503491 MGI:3630383
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100040739 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040739
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Defb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13214 MGI:1096878
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Defb50 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:387334 MGI:3055870
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Defb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13215 MGI:1338754
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Defb10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:246085 MGI:2179205
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Defb9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:246079 MGI:2179198
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Defb11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:246081 MGI:2179197
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Defb15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:246082 MGI:2179202
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Defb35 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:246084 MGI:2179204
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Defb13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:246083 MGI:2179203
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C86695 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:97476 MGI:2142877
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc70 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67929 MGI:1915179
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atp7b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11979 MGI:103297
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Alg11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:207958 MGI:2142632
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nek5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330721 MGI:2142824
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nek3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23954 MGI:1344371
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ckap2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80986 MGI:1931797
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vps36 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70160 MGI:1917410
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpl30-ps2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19948 MGI:1321400
definition	gene_synonym : RpL30-3 note : ribosomal protein L30, pseudogene 2 pseudo : _no_value

name	Thsd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56229 MGI:1929096
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tpte (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234129 MGI:2446460
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc25a15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18408 MGI:1342274
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC547006 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:547006
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	Mrps31 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57312 MGI:1913153
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AI316807 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102032 MGI:2142501
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc20a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20516 MGI:97851
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040803 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040803
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 22 ESTs

name	Vdac3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22335 MGI:106922
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dkk4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234130 MGI:2385299
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Polb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18970 MGI:97740
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ikbkb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16150 MGI:1338071
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Plat (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18791 MGI:97610
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ap3m2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64933 MGI:1929214
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Myst3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244349 MGI:2442415
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042253 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042253
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 18 ESTs, 4 Proteins

name	Ank1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11733 MGI:88024
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nkx6-3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74561 MGI:1921811
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 5 ESTs, 13 Proteins

name	Agpat6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102247 MGI:2142716
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gins4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109145 MGI:1923847
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Golga7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57437 MGI:1931029
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100040678 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258515 GeneID:100040678
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 4 Proteins product : similar to ribosomal protein L21 transcript_id : XM_001475062.1

name	EG665927 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94383146 GeneID:665927 MGI:3645033
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 5 ESTs, 4 Proteins product : predicted gene, EG665927 transcript_id : XM_980383.1

name	LOC100040693 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258517 GeneID:100040693
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins product : similar to defensin related cryptdin 26 transcript_id : XM_001475082.1

name	Defcr20 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801303 GeneID:68009 MGI:1915259
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : defensin related cryptdin 20 transcript_id : NM_183268.2

name	LOC100041890 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258553 GeneID:100041890
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 11 ESTs, 6 Proteins product : similar to defensin-related cryptdin 20, transcript variant 1 transcript_id : XM_001477105.1

name	LOC100041890 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258555 GeneID:100041890
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins product : similar to defensin-related cryptdin 20, transcript variant 2 transcript_id : XM_001477117.1

name	LOC100041895 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258557 GeneID:100041895
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs, 17 Proteins product : similar to cryptdin-5 transcript_id : XM_001477133.1

name	EG626682 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82916634 GeneID:626682 MGI:3646688
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins product : predicted gene, EG626682 transcript_id : XM_891293.1

name	LOC100040706 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258519 GeneID:100040706
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 7 Proteins product : similar to ribosomal protein L21 transcript_id : XM_001475107.1

name	EG665956 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94383148 GeneID:665956 MGI:3648003
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 5 ESTs, 4 Proteins product : predicted gene, EG665956 transcript_id : XM_980509.1

name	Defcr26 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121247276 GeneID:626708 MGI:3630390
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : defensin related cryptdin 26 transcript_id : NM_001079933.1

name	Defcr17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94383150 GeneID:23855 MGI:1345152
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 41 ESTs, 17 Proteins product : defensin related cryptdin 17 transcript_id : XM_980537.1

name	LOC100041952 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258559 GeneID:100041952
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs, 17 Proteins product : similar to cryptdin-5 transcript_id : XM_001477188.1

name	AY761184 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:57222283 GeneID:382000 MGI:3611585
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence AY761184 transcript_id : NM_001007582.1

name	LOC100040729 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258521 GeneID:100040729
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins product : similar to defensin related cryptdin 26 transcript_id : XM_001475147.1

name	Defcr24 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:66730566 GeneID:503491 MGI:3630383
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs product : defensin related cryptdin 24 transcript_id : NM_001024225.1

name	Defb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982411 GeneID:13214 MGI:1096878
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : defensin beta 1 transcript_id : NM_007843.2

name	Defb50 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:39979633 GeneID:387334 MGI:3055870
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : defensin beta 50 transcript_id : NM_199067.1

name	Defb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753623 GeneID:13215 MGI:1338754
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : defensin beta 2 transcript_id : NM_010030.1

name	Defb10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21327670 GeneID:246085 MGI:2179205
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : defensin beta 10 transcript_id : NM_139225.1

name	Defb9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21361231 GeneID:246079 MGI:2179198
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : defensin beta 9 transcript_id : NM_139219.1

name	Defb11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21361235 GeneID:246081 MGI:2179197
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : defensin beta 11 transcript_id : NM_139221.1

name	Defb15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110347556 GeneID:246082 MGI:2179202
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : defensin beta 15 transcript_id : NM_139222.3

name	Defb35 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21218413 GeneID:246084 MGI:2179204
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : defensin beta 35 transcript_id : NM_139224.1

name	Defb13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133778941 GeneID:246083 MGI:2179203
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : defensin beta 13 transcript_id : NM_139223.3

name	C86695 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126157471 GeneID:97476 MGI:2142877
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence C86695 transcript_id : NM_001081662.1

name	Ccdc70 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386013 GeneID:67929 MGI:1915179
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 70 transcript_id : NM_026459.3

name	Atp7b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116256506 GeneID:11979 MGI:103297
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase, Cu++ transporting, beta polypeptide transcript_id : NM_007511.2

name	Alg11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351176 GeneID:207958 MGI:2142632
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : asparagine-linked glycosylation 11 homolog (yeast, alpha-1,2-mannosyltransferase) transcript_id : NM_183142.2

name	Nek5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803451 GeneID:330721 MGI:2142824
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NIMA (never in mitosis gene a)-related expressed kinase 5 transcript_id : NM_177898.4

name	Nek3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803476 GeneID:23954 MGI:1344371
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NIMA (never in mitosis gene a)-related expressed kinase 3 transcript_id : NM_011848.2

name	Ckap2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:52138529 GeneID:80986 MGI:1931797
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytoskeleton associated protein 2 transcript_id : NM_001004140.1

name	Vps36 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30794415 GeneID:70160 MGI:1917410
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vacuolar protein sorting 36 (yeast) transcript_id : NM_027338.1

name	Thsd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9625040 GeneID:56229 MGI:1929096
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thrombospondin, type I, domain 1 transcript_id : NM_019576.1

name	Tpte (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40549439 GeneID:234129 MGI:2446460
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane phosphatase with tensin homology transcript_id : NM_199257.1

name	Slc25a15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802645 GeneID:18408 MGI:1342274
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 25 (mitochondrial carrier ornithine transporter), member 15 transcript_id : NM_181325.3

name	Slc25a15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754951 GeneID:18408 MGI:1342274
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 25 (mitochondrial carrier ornithine transporter), member 15 transcript_id : NM_011017.1

name	Mrps31 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10181115 GeneID:57312 MGI:1913153
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein S31 transcript_id : NM_020560.1

name	AI316807 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:60592995 GeneID:102032 MGI:2142501
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AI316807 transcript_id : NM_001012667.1

name	Slc20a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802688 GeneID:20516 MGI:97851
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 20, member 2 transcript_id : NM_011394.2

name	LOC100040803 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258523 GeneID:100040803
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 22 ESTs product : hypothetical protein LOC100040803 transcript_id : XM_001475299.1

name	Vdac3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755966 GeneID:22335 MGI:106922
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : voltage-dependent anion channel 3 transcript_id : NM_011696.1

name	Dkk4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:128485763 GeneID:234130 MGI:2385299
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dickkopf homolog 4 (Xenopus laevis) transcript_id : NM_145592.2

name	Polb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21729748 GeneID:18970 MGI:97740
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polymerase (DNA directed), beta transcript_id : NM_011130.1

name	Ikbkb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33469100 GeneID:16150 MGI:1338071
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : inhibitor of kappaB kinase beta transcript_id : NM_010546.1

name	Plat (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679374 GeneID:18791 MGI:97610
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : plasminogen activator, tissue transcript_id : NM_008872.1

name	Ap3m2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374145 GeneID:64933 MGI:1929214
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adaptor-related protein complex 3, mu 2 subunit transcript_id : NM_029505.2

name	Myst3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487238 GeneID:244349 MGI:2442415
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MYST histone acetyltransferase (monocytic leukemia) 3 transcript_id : NM_001081149.1

name	LOC100042253 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258561 GeneID:100042253
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 18 ESTs, 4 Proteins product : similar to Lsm6 protein transcript_id : XM_001477766.1

name	Ank1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13624296 GeneID:11733 MGI:88024
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin 1, erythroid transcript_id : NM_031158.1

name	Nkx6-3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94383172 GeneID:74561 MGI:1921811
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 5 ESTs, 13 Proteins product : NK6 transcription factor related, locus 3 (Drosophila) transcript_id : XM_486090.3

name	Agpat6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350728 GeneID:102247 MGI:2142716
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 1-acylglycerol-3-phosphate O-acyltransferase 6 (lysophosphatidic acid acyltransferase, zeta) transcript_id : NM_018743.3

name	Gins4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801928 GeneID:109145 MGI:1923847
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GINS complex subunit 4 (Sld5 homolog) transcript_id : NM_024240.4

name	Golga7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:109809746 GeneID:57437 MGI:1931029
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : golgi autoantigen, golgin subfamily a, 7 transcript_id : NM_001042484.1

name	Golga7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:109809742 GeneID:57437 MGI:1931029
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : golgi autoantigen, golgin subfamily a, 7 transcript_id : NM_020585.2

name	LOC100040678 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258516 GeneID:100040678
definition	codon_start : 1 product : similar to ribosomal protein L21 protein_id : XP_001475112.1

name	EG665927 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94383147 GeneID:665927 MGI:3645033
definition	codon_start : 1 product : hypothetical protein protein_id : XP_985477.1

name	LOC100040693 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258518 GeneID:100040693
definition	codon_start : 1 product : similar to defensin related cryptdin 26 protein_id : XP_001475132.1

name	Defcr20 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34304056 GeneID:68009 MGI:1915259
definition	codon_start : 1 exception : mismatches in translation product : defensin-related cryptdin 20 protein_id : NP_899091.1

name	LOC100041890 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258556 GeneID:100041890
definition	codon_start : 1 product : similar to defensin-related cryptdin 20 isoform 2 protein_id : XP_001477167.1

name	LOC100041890 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258554 GeneID:100041890
definition	codon_start : 1 product : similar to defensin-related cryptdin 20 isoform 1 protein_id : XP_001477155.1

name	LOC100041895 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258558 GeneID:100041895
definition	codon_start : 1 product : similar to cryptdin-5 protein_id : XP_001477183.1

name	EG626682 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82916635 GeneID:626682 MGI:3646688
definition	codon_start : 1 product : similar to defensin-related cryptdin 25 protein_id : XP_896386.1

name	LOC100040706 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258520 GeneID:100040706
definition	codon_start : 1 product : similar to ribosomal protein L21 protein_id : XP_001475157.1

name	EG665956 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94383149 GeneID:665956 MGI:3648003
definition	codon_start : 1 product : hypothetical protein protein_id : XP_985603.1

name	Defcr26 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121247277 GeneID:626708 MGI:3630390
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA] codon_start : 1 note : testis defensin product : defensin related cryptdin 26 protein_id : NP_001073402.1

name	Defcr17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94383151 GeneID:23855 MGI:1345152
definition	codon_start : 1 product : defensin related cryptdin 17 protein_id : XP_985631.1

name	LOC100041952 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258560 GeneID:100041952
definition	codon_start : 1 product : similar to cryptdin-5 protein_id : XP_001477238.1

name	AY761184 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:57222284 CCDS:CCDS22156.1 GeneID:382000 MGI:3611585
definition	GO_process : GO:0006952 - defense response [Evidence IEA] codon_start : 1 product : hypothetical protein LOC382000 protein_id : NP_001007583.1

name	LOC100040729 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258522 GeneID:100040729
definition	codon_start : 1 product : similar to defensin related cryptdin 26 protein_id : XP_001475197.1

name	Defcr24 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66730567 GeneID:503491 MGI:3630383
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA] codon_start : 1 product : defensin-related cryptdin 24 protein_id : NP_001019396.1

name	Defb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681161 GeneID:13214 MGI:1096878
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0042742 - defense response to bacterium [Evidence IEA]; GO:0045087 - innate immune response [Evidence IMP]; GO:0051707 - response to other organism [Evidence IEA] codon_start : 1 product : defensin beta 1 protein_id : NP_031869.1

name	Defb50 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39979634 GeneID:387334 MGI:3055870
definition	GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0042742 - defense response to bacterium [Evidence IEA]; GO:0051707 - response to other organism [Evidence IEA] codon_start : 1 note : prostate beta defensin 1; beta-defensin 50 product : defensin beta 50 protein_id : NP_951022.1

name	Defb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753624 GeneID:13215 MGI:1338754
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0042742 - defense response to bacterium [Evidence IEA]; GO:0051707 - response to other organism [Evidence IEA] codon_start : 1 product : defensin beta 2 protein_id : NP_034160.1

name	Defb10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21327671 GeneID:246085 MGI:2179205
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0042742 - defense response to bacterium [Evidence IEA]; GO:0051707 - response to other organism [Evidence IEA] codon_start : 1 function : antimicrobial peptide product : defensin beta 10 protein_id : NP_631971.1

name	Defb9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21361232 GeneID:246079 MGI:2179198
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0042742 - defense response to bacterium [Evidence IEA]; GO:0051707 - response to other organism [Evidence IEA] codon_start : 1 function : antimicrobial peptide product : defensin beta 9 protein_id : NP_631965.1

name	Defb11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21361236 GeneID:246081 MGI:2179197
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0042742 - defense response to bacterium [Evidence IEA]; GO:0051707 - response to other organism [Evidence IEA] codon_start : 1 function : antimicrobial peptide product : defensin beta 11 protein_id : NP_631967.1

name	Defb15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21218418 GeneID:246082 MGI:2179202
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0042742 - defense response to bacterium [Evidence IEA]; GO:0051707 - response to other organism [Evidence IEA] codon_start : 1 function : antimicrobial peptide product : defensin beta 15 protein_id : NP_631968.1

name	Defb35 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21218414 GeneID:246084 MGI:2179204
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0042742 - defense response to bacterium [Evidence IEA]; GO:0051707 - response to other organism [Evidence IEA] codon_start : 1 function : antimicrobial peptide product : defensin beta 35 protein_id : NP_631970.1

name	Defb13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21218412 GeneID:246083 MGI:2179203
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0042742 - defense response to bacterium [Evidence IEA]; GO:0051707 - response to other organism [Evidence IEA] codon_start : 1 function : antimicrobial peptide product : defensin beta 13 protein_id : NP_631969.1

name	C86695 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126157472 GeneID:97476 MGI:2142877
definition	codon_start : 1 product : hypothetical protein LOC97476 protein_id : NP_001075131.1

name	Ccdc70 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385954 CCDS:CCDS22167.1 GeneID:67929 MGI:1915179
definition	codon_start : 1 product : coiled-coil domain containing 70 protein_id : NP_080735.1

name	Atp7b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116256507 CCDS:CCDS22168.1 GeneID:11979 MGI:103297
definition	GO_component : GO:0005802 - Golgi trans face [Evidence IDA]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0005770 - late endosome [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] [Evidence IDA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA] [Evidence ISS]; GO:0015662 - ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0005507 - copper ion binding [Evidence ISS] [Evidence IEA]; GO:0005375 - copper ion transporter activity [Evidence IEA]; GO:0004008 - copper-exporting ATPase activity [Evidence ISS] [Evidence IDA] [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016820 - hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0046873 - metal ion transporter activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006812 - cation transport [Evidence IEA]; GO:0006878 - copper ion homeostasis [Evidence IMP]; GO:0006825 - copper ion transport [Evidence IDA] [Evidence IMP] [Evidence ISS] [Evidence IEA]; GO:0015680 - intracellular copper ion transport [Evidence IMP]; GO:0006811 - ion transport [Evidence IEA]; GO:0007595 - lactation [Evidence IMP]; GO:0008152 - metabolism [Evidence IEA]; GO:0030001 - metal ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0006882 - zinc ion homeostasis [Evidence IMP] codon_start : 1 note : Wilson protein; toxic milk product : ATPase, Cu++ transporting, beta polypeptide protein_id : NP_031537.2

name	Alg11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34147157 GeneID:207958 MGI:2142632
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0009058 - biosynthesis [Evidence IEA] codon_start : 1 product : asparagine-linked glycosylation 11 homolog (yeast, alpha-1,2-mannosyltransferase) protein_id : NP_898965.1

name	Nek5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31559852 GeneID:330721 MGI:2142824
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 product : NIMA (never in mitosis gene a)-related expressed kinase 5 protein_id : NP_808566.2

name	Nek3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754820 CCDS:CCDS22169.1 GeneID:23954 MGI:1344371
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 exception : mismatches in translation note : NIMA-related expressed kinase 3 product : NIMA (never in mitosis gene a)-related expressed kinase 3 protein_id : NP_035978.1

name	Ckap2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:52138530 CCDS:CCDS22170.1 GeneID:80986 MGI:1931797
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005874 - microtubule [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0008150 - biological_process [Evidence ND]; GO:0007049 - cell cycle [Evidence IEA] codon_start : 1 exception : mismatches in translation product : cytoskeleton associated protein 2 protein_id : NP_001004140.1

name	Vps36 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794416 CCDS:CCDS22171.1 GeneID:70160 MGI:1917410
definition	GO_component : GO:0005770 - late endosome [Evidence IDA]; GO:0005764 - lysosome [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0008289 - lipid binding [Evidence IEA]; GO:0043130 - ubiquitin binding [Evidence IDA] GO_process : GO:0016197 - endosome transport [Evidence IC]; GO:0015031 - protein transport [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : vacuolar protein sorting 36 protein_id : NP_081614.1

name	Thsd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9625041 CCDS:CCDS22172.1 GeneID:56229 MGI:1929096
definition	GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : transmembrane molecule with thrombospondin module product : thrombospondin, type I, domain 1 protein_id : NP_062522.1

name	Tpte (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40549440 CCDS:CCDS22173.1 GeneID:234129 MGI:2446460
definition	GO_component : GO:0005794 - Golgi apparatus [Evidence ISS] codon_start : 1 exception : mismatches in translation product : transmembrane phosphatase with tensin homology protein_id : NP_954866.1

name	Slc25a15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754952 CCDS:CCDS22175.1 GeneID:18408 MGI:1342274
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : ornithine transporter, mitochondrial 1 product : solute carrier family 25 (mitochondrial carrier ornithine transporter), member 15 protein_id : NP_035147.1

name	Slc25a15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31044465 CCDS:CCDS22175.1 GeneID:18408 MGI:1342274
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : ornithine transporter, mitochondrial 1 product : solute carrier family 25 (mitochondrial carrier ornithine transporter), member 15 protein_id : NP_851842.1

name	Mrps31 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10181116 CCDS:CCDS22176.1 GeneID:57312 MGI:1913153
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] codon_start : 1 note : islet mitochondrial antigen, 38 kD product : mitochondrial ribosomal protein S31 protein_id : NP_065585.1

name	AI316807 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:60592996 GeneID:102032 MGI:2142501
definition	codon_start : 1 product : hypothetical protein LOC102032 protein_id : NP_001012685.1

name	Slc20a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794520 CCDS:CCDS22178.1 GeneID:20516 MGI:97851
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA] GO_function : GO:0005386 - carrier activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : solute carrier family 20, member 2 protein_id : NP_035524.1

name	LOC100040803 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258524 GeneID:100040803
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475349.1

name	Vdac3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755967 CCDS:CCDS22179.1 GeneID:22335 MGI:106922
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005741 - mitochondrial outer membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0019867 - outer membrane [Evidence IEA] GO_function : GO:0015288 - porin activity [Evidence IEA]; GO:0008308 - voltage-gated ion-selective channel activity [Evidence IEA] GO_process : GO:0006820 - anion transport [Evidence IEA]; GO:0001662 - behavioral fear response [Evidence IMP]; GO:0006811 - ion transport [Evidence IEA]; GO:0007612 - learning [Evidence IMP]; GO:0007270 - nerve-nerve synaptic transmission [Evidence IMP]; GO:0007268 - synaptic transmission [Evidence IMP]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : channel protein VDAC3; mitochondrial outer membrane protein product : voltage-dependent anion channel 3 protein_id : NP_035826.1

name	Dkk4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704186 CCDS:CCDS22180.1 GeneID:234130 MGI:2385299
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0030178 - negative regulation of Wnt receptor signaling pathway [Evidence IEA]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 product : dickkopf homolog 4 protein_id : NP_663567.1

name	Polb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21729749 CCDS:CCDS22181.1 GeneID:18970 MGI:97740
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005874 - microtubule [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA]; GO:0005876 - spindle microtubule [Evidence ISS]; GO:0000795 - synaptonemal complex [Evidence TAS] GO_function : GO:0003890 - beta DNA polymerase activity [Evidence TAS]; GO:0016829 - lyase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008017 - microtubule binding [Evidence ISS]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0031402 - sodium ion binding [Evidence IEA] GO_process : GO:0006916 - anti-apoptosis [Evidence IMP]; GO:0006284 - base-excision repair [Evidence TAS]; GO:0006287 - base-excision repair, gap-filling [Evidence TAS] [Evidence IMP]; GO:0008219 - cell death [Evidence IMP]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 note : DNA polymerase beta; Pol beta product : polymerase (DNA directed), beta protein_id : NP_035260.1

name	Ikbkb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33469101 CCDS:CCDS22182.1 GeneID:16150 MGI:1338071
definition	GO_component : GO:0005737 - cytoplasm [Evidence TAS] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] [Evidence ISS]; GO:0004672 - protein kinase activity [Evidence IDA] [Evidence IMP]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0004702 - receptor signaling protein serine/threonine kinase activity [Evidence TAS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0051092 - activation of NF-kappaB transcription factor [Evidence ISS]; GO:0001782 - B cell homeostasis [Evidence IMP]; GO:0007252 - I-kappaB phosphorylation [Evidence TAS]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta product : inhibitor of kappaB kinase beta protein_id : NP_034676.1

name	Plat (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679375 CCDS:CCDS22183.1 GeneID:18791 MGI:97610
definition	GO_component : GO:0045177 - apical part of cell [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0005576 - extracellular region [Evidence IEA]; GO:0005615 - extracellular space [Evidence IDA]; GO:0030141 - secretory granule [Evidence IDA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008243 - plasminogen activator activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IDA] GO_process : GO:0048008 - platelet-derived growth factor receptor signaling pathway [Evidence IDA] [Evidence IMP]; GO:0006508 - proteolysis [Evidence IDA] codon_start : 1 exception : mismatches in translation product : plasminogen activator, tissue protein_id : NP_032898.1

name	Ap3m2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:17505212 CCDS:CCDS22184.1 GeneID:64933 MGI:1929214
definition	GO_component : GO:0030662 - coated vesicle membrane [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : adaptor-related protein complex 3, mu 2 subunit protein_id : NP_083781.1

name	Myst3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487239 GeneID:244349 MGI:2442415
definition	GO_component : GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] [Evidence IDA] GO_function : GO:0016407 - acetyltransferase activity [Evidence ISS]; GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0004402 - histone acetyltransferase activity [Evidence ISS] [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] [Evidence IEA]; GO:0008134 - transcription factor binding [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0035162 - embryonic hemopoiesis [Evidence IMP]; GO:0016573 - histone acetylation [Evidence ISS]; GO:0030099 - myeloid cell differentiation [Evidence ISS]; GO:0016481 - negative regulation of transcription [Evidence ISS]; GO:0006334 - nucleosome assembly [Evidence IEA]; GO:0045941 - positive regulation of transcription [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0035019 - somatic stem cell maintenance [Evidence IMP]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : zinc finger protein 220 product : MYST histone acetyltransferase (monocytic leukemia) 3 protein_id : NP_001074618.1

name	LOC100042253 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258562 GeneID:100042253
definition	codon_start : 1 product : similar to Lsm6 protein protein_id : XP_001477816.1

name	Ank1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13624297 CCDS:CCDS22187.1 GeneID:11733 MGI:88024
definition	GO_component : GO:0016323 - basolateral plasma membrane [Evidence ISS]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008093 - cytoskeletal adaptor activity [Evidence ISS]; GO:0019899 - enzyme binding [Evidence ISS]; GO:0005515 - protein binding [Evidence IEA]; GO:0030507 - spectrin binding [Evidence ISS]; GO:0005200 - structural constituent of cytoskeleton [Evidence ISS] GO_process : GO:0045199 - maintenance of epithelial cell polarity [Evidence ISS]; GO:0015672 - monovalent inorganic cation transport [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : normoblastic anemia product : ankyrin 1, erythroid protein_id : NP_112435.1

name	Nkx6-3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51763993 GeneID:74561 MGI:1921811
definition	codon_start : 1 product : NK6 transcription factor related, locus 3 protein_id : XP_486090.1

name	Agpat6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30520301 CCDS:CCDS22189.1 GeneID:102247 MGI:2142716
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IDA]; GO:0030176 - integral to endoplasmic reticulum membrane [Evidence NAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003841 - 1-acylglycerol-3-phosphate O-acyltransferase activity [Evidence IEA]; GO:0008780 - acyl-[acyl-carrier protein]-UDP-N-acetylglucosamine O-acyltransferase activity [Evidence NAS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0046339 - diacylglycerol metabolism [Evidence IMP]; GO:0006631 - fatty acid metabolism [Evidence IMP]; GO:0002071 - glandular epithelial cell maturation [Evidence IMP]; GO:0007595 - lactation [Evidence IMP]; GO:0008610 - lipid biosynthesis [Evidence IMP]; GO:0030879 - mammary gland development [Evidence IMP]; GO:0040014 - regulation of body size [Evidence IMP]; GO:0019432 - triacylglycerol biosynthesis [Evidence IMP]; GO:0006641 - triacylglycerol metabolism [Evidence IMP] codon_start : 1 note : testis spermatogenesis apoptosis-related protein 7; putative lysophosphatidic acid acyltransferase product : lysophosphatidic acid acyltransferase zeta protein_id : NP_061213.2

name	Gins4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13195660 CCDS:CCDS22190.1 GeneID:109145 MGI:1923847
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] codon_start : 1 product : SLD5 protein_id : NP_077202.1

name	Golga7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:109809747 GeneID:57437 MGI:1931029
definition	GO_component : GO:0000139 - Golgi membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006893 - Golgi to plasma membrane transport [Evidence ISS] codon_start : 1 product : golgi autoantigen, golgin subfamily a, 7 protein_id : NP_001035949.1

name	Golga7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:109809743 GeneID:57437 MGI:1931029
definition	GO_component : GO:0000139 - Golgi membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006893 - Golgi to plasma membrane transport [Evidence ISS] codon_start : 1 product : golgi autoantigen, golgin subfamily a, 7 protein_id : NP_065610.2

name	LOC100041843 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041843
definition	number : 1 pseudo : _no_value

name	LOC100041843 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041843
definition	number : 2 pseudo : _no_value

name	LOC635093 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:635093
definition	number : 1 pseudo : _no_value

name	LOC635093 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:635093
definition	number : 2 pseudo : _no_value

name	LOC100040739 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040739
definition	number : 1 pseudo : _no_value

name	LOC100040739 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040739
definition	number : 2 pseudo : _no_value

name	LOC547006 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:547006
definition	number : 1 pseudo : _no_value

name	LOC547006 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:547006
definition	number : 2 pseudo : _no_value

clone name	MSMg01-237B05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-057K14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-097E18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-480G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-488F13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-362C02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-339J20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-371K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-091K13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-080N19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-507A20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-499C06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-332A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-199H06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-194H24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-164E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-167A21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-537D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-093A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-514C20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052M12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-479O04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-363F24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-460P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-203F14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-098F10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-101I09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-491D10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-349D17
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-517G16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-542J09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-463M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-070J20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-136N06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-514A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-447O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-338M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-144E07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-488J03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-513O02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-539K06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-510L14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-455B05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-111J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-129C19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-347N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471E19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-402I05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-401D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157H02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372D21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-263J24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-495N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-544J23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-452J12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-130A17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-209I17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-080P09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-082P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-270M11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-305P13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-478P15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-407K05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-426O12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-060E18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-366C19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-395L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-160D14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-435B10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-117P05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-087C21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-270D24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-322M18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-473A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-073M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182K16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-008C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156K24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-117O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-185B10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-161M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116H20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-173G14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-096G17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-143A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154N13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139P12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114F02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-312E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-066B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-173J14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-257B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034J02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033P11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-195K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271B12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-192G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272P05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069E24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-063J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287G04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313M10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280M09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-298D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081P10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-223D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262I04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-215K08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-270D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227N01
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-491D10.T7 (MSMg01no491_d10.b1)	MSMg01-491D10.TJ (MSMg01no491_d10.g1)
ACC	AG569261	AG569262
length	743	1,332
length of high quality (start - end)	637 (63 - 699)	---
definition	CHROMAT_FILE: MSMg01no491_d10.b1 PHD_FILE: MSMg01no491_d10.b1.phd.1 CHEM: term DYE: big TIME: Wed May 18 20:15:03 2005	CHROMAT_FILE: MSMg01no491_d10.g1 PHD_FILE: MSMg01no491_d10.g1.phd.1 CHEM: term DYE: big TIME: Wed May 18 20:15:03 2005
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	GCGCTAAACGACNCACATAGGTCGACAATCCGCGGAANCCAAGGAGCCTT GCTATAAACGGCCAGATCCCCCATGTTTACCAAGTCACTGAAAAGACCTT TGGCTGTGGGAGTCACTCCTACCAGGACTTTCTAATACTATTCCACGTGG TGATGAAGTTGCAGAGGCTGCAGTTGAACTGACTCATTGTCTGTAGACAC TTTCTGGAAAGTTGGTGTGTCTCCTGTGAGTGTGATAGCTATGTCATCCT GAGTCCTGCCTGGGTCACAGAACCATTTGACAACCAGGGTTCTGAACTGT ATAATAGTATTATGAGGAAAACTAGCTGAACAATAATTAGAAACAAGCAG ACTTCTTGGATACATTTGCCTTTCCGTTCTGTTGACCACAGATGTAGTGT GACCATCTGTCTCATTCCCCTGCCTCTGTGACTTCCCCACAAAATAGACT GTAGCCTGACATTATAAGCCAAATAAACCCCTTTCTCCCTTAAGTTGCCA TTGTGCACAGTATTTGTCTTAGTTTCATTCTGTTATTGTGATAAGATGAT GTCAGCTTAGAGGGCTCATTATCATAGATCAGCAGATCTATGATAGATCA CAGATCATATCATAGTTCAGGCTCTGTTCTTTGGAGGTCTGTGGTGATGG TCATCATGGTGGGCTGGGTTGTAGAATGCAGCTTCTCACCTCATGGTGGC CTGAGAGCAACACTCCATTAAGATCAAGCCCCAGTGGCCTGCA	TGAGAGAGAATAGAGTAAGGGTCGGTTTTCTCCTTGTTCTCTCTCGNGCT GTGTTCTGGCTGTTGGTTTATTCGTCTTTCCCGTGTAATGAAAAGATGGA TGACCTATTATGTGTGTGTGACGTGATGTGTATGATGTAATGTGTGTATG TGTACGTGTTTGATGTGGATGATCTGATGTGGAGGTATATAGGTGTACGT GTCGTAGTAGATCGTATCGGTAGTTGCTGATGAGTCCGACAAGGAACGTA ACTCAGGACGATGTCGTGCGTGCACTGACGACACTACAGTGTACCATATC NACTCCTTCTCATGCGACTTAGGCTCCGCGATGTGCGCTGTCGCACGCAG TGTCGGTCGATGTGCCATGTATTCTCANTCTTCGTACACCTGCCGTCTCC ACACGTCCCACTGCGACTATCTTCTGAGCGNATCGCGCCGGGTAACAGTG ACATTGTTGCGGCGTAGATAGAGCACGCCGTATACCACTAGTACCGCAGA TTGCGACTATATTATCGTGCTGTGTGTGTGTTGTGTGTAGGGAGTGATTC GTGTTAATGATATATCTCGGTCCATATATTGTCTTGCTTCTATTCTCGTC TAACATTTGTACTCTCTCTACTTATACTCGCCTATCCTCTCTATACTCCT ACACTTCCCTAGTCAATTCCATACTATCCTACTATATCATATCATACTAA CAAGCGCGAGCGCATACAAACATCGTTATACAGTAGCCGATGCTAGAATG ATATGACTTTACATACTCGATGAGCGAAGCAGACAACTCAAGCAGCTACC ACAACCGCCACTACCTCACCATCATCCGAATACGATCGGCTGTATGCTCG ATACCATCTATACCAGCTAGCGACTCCTATTACTAGATCAACCGATATGA TATATATATGATATGATGGCGCGACGTATTGATACGCGTTATGCTCGGTA CTAGAAATATCTATTCGCAACATCCGACAATAGAAGAGTCTAACAGACGC ATGTGCTGNTCTCGTCATTAGTCCTGTGCATAATACACTGGACAATGCCG TGCACAATCTACATGAACTAACACCATCGACTCNTCAAGATCTACTCACA CTCTCTATCCCTGCCTGATCTACTTATCTTATATCATATGTACTATCATA TTCACCACTCATATCAACACGCACAAAGACAGTAGCATAACCGTACGCCG CTNGATGATAGAGTGTAATTTAACCATATCTAACGCTAGTGTTAACCCAG CTATACATATGTGGATACGACGTACAAGACTCATTACATTACATCAGACA TACACTACAAATATGCCGCATGCACAGTTATG
quality values	Open. Hide. 8 8 8 8 8 8 8 10 16 19 27 3 0 3 13 19 17 7 7 9 9 9 6 6 6 6 7 6 8 10 10 11 12 11 27 17 3 0 3 13 15 20 25 25 25 10 7 6 6 6 6 6 6 9 9 12 14 22 21 24 13 13 13 21 26 32 47 53 53 53 57 53 53 53 53 57 57 57 50 53 42 42 42 47 53 68 68 68 68 68 68 68 68 68 68 68 68 68 68 46 44 23 15 11 11 11 18 25 39 43 43 57 57 57 57 57 48 57 57 59 57 57 57 50 50 50 51 50 50 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 43 37 43 43 33 33 37 42 50 50 50 50 57 57 57 57 57 57 54 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 53 53 53 53 53 57 59 59 59 59 59 59 59 57 57 50 53 50 50 39 37 37 30 22 16 11 11 11 16 20 26 34 34 46 59 48 50 53 53 57 57 59 59 59 59 59 59 59 59 59 59 57 57 57 57 48 57 59 59 59 54 54 54 59 59 57 57 57 57 57 57 59 59 57 57 57 57 57 57 59 59 59 59 59 59 47 47 47 59 29 27 12 9 9 7 6 6 6 6 6 8 9 11 18 27 36 47 50 50 50 50 53 53 59 57 57 57 57 57 57 57 50 50 50 53 48 57 48 57 57 43 40 37 22 22 17 19 22 37 40 57 59 59 59 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 68 57 57 57 57 59 68 68 68 68 68 68 68 68 57 57 57 57 68 68 68 68 68 68 57 59 52 52 52 57 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 57 57 57 54 54 57 59 59 57 57 57 57 57 57 59 54 59 59 57 57 57 57 57 68 68 57 57 57 57 54 59 59 50 50 54 57 59 57 57 57 48 57 57 59 59 68 68 68 68 68 68 68 68 59 59 59 59 59 68 59 68 68 57 57 57 57 57 59 59 57 57 57 48 57 54 54 54 54 59 59 54 59 59 43 43 47 46 57 57 57 57 57 54 54 54 57 48 48 48 48 48 48 48 57 57 57 44 44 40 37 37 39 39 36 37 39 48 47 47 43 43 35 35 35 32 36 44 59 59 35 35 36 43 39 48 48 39 39 35 35 43 43 48 43 43 43 36 36 43 43 48 57 59 57 57 57 57 57 57 57 43 43 43 43 43 48 48 48 34 34 25 28 28 34 28 37 39 39 31 36 32 32 26 29 32 39 47 37 30 28 28 30 27 36 41 41 41 37 37 30 34 21 26 14 13 13 24 24 24 28 24 29 29 32 36 37 37 37 32 30 25 25 35 28 31 39 41 41 37 37 36 34 24 21 21 16 15 15 28 26 24 26 21 28 27 25 25 27 33 30 30 25 27 32 32 32 19 13 11 11 11 16 20 21 22 24 12 22 22 28 21 19 12 14 12 20 19 21 19 24 24 28 19 14 12 12 16 12 8 8 7 7 7 12 14 30 37 15 11 11 11 10 18 24 24 19	Open. Hide. 6 6 8 8 8 6 6 7 8 8 8 8 8 8 8 6 7 6 6 6 6 9 8 8 8 8 10 6 6 8 8 8 6 6 6 6 6 10 7 7 7 6 6 6 9 3 0 3 9 6 6 6 6 8 6 6 7 7 8 6 8 6 6 6 6 8 8 10 6 6 8 8 8 8 8 8 6 6 6 6 7 6 9 9 9 8 8 8 8 8 8 8 8 6 6 6 6 8 6 6 6 6 8 8 10 10 10 10 10 10 10 8 11 8 8 8 8 8 8 8 8 8 8 8 8 8 8 12 9 9 8 8 8 8 8 8 8 8 6 8 6 6 6 6 6 6 6 9 10 10 8 8 6 6 6 6 6 10 8 8 6 6 8 6 8 10 8 10 10 19 17 11 11 10 8 8 6 6 8 8 8 6 6 8 8 10 8 8 6 6 6 6 8 8 8 10 11 10 8 8 8 8 8 8 8 8 8 8 8 8 8 9 9 8 8 6 10 6 6 8 6 8 8 8 8 8 8 8 10 6 8 8 8 8 6 6 6 6 6 6 6 6 6 6 6 8 10 8 8 8 8 6 6 6 6 8 8 10 10 11 11 10 10 10 10 10 10 11 11 10 6 6 6 6 6 6 9 8 8 8 7 6 7 6 8 8 8 8 8 8 8 8 6 6 8 8 10 10 10 3 0 3 6 6 8 8 8 10 8 8 8 8 9 10 9 9 9 9 7 7 7 8 8 8 11 8 8 6 6 8 6 6 10 8 8 6 6 8 8 10 10 10 10 9 7 8 8 8 8 6 6 6 6 6 6 8 8 8 8 17 17 22 15 10 10 8 6 6 8 6 6 10 8 10 10 10 3 0 3 6 8 6 6 6 8 10 10 7 7 7 7 7 7 7 11 10 12 8 8 6 6 6 6 8 6 6 6 6 6 8 8 8 8 10 8 8 6 6 6 6 10 10 10 8 8 10 8 8 8 3 0 3 10 13 14 18 12 12 10 8 8 8 8 8 6 6 8 8 8 6 6 8 6 8 8 8 8 6 7 6 6 6 6 8 8 11 10 10 10 10 8 8 6 6 8 8 9 9 9 9 10 13 8 8 8 8 9 9 9 9 13 21 11 8 6 6 6 6 8 8 8 8 8 8 8 8 10 8 9 10 9 9 9 6 6 6 7 6 8 8 8 8 8 8 8 8 8 9 9 11 13 13 17 13 11 8 8 10 9 8 8 8 8 10 8 8 8 8 8 8 10 12 6 6 6 6 6 6 8 8 8 10 8 10 10 10 11 11 11 13 11 10 9 10 8 6 6 6 6 6 6 8 8 12 10 8 8 7 10 6 6 8 6 11 11 11 12 12 12 10 8 8 6 6 6 6 6 6 6 8 8 10 15 13 10 10 11 8 8 6 6 8 10 9 9 9 8 10 8 8 8 8 9 9 11 18 10 8 8 8 8 8 8 8 8 12 12 8 8 8 6 6 6 6 6 6 9 6 6 6 6 6 6 10 10 6 6 6 6 8 8 8 12 8 10 10 10 9 9 9 10 10 13 16 10 10 9 9 9 10 6 8 6 6 8 8 8 8 8 10 10 10 10 10 10 10 10 11 8 8 8 8 8 8 10 10 11 11 8 8 8 8 8 8 9 10 10 10 10 8 6 6 6 6 8 8 8 8 8 10 10 11 11 11 10 8 8 6 6 6 6 9 10 9 9 9 7 6 8 8 8 8 8 15 11 10 9 9 10 8 12 10 10 10 10 12 6 7 7 7 6 8 6 6 6 8 8 10 8 8 8 8 8 8 6 6 8 7 6 8 8 6 6 6 6 9 6 6 6 6 6 6 9 11 13 8 8 7 7 8 8 8 8 8 8 8 10 10 8 9 9 10 9 9 8 8 8 8 8 8 8 9 9 9 9 10 10 10 10 10 10 10 8 8 6 6 8 8 10 10 13 12 10 10 8 8 7 8 8 8 8 8 6 6 6 6 6 6 6 6 8 6 6 6 6 8 6 6 6 8 8 6 7 6 6 6 8 8 6 6 8 6 6 6 6 6 6 6 10 10 10 10 10 10 10 10 10 10 8 8 10 6 6 8 8 8 6 6 6 6 8 13 11 12 10 10 9 9 10 8 8 8 8 8 8 10 8 10 8 8 8 6 6 7 10 8 11 13 10 10 10 9 9 9 8 8 8 8 8 8 8 8 8 8 8 8 8 10 10 10 9 10 10 8 8 9 9 8 8 8 6 6 8 6 8 8 8 8 8 8 8 8 6 6 8 6 8 3 0 3 8 8 8 8 8 8 8 8 6 8 6 6 8 10 8 8 8 8 8 15 19 9 9 8 8 6 6 8 6 6 8 6 8 8 8 8 8 8 8 8 8 8 8 8 10 10 9 9 9 8 6 8 8 8 6 6 6 6 8 10 10 10 6 6 6 6 8 8 9 9 13 13 3 0 3 10 10 10 10 10 11 10 10 9 9 10 8 7 9 9 7 10 10 9 9 9 8 11 8 8 8 10 6 6 6 6 6 6 10 10 10 9 7 14 8 9 8 7 6 6 6 10 10 8 9 9 10 12 8 6 6 6 6 6 6 8 8 8 10 7 7 6 6 8 8 8 8 8 8 8 8 8 10 10 10 8 8 8 10 10 10 10 10 9 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 6 3 0 3 8 10 10 8 8 9 9 9 8 10 8 8 6 6 6 8 8 6 6 7 8 8 8 15 11 6 6 6 13 10 15 12 10 8 8 8 6 6 6 6 6 6 6 8 8 8 8 8 6 6 6 6 11 8 6 6 8 8 10 8 8 8 8 10 10 8 8 9 8 8 8 8 8 8 6 6 6 8 6 6 8 6 6 6 6 8 8 8 9 9 9 9 9 10 10 10 10 6 6 6 6 8 10 8 8 8 7 8 8 8 8 8 9 8 6 6 6 6 8 8 7 8 6 6 6 6 6 6

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no491_d10.b1 MSMg01no491_d10.b1 CHROMAT_FILE:
MSMg01no491_d10.b1 PHD_FILE: MSMg01no491_d10.b1.phd.1 CHEM: term DYE:
big TIME: Wed May 18 20:15:03 2005
         (637 letters)



>mm_chr8_23512950_23513986
          Length = 1037

 Score = 1079 bits (558), Expect = 0.0
 Identities = 610/636 (95%), Gaps = 15/636 (2%)
 Strand = Plus / Plus

                                                                       
Query: 1   cagatcccccatgtttaccaagtcactgaaaagacctttggctgtgggagtcactcctac 60
           |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 201 cagatcccccatgtttaccaagtcactgaaaagacctttggcagtgggagtcactcctac 260

                                                                       
Query: 61  caggactttctaatactattccacgtggtgatgaagttgcagaggctgcagttgaactga 120
           |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 261 caggacttcctaatactattccacgtggtgatgaagttgcagaggctgcagttgaactga 320

                                                                       
Query: 121 ctcattgtctgtagacactttctggaaagttggtgtgtctcctgtgagtgtgatagctat 180
           ||||             |||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 321 ctca-------------ctttctggaaagttggtgtgtctcctgtgagtgtgatagcaat 367

                                                                       
Query: 181 gtcatcctgagtcctgcctgggtcacagaaccatttgacaaccagggttctgaactgtat 240
           ||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 368 gtggtcctgagtcctgcctgggtcacagaaccatttgacaaccagggttctgaactgtat 427

                                                                       
Query: 241 aatagtattatgaggaaaactagctgaacaataattagaaacaagcagacttcttggata 300
           |||||||  | |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 428 aatagtaagaggaggaaaactagctgaacaataattagaaacaagcagacttcttggata 487

                                                                       
Query: 301 catttgcctttccgttctgttgaccacagatgtagtgtgaccatctgtctcattcccctg 360
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 488 catttgcctttccgttctgttgaccacagatgtagtgtgaccatctgtctcattctcctg 547

                                                                       
Query: 361 cctctgtgacttccccacaaaatagactgtagcctgacattataagccaaataaacccct 420
           ||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||
Sbjct: 548 cctctgtgacttccccacaaaatagact--agcctgacattataagccaaataaacccct 605

                                                                       
Query: 421 ttctcccttaagttgccattgtgcacagtatttgtcttagtttcattctgttattgtgat 480
           ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 606 ttctcccttaagttgccgttgtgcacagtatttgtcttagtttcattctgttattgtgat 665

                                                                       
Query: 481 aagatgatgtcagcttagagggctcattatcatagatcagcagatctatgatagatcaca 540
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 666 aagatgatgtcagcttagagggctcattatcatagatcagcagatctatgatagatcaca 725

                                                                       
Query: 541 gatcatatcatagttcaggctctgttctttggaggtctgtggtgatggtcatcatggtgg 600
           |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 726 gatcatatcatagttcaggctcagttctttggaggtctgtggtgatggtcatcatggtgg 785

                                               
Query: 601 gctgggttgtagaatgcagcttctcacctcatggtg 636
           ||||||||||||||||||||||||||||||||||||
Sbjct: 786 gctgggttgtagaatgcagcttctcacctcatggtg 821


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 32
Number of extensions: 3
Number of successful extensions: 3
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 637
Length of database: 1037
Length adjustment: 10
Effective length of query: 627
Effective length of database: 1027
Effective search space:   643929
Effective search space used:   643929
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information