MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-190I09
Chromosome	9 (Build37)
Map Location	22,615,675 - 22,805,586
singlet/doublet	doublet
Overlap gene	Bbs9
Upstream gene	Dock6, EG624219, Rab3d, BC010787, 2510048L02Rik, BC018242, 2310047B19Rik, Epor, Rgl3, C330001K17Rik, Prkcsh, Elavl3, Zfp653, Ecsit, EG625409, Cnn1, Elof1, Acp5, Pigyl, LOC100034724, 9530015I07Rik, 1810064F22Rik, Zfp809, BC050092, Zfp810, LOC100041826, EG625603, Anln, 9530077C05Rik, rp9, LOC100041870, LOC100040805
Downstream gene	Bmper, LOC100040866, LOC100040878, LOC100040893
Link	Open Mouse BAC browser

Click to get alignment info.

name	Dock6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319899 MGI:1914789
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG624219 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:624219 MGI:3643534
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rab3d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19340 MGI:97844
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC010787 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235043 MGI:3045495
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2510048L02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67119 MGI:1914369
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC018242 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235044 MGI:2384575
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310047B19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66962 MGI:1914212
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 64 ESTs, 1 Protein

name	Epor (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13857 MGI:95408
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rgl3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71746 MGI:1918996
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C330001K17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77609 MGI:1924859
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prkcsh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19089 MGI:107877
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Elavl3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15571 MGI:109157
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp653 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319601 MGI:2442362
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ecsit (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26940 MGI:1349469
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG625409 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:625409 MGI:3648298
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 73 ESTs, 3 Proteins pseudo : _no_value

name	Cnn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12797 MGI:104979
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Elof1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66126 MGI:1913376
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Acp5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11433 MGI:87883
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pigyl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66268 MGI:1913518
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100034724 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100034724
definition	note : ribosomal protein L15 pseudogene pseudo : _no_value

name	9530015I07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:619310 MGI:3588272
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1810064F22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69862 MGI:1917112
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp809 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235047 MGI:2143362
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC050092 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235048 MGI:2679006
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp810 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235050 MGI:2384563
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041826 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041826
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 836 ESTs, 11 Proteins

name	EG625603 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:625603 MGI:3645371
definition	note : predicted gene, EG625603 pseudo : _no_value

name	Anln (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68743 MGI:1920174
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9530077C05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68283 MGI:1915533
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	rp9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:55934 MGI:2157166
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041870 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041870
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Bbs9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319845 MGI:2442833
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040805 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040805
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 ESTs, 12 Proteins pseudo : _no_value

name	Bmper (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73230 MGI:1920480
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040866 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040866
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	LOC100040878 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040878
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	LOC100040893 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040893
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Dock6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124301207 GeneID:319899 MGI:1914789
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dedicator of cytokinesis 6 transcript_id : NM_177030.3

name	EG624219 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124301203 GeneID:624219 MGI:3643534
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG624219 transcript_id : NM_001080940.1

name	Rab3d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893108 GeneID:19340 MGI:97844
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB3D, member RAS oncogene family transcript_id : NM_031874.4

name	BC010787 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119360290 GeneID:235043 MGI:3045495
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC010787 transcript_id : NM_178577.4

name	2510048L02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142359878 GeneID:67119 MGI:1914369
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2510048L02 gene transcript_id : NM_025977.2

name	BC018242 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450346 GeneID:235044 MGI:2384575
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC018242 transcript_id : NM_144935.1

name	2310047B19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149259874 GeneID:66962 MGI:1914212
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 64 ESTs, 1 Protein product : RIKEN cDNA 2310047B19 gene transcript_id : XM_150151.7

name	Epor (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116292185 GeneID:13857 MGI:95408
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : erythropoietin receptor transcript_id : NM_010149.3

name	Rgl3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802998 GeneID:71746 MGI:1918996
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ral guanine nucleotide dissociation stimulator-like 3 transcript_id : NM_023622.3

name	C330001K17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351924 GeneID:77609 MGI:1924859
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C330001K17 gene transcript_id : NM_029939.2

name	Prkcsh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679464 GeneID:19089 MGI:107877
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein kinase C substrate 80K-H transcript_id : NM_008925.1

name	Elavl3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328052 GeneID:15571 MGI:109157
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C) transcript_id : NM_010487.1

name	Zfp653 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31341137 GeneID:319601 MGI:2442362
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 653 transcript_id : NM_177318.2

name	Ecsit (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755521 GeneID:26940 MGI:1349469
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ECSIT homolog (Drosophila) transcript_id : NM_012029.1

name	Cnn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347862 GeneID:12797 MGI:104979
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calponin 1 transcript_id : NM_009922.3

name	Elof1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254323 GeneID:66126 MGI:1913376
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : elongation factor 1 homolog (ELF1, S. cerevisiae) transcript_id : NM_170777.3

name	Acp5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131000 GeneID:11433 MGI:87883
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acid phosphatase 5, tartrate resistant transcript_id : NM_007388.2

name	Pigyl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126722948 GeneID:66268 MGI:1913518
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatidylinositol glycan anchor biosynthesis, class Y-like transcript_id : NM_001082532.1

name	9530015I07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386406 GeneID:619310 MGI:3588272
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9530015I07 gene transcript_id : NM_001033813.2

name	1810064F22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369702 GeneID:69862 MGI:1917112
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1810064F22 gene transcript_id : NM_001033151.2

name	Zfp809 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70778878 GeneID:235047 MGI:2143362
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 809 transcript_id : NM_172763.2

name	BC050092 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31340882 GeneID:235048 MGI:2679006
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC050092 transcript_id : NM_181419.2

name	Zfp810 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130189 GeneID:235050 MGI:2384563
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 810 transcript_id : NM_145612.2

name	LOC100041826 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149259880 GeneID:100041826
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 836 ESTs, 11 Proteins product : similar to high mobility group nucleosomal binding domain 2 transcript_id : XM_001477164.1

name	Anln (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142380043 GeneID:68743 MGI:1920174
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : anillin, actin binding protein (scraps homolog, Drosophila) transcript_id : NM_028390.2

name	9530077C05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46810272 GeneID:68283 MGI:1915533
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9530077C05 gene transcript_id : NM_026739.1

name	rp9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9055299 GeneID:55934 MGI:2157166
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : retinitis pigmentosa 9 (human) transcript_id : NM_018739.1

name	LOC100041870 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149259882 GeneID:100041870
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : hypothetical protein LOC100041870 transcript_id : XM_001477212.1

name	Bbs9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37620184 GeneID:319845 MGI:2442833
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Bardet-Biedl syndrome 9 transcript_id : NM_181316.3

name	Bmper (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24371215 GeneID:73230 MGI:1920480
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : BMP-binding endothelial regulator transcript_id : NM_028472.1

name	Dock6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124301208 GeneID:319899 MGI:1914789
definition	codon_start : 1 product : dedicator of cytokinesis 6 protein_id : NP_796004.2

name	EG624219 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124301204 GeneID:624219 MGI:3643534
definition	codon_start : 1 product : hypothetical protein LOC624219 protein_id : NP_001074409.1

name	Rab3d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15042957 CCDS:CCDS22912.1 GeneID:19340 MGI:97844
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0042588 - zymogen granule [Evidence IDA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] [Evidence IPI] GO_process : GO:0006887 - exocytosis [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0017157 - regulation of exocytosis [Evidence IDA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : RAB3D, member RAS oncogene family protein_id : NP_114080.2

name	BC010787 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982159 CCDS:CCDS22913.1 GeneID:235043 MGI:3045495
definition	codon_start : 1 product : hypothetical protein LOC235043 protein_id : NP_848692.2

name	2510048L02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385476 GeneID:67119 MGI:1914369
definition	GO_function : GO:0000175 - 3'-5'-exoribonuclease activity [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006396 - RNA processing [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC67119 protein_id : NP_080253.1

name	BC018242 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450347 GeneID:235044 MGI:2384575
definition	codon_start : 1 product : lipid phosphate phosphatase-related protein type 2 protein_id : NP_659184.1

name	2310047B19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38089739 GeneID:66962 MGI:1914212
definition	codon_start : 1 product : hypothetical protein LOC66962 protein_id : XP_150151.2

name	Epor (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116292186 CCDS:CCDS22915.1 GeneID:13857 MGI:95408
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004896 - hematopoietin/interferon-class (D200-domain) cytokine receptor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004888 - transmembrane receptor activity [Evidence IEA] codon_start : 1 product : erythropoietin receptor protein_id : NP_034279.3

name	Rgl3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982627 CCDS:CCDS22916.1 GeneID:71746 MGI:1918996
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0008321 - Ral guanyl-nucleotide exchange factor activity [Evidence IDA]; GO:0017016 - Ras GTPase binding [Evidence IDA] GO_process : GO:0051056 - regulation of small GTPase mediated signal transduction [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence TAS] codon_start : 1 function : putative guanine nucleotide exchange factor for the small GTPase Ral note : Ral guanine-nucleotide exchange factor; ral guanine nucleotide dissociation stimulator like 3 product : RalGDS-like protein 3 protein_id : NP_076111.2

name	C330001K17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037495 CCDS:CCDS22917.1 GeneID:77609 MGI:1924859
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC77609 protein_id : NP_084215.1

name	Prkcsh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679465 CCDS:CCDS22918.1 GeneID:19089 MGI:107877
definition	GO_component : GO:0017177 - alpha-glucosidase II complex [Evidence IPI]; GO:0005783 - endoplasmic reticulum [Evidence TAS] GO_function : GO:0004558 - alpha-glucosidase activity [Evidence IPI]; GO:0016301 - kinase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006491 - N-glycan processing [Evidence TAS] codon_start : 1 note : alpha glucosidase II, beta-subunit; glucosidase II beta-subunit; carbohydrate processing enzyme of the endoplasmic reticulum product : protein kinase C substrate 80K-H protein_id : NP_032951.1

name	Elavl3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328053 GeneID:15571 MGI:109157
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007399 - nervous system development [Evidence IEA] codon_start : 1 note : HU-antigen C product : ELAV-like protein 3 protein_id : NP_034617.1

name	Zfp653 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789439 CCDS:CCDS22919.1 GeneID:319601 MGI:2442362
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : Zip67 product : zinc finger protein Zip67 protein_id : NP_796292.1

name	Ecsit (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755522 CCDS:CCDS22920.1 GeneID:26940 MGI:1349469
definition	GO_component : GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0003702 - RNA polymerase II transcription factor activity [Evidence IDA]; GO:0004871 - signal transducer activity [Evidence IDA]; GO:0003700 - transcription factor activity [Evidence IDA] GO_process : GO:0030509 - BMP signaling pathway [Evidence IDA]; GO:0001707 - mesoderm formation [Evidence IMP]; GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0007178 - transmembrane receptor protein serine/threonine kinase signaling pathway [Evidence IPI] [Evidence IDA] codon_start : 1 note : signaling intermediate in Toll pathway-evolutionarily conserved product : evolutionarily conserved signaling intermediate in Toll pathway protein_id : NP_036159.1

name	Cnn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560611 CCDS:CCDS22921.1 GeneID:12797 MGI:104979
definition	GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA] GO_process : GO:0031032 - actomyosin structure organization and biogenesis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : calponin h1 product : calponin 1 protein_id : NP_034052.2

name	Elof1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:25140989 GeneID:66126 MGI:1913376
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : elongation factor 1 homolog (ELF1, S. cerevisiae) protein_id : NP_740747.1

name	Acp5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680624 CCDS:CCDS22923.1 GeneID:11433 MGI:87883
definition	GO_component : GO:0005764 - lysosome [Evidence IEA] GO_function : GO:0003993 - acid phosphatase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 note : acid phosphatase type V product : acid phosphatase 5, tartrate resistant protein_id : NP_031414.1

name	Pigyl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126722949 GeneID:66268 MGI:1913518
definition	codon_start : 1 note : phosphatidylinositol N-acetylglucosaminyltransferase subunit Y product : phosphatidylinositol glycan anchor biosynthesis, class Y-like protein_id : NP_001076001.1

name	9530015I07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702145 GeneID:619310 MGI:3588272
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC619310 protein_id : NP_001028985.1

name	1810064F22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701662 GeneID:69862 MGI:1917112
definition	GO_component : GO:0019028 - viral capsid [Evidence IEA] GO_function : GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC69862 protein_id : NP_001028323.1

name	Zfp809 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70778879 GeneID:235047 MGI:2143362
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc finger protein 809 protein_id : NP_766351.2

name	BC050092 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31088880 GeneID:235048 MGI:2679006
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC235048 protein_id : NP_852084.1

name	Zfp810 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704232 GeneID:235050 MGI:2384563
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger protein ZFP protein_id : NP_663587.1

name	LOC100041826 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149259881 GeneID:100041826
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477214.1

name	Anln (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22507319 CCDS:CCDS22927.1 GeneID:68743 MGI:1920174
definition	GO_component : GO:0015629 - actin cytoskeleton [Evidence ISS]; GO:0005826 - contractile ring [Evidence ISS]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence ISS] [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0000910 - cytokinesis [Evidence ISS]; GO:0007067 - mitosis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : anillin protein_id : NP_082666.1

name	9530077C05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46810273 GeneID:68283 MGI:1915533
definition	codon_start : 1 product : hypothetical protein LOC68283 protein_id : NP_081015.1

name	rp9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9055300 GeneID:55934 MGI:2157166
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005785 - signal recognition particle receptor complex [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : Pim-1 associated protein product : retinitis pigmentosa 9 homolog protein_id : NP_061209.1

name	LOC100041870 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149259883 GeneID:100041870
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477262.1

name	Bbs9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37620185 CCDS:CCDS22928.1 GeneID:319845 MGI:2442833
definition	codon_start : 1 note : EST 3159894; parathyroid hormone-responsive B1 product : Bardet-Biedl syndrome 9 protein_id : NP_851833.2

name	Bmper (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24371216 CCDS:CCDS22929.1 GeneID:73230 MGI:1920480
definition	GO_component : GO:0005576 - extracellular region [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0030514 - negative regulation of BMP signaling pathway [Evidence IDA] codon_start : 1 note : crossveinless-2; crossveinless 2 homolog product : crossveinless 2 protein_id : NP_082748.1

name	LOC100040866 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040866
definition	number : 1 pseudo : _no_value

name	LOC100040866 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040866
definition	number : 2 pseudo : _no_value

name	LOC100040866 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040866
definition	number : 3 pseudo : _no_value

name	LOC100040878 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040878
definition	number : 1 pseudo : _no_value

name	LOC100040893 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040893
definition	number : 1 pseudo : _no_value

name	LOC100040893 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040893
definition	number : 2 pseudo : _no_value

name	LOC100040893 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040893
definition	number : 3 pseudo : _no_value

name	LOC100040893 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040893
definition	number : 4 pseudo : _no_value

name	LOC100040893 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040893
definition	number : 5 pseudo : _no_value

name	EG625409 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149259877 GeneID:625409 MGI:3648298
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 73 ESTs, 3 Proteins product : predicted gene, EG625409 pseudo : _no_value transcript_id : XR_001828.2

name	LOC100040805 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149259845 GeneID:100040805
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 ESTs, 12 Proteins product : similar to ribosomal protein L7a pseudo : _no_value transcript_id : XR_032174.1

clone name	MSMg01-439I14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-119B13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-438L19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095O17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-401F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-192J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-501E05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-105D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-490K10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381A01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-498N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-489N03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-056F01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-498J01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-149L16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-499I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-136F22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-046M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-046M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-405K05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-391D09
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-426I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-288O17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-266I16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-350E10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-426H20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342F06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-264M13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-267L03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-112C12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-355G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-327L17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-115I10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-385J01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-204A24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-083I02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-087M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-278B20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-367C17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-403N11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-185P15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-432J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-180F17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-342B10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-462G05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-457E07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-500D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-499P18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-496L05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-312H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-293N23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-304P22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505H21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-188O19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-268I07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-124B08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-084G22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-467M20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-339D15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-274J03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-374A17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-204O06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-136N05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-144C02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-231N08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-068N03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-135N11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-478E23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-521N08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-145B11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-274F06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-069D19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-525O21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-477H23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-268J18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-117D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-492K19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-420D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-529L20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-308M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390H08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-136O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-465F15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-337J15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-436M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-158I13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-188H17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-237G18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-195J14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-072H18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-364G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-498E03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-146C03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-538N24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-520I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-110I02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-404H16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-201L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-144O14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-432A23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-334O12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-104C18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-266D14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-278I15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-544C08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-544O06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-544C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023K16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075F16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308E14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287D20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329O12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181M10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-161M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112E10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-115J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088J06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073D21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187F06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-219K23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209O23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-257D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068J05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012G22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-014N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216M02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-082B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067D13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241A19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-185J07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-319M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314K01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238P18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071M24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241D10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061F08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-057H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237N06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-219M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084I04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-018C08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155G07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017G24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-141L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206E17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-312F23
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-190I09.b	B6Ng01-190I09.g
ACC	GA014258	GA014259
length	1,208	1,134
definition	B6Ng01-190I09.b	B6Ng01-190I09.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(22,804,386 - 22,805,586)	(22,615,675 - 22,616,820)
sequence	gaattcttttactcctggctaagagtaagtatcattaaaccatccctggg ggctgtttctttttcttctctatccaacattccataaaacaaaagccagt taatctgtgaatttctaccctcctccaataccatttttaatagacaaaca gtcccctgggttccccaaattccttccctggcagcacagatggaagtgga tagctaagatgtaagagcaaaccttgctaggctctcctccactgggaccc agaaggcagagctgggtagatgtattcgtttgctgaggctgctgtaacaa aaaaccctgactgattagctgaaaccacagagctacagtgagagtcctga gaaccctgagggaagggtgtgttccaggctatgtctttatattctacctt ctttctttgatagagtgtgtttaaattcacctttcgactctgaaatctgg tctgggaagttggcactagcctctgaaaacatgaataaatatcagctcca tcatattatccccattaacacactgtctagaaatggtatgcaaatgtaga gagagagtgtcacctctgtcccctccctggaagtgatttttctcaagcat atagtctcccaaaccaatgtagtcatgttacaaaatagtgtcctgacaca catgacacctcacttgtttttagtgaacttaacactgagctaaaaggaga aagaagccggacagatggcagtaaggcagagaagtagctgcttcggtgtg agttgcagtctgccgcttggcaagatggaaatgttccctatttggggctc attttcagttcagcacatgcacatcacttcctgggtacccctcattagag tctctcctcagaagccacctctctgcctcactagcaacatgagctctctg cctgctgcccacctccccagcaccctgtctttttgatatggccattgccc ccttgctgatagtatcctcaaaaacctgaatccttgaagagagaggccat gttttatgacagcagacctggcgaaaacaaagaagagtgcttgtctatgt gcagtaacagcagaaccatcaaacttcaatggtggtaaacaactgagctg tccttatgggagcagaaaagcaacgacccccacccccccacccttctttt cctggagatccagttttcttgtaaaatgtctacccaaatgccatctatcc ctgttaat	gaattcctcttgaaaggattctcaggttcagttttctttttcctaatttg ctggtggcatctattacagggagatagaaatgggtcaatggaatcaaaag tcttggtttactgtttatggcagtcagagggaagctccctggtgggtata gagagactctggactttggtttaagaaccaactctatgtgcctggaagga atgaggaaggaccctgagctgtgtagtcattgcgcatccagagctcagtt cagctaccaatagagcagagataaccagaggcttgtaggtaggactccta ggaagcaggaggcaagtgccctcctaactttaacgccttacaccctctgt caggaagaccttactcagttatccttaagttgcttttatgggctcttcct gccatacagcctttacttcttgagcctgccagtttggtccctttggcact agtacagtgtgctgctgctgtctttgctggcgctgaggtcccagtgcagc agtgatgttcctaggattgcagcctccacattttaaggtgacaccacatt tcctggggtctttactgtagctcatacaattgctccgaagaaaaatggga caaattttgtaccattatttttgccacatgatactgaagtggaactagat agatccttagagctcccaaaatccctctggagaccagcactatcagattt tgtcaagactatggctcaaggagctgaaatgtcagtatcttctctccatc ccaggtgcccctgctgtatctagggcttctgtaagggccagatccttttc tgcagactgtaaggcagaagaagggacactcctggtagttaagccaccag atcatcaaacaggcctgcactgggggattgatcttatcactgtgtttcct attcctggcaccaggacaaagcacttcccacatgtggactcatccaattg cctcagtccttggggggaggcagtcaaaagaactagtagctcactacctg aaaaccttgctaacgcctcctcgtacagtacagtcctttggcctgctgtc atttgtttacaattccaaattggcttgccacacaggctggaagaacgtga tgctgccattgctaccttttgaaactgccctgtc
quality values	Open. Hide. 46 41 21 33 62 62 62 62 62 41 51 62 62 62 62 62 62 49 62 59 56 62 62 62 62 62 62 62 62 62 62 59 30 26 25 23 25 25 28 28 27 23 43 34 34 50 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 59 62 59 49 54 43 54 54 26 54 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 54 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 54 54 62 62 62 62 59 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 59 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 54 58 58 58 58 54 58 58 58 58 58 54 54 58 58 58 58 54 58 58 58 58 58 58 58 58 54 58 42 45 58 58 58 58 58 58 58 39 58 52 54 54 58 54 58 58 58 58 58 58 58 58 58 46 54 58 54 25 38 58 58 58 52 58 52 54 54 52 54 58 54 51 42 51 50 58 49 48 50 51 54 58 58 53 54 58 54 58 49 46 46 54 50 53 40 58 58 58 50 46 42 58 58 47 40 52 58 58 58 50 58 58 58 50 52 53 51 51 51 50 37 58 52 46 47 43 50 50 58 50 58 30 58 41 37 58 58 51 37 58 51 26 51 58 43 24 40 58 24 40 58 50 58 40 27 52 53 51 37 44 39 28 53 52 40 38 50 37 58 25 52 39 58 31 58 58 18 52 50 32 52 51 50 41 35 32 42 33 51 32 53 38 37 51 27 40 46 45 32 39 41 29 53 47 42 31 51 41 33 49 26 44 49 32 34 39 40 45 32 49 25 24 54 29 37 42 17 25 24 54 40 33 52 38 54 54 31 54 54 41 21 49 29 34 39 54 54 26 20 31 39 42 53 34 32 23 52 37 34 29 32 33 32 23 42 29 53 33 32 30 42 42 32 41 31 31 51 53 31 33 32 52 49 32 45 32 29 34 33 35 32 53 31 32 32 30 30 30 26 31 26 31 26 16 51 45 31 31 30 29 16 33 40 30 31 32 31 37 24 39 30 29 24 31 29 33 24 26 20 28 20 28 42 38 32 32 32 36 31 31 33 32 37 31 32 31 37 34 34 31 18 41 46 29 32 42 42 28 46 46 27 25 35 32 31 31 47 31 29 41 31 27 33 46 48 46 25 23 31 23 30 29 32 33 14 27 29 41 26 31 37 46 46 46 23 31 31 37 28 33 26 16 11 16 21 31 23 31 21 25 19 21 23 48 44 44 12 21 12 31 31 30 26 34 26 30 17 18 20 33 30 11 31 7 27 16 26 19 31 16 26 10 13 29 11 48 44 29 13 10 7 14 19 10 10 22 19 9 33 14 23 34 15 19 15 9 14 6 5 5 13 9 48 33 20 19 30 6 9 6 14 30 15 33 9 11 11 22 6 7 6 8 10 8 14 16 11 16 28 14 19 7 22 14 7 6 10 27 9 19 15 26 15 11 12 10 3 8 20 16 13 18 16 23 5 3 12 18 15 21 28 19 15 9 5 6 7 10 9 5 6 14 28 26 10 15 15 29 7 11 10 22 13 8 5 15 6 5 20 32 32 15 10 12 5 4 6 6 16 5 21 17 25 5 4 10 22 25 24 14 24 16 4 5 9 10 7 5 12 4 17 19 8 16 14 4 5 7 12 4 5 10 8 11 6 3 12 17 17 13 5 4 4 5 7 10 29 29 12 1 3 8 8 12 9 18 9 6 1 5 3 6 8 6 6 2 2 9 7 11 4 9 8 8 5 9 4 3 4 1 8	Open. Hide. 62 47 56 47 62 62 62 62 62 62 43 43 22 22 22 22 32 24 29 45 38 38 28 35 56 62 62 62 59 59 62 62 62 62 62 62 62 54 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 51 49 54 54 33 54 54 54 62 62 59 62 62 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 62 62 62 42 54 62 62 42 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 59 62 62 62 54 62 62 62 62 59 59 62 62 62 59 59 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 42 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 49 54 62 62 62 62 62 62 62 58 58 45 38 58 58 58 54 58 58 58 58 54 58 52 58 58 58 58 58 43 46 58 58 58 54 58 54 50 54 58 58 52 58 58 58 58 58 54 58 58 58 58 58 58 54 58 54 58 54 52 54 58 58 52 58 52 58 58 54 54 58 58 54 52 58 58 58 58 58 58 58 58 50 58 58 46 58 58 54 58 47 42 58 58 58 51 49 52 58 58 53 58 58 58 58 52 50 38 24 37 58 45 53 51 58 58 58 58 45 31 49 35 51 50 58 58 54 52 53 52 58 58 58 49 50 49 58 40 58 51 50 52 42 51 39 35 50 50 37 37 50 54 50 48 54 53 58 53 58 54 52 58 50 39 58 58 51 50 50 44 44 51 50 50 51 58 47 24 35 30 40 34 50 53 52 53 51 52 53 45 53 40 31 13 58 58 58 51 38 45 31 45 45 46 31 52 45 52 35 46 37 53 42 45 37 41 51 39 29 52 51 52 46 54 47 53 54 31 41 40 32 42 39 52 53 51 45 53 52 42 34 26 32 18 42 29 54 34 35 17 54 33 33 10 35 42 39 24 37 40 45 45 32 25 38 33 33 32 32 54 41 32 47 24 31 32 47 24 33 40 30 51 41 23 30 32 24 35 18 19 31 18 49 49 47 40 40 41 28 28 10 52 33 33 42 31 32 33 42 51 21 43 21 42 27 20 30 25 20 47 23 32 32 30 32 37 38 25 30 30 35 30 36 28 31 31 23 33 30 46 28 24 29 32 31 31 26 25 35 32 31 30 28 46 33 24 11 27 27 42 34 38 38 38 25 30 31 37 48 46 48 32 31 15 31 30 29 32 26 30 27 21 31 31 17 8 16 37 24 37 32 48 32 25 20 21 31 23 30 29 23 24 31 39 18 20 7 12 15 26 32 24 19 30 46 31 22 32 32 27 30 31 19 44 29 19 19 20 31 23 14 20 31 11 13 24 32 19 27 21 37 25 26 25 19 31 29 33 32 26 31 21 16 23 37 20 23 37 48 44 48 48 10 33 21 20 11 19 13 18 32 32 43 34 19 4 6 25 12 27 31 25 22 23 19 28 34 27 27 31 34 32 22 17 12 23 29 47 47 26 13 18 10 12 33 32 32 15 19 23 14 9 21 12 18 10 24 21 6 5 3 4 11 13 22 30 7 12 12 12 15 12 6 18 14 10 27 9 7 27 17 16 14 6 5 11 18 20 28 14 5 3 5 4 6 10 15 17 9 13 8 18 7 40 17 9 9 11 18 9 4 3 5 10 4 4 9 8 15 4 7 11 5 9 9 12 3 3 5 21 17 7 7 8 17 4 4 6 19 7 6 6 11 6 11 14 6 18 7 16 8 14 13 28 17 25 13 22 17 16 14 4 6 8 24 8 8 14 9 4

Alignment Information

BAC End 1

BAC End 2

seq1: chr9_22804386_22805586
seq2: B6Ng01-190I09.b_45_1252 (reverse)

seq1  ATTAACA-GGATAGATGGCATTGTGGGTAGACATTTTTACAGAAAAACTG  49
      ||||||| |||||||||||||| |||||||||| |||||||  |||||||
seq2  ATTAACAGGGATAGATGGCATT-TGGGTAGACA-TTTTACAAGAAAACTG  48

seq1  GATCT-CAGG-AAAGAAGGGT--GGGGGTGGGGGTCTGTGCTTTTCTGCT  95
      ||||| |||| ||||||||||  |||||||||||||  ||||||||||||
seq2  GATCTCCAGGAAAAGAAGGGTGGGGGGGTGGGGGTCGTTGCTTTTCTGCT  98

seq1  -CCATAAGGACAGCTCAG-TGTTTACCACCATTGAGTTTTGATGG-TCTG  142
       ||||||||||||||||| ||||||||||||||||  |||||||| ||||
seq2  CCCATAAGGACAGCTCAGTTGTTTACCACCATTGAAGTTTGATGGTTCTG  148

seq1  CTGTTACTGCACATAGACAAGCACTCTTCTTTG-TATCGCCAGGTCTGCT  191
      ||||||||||||||||||||||||||||||||| | ||||||||||||||
seq2  CTGTTACTGCACATAGACAAGCACTCTTCTTTGTTTTCGCCAGGTCTGCT  198

seq1  GTCATAAAACATGGCCTCTCTCTTCAAGGATTCAGGTTTTTGAGGATACT  241
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCATAAAACATGGCCTCTCTCTTCAAGGATTCAGGTTTTTGAGGATACT  248

seq1  ATCAGCAAGGGGGCAATGGCCATATCAAAAAGACAGGGTGCTGGGGAGGT  291
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCAGCAAGGGGGCAATGGCCATATCAAAAAGACAGGGTGCTGGGGAGGT  298

seq1  GGGCAGCAGGCAGAGAGCTCATGTTGCTAGTGAGGCAGAGAGGTGGCTTC  341
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGCAGCAGGCAGAGAGCTCATGTTGCTAGTGAGGCAGAGAGGTGGCTTC  348

seq1  TGAGGAGAGACTCTAATGAGGGGTACCCAGGAAGTGATGTGCATGTGCTG  391
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGGAGAGACTCTAATGAGGGGTACCCAGGAAGTGATGTGCATGTGCTG  398

seq1  AACTGAAAATGAGCCCCAAATAGGGAACATTTCCATCTTGCCAAGCGGCA  441
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACTGAAAATGAGCCCCAAATAGGGAACATTTCCATCTTGCCAAGCGGCA  448

seq1  GACTGCAACTCACACCGAAGCAGCTACTTCTCTGCCTTACTGCCATCTGT  491
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACTGCAACTCACACCGAAGCAGCTACTTCTCTGCCTTACTGCCATCTGT  498

seq1  CCGGCTTCTTTCTCCTTTTAGCTCAGTGTTAAGTTCACTAAAAACAAGTG  541
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCGGCTTCTTTCTCCTTTTAGCTCAGTGTTAAGTTCACTAAAAACAAGTG  548

seq1  AGGTGTCATGTGTGTCAGGACACTATTTTGTAACATGACTACATTGGTTT  591
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGTGTCATGTGTGTCAGGACACTATTTTGTAACATGACTACATTGGTTT  598

seq1  GGGAGACTATATGCTTGAGAAAAATCACTTCCAGGGAGGGGACAGAGGTG  641
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGAGACTATATGCTTGAGAAAAATCACTTCCAGGGAGGGGACAGAGGTG  648

seq1  ACACTCTCTCTCTACATTTGCATACCATTTCTAGACAGTGTGTTAATGGG  691
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACACTCTCTCTCTACATTTGCATACCATTTCTAGACAGTGTGTTAATGGG  698

seq1  GATAATATGATGGAGCTGATATTTATTCATGTTTTCAGAGGCTAGTGCCA  741
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATAATATGATGGAGCTGATATTTATTCATGTTTTCAGAGGCTAGTGCCA  748

seq1  ACTTCCCAGACCAGATTTCAGAGTCGAAAGGTGAATTTAAACACACTCTA  791
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTCCCAGACCAGATTTCAGAGTCGAAAGGTGAATTTAAACACACTCTA  798

seq1  TCAAAGAAAGAAGGTAGAATATAAAGACATAGCCTGGAACACACCCTTCC  841
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAAAGAAAGAAGGTAGAATATAAAGACATAGCCTGGAACACACCCTTCC  848

seq1  CTCAGGGTTCTCAGGACTCTCACTGTAGCTCTGTGGTTTCAGCTAATCAG  891
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCAGGGTTCTCAGGACTCTCACTGTAGCTCTGTGGTTTCAGCTAATCAG  898

seq1  TCAGGGTTTTTTGTTACAGCAGCCTCAGCAAACGAATACATCTACCCAGC  941
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGGGTTTTTTGTTACAGCAGCCTCAGCAAACGAATACATCTACCCAGC  948

seq1  TCTGCCTTCTGGGTCCCAGTGGAGGAGAGCCTAGCAAGGTTTGCTCTTAC  991
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGCCTTCTGGGTCCCAGTGGAGGAGAGCCTAGCAAGGTTTGCTCTTAC  998

seq1  ATCTTAGCTATCCACTTCCATCTGTGCTGCCAGGGAAGGAATTTGGGGAA  1041
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCTTAGCTATCCACTTCCATCTGTGCTGCCAGGGAAGGAATTTGGGGAA  1048

seq1  CCCAGGGGACTGTTTGTCTATTAAAAATGGTATTGGAGGAGGGTAGAAAT  1091
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCAGGGGACTGTTTGTCTATTAAAAATGGTATTGGAGGAGGGTAGAAAT  1098

seq1  TCACAGATTAACTGGCTTTTGTTTTATGGAATGTTGGATAGAGAAGAAAA  1141
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCACAGATTAACTGGCTTTTGTTTTATGGAATGTTGGATAGAGAAGAAAA  1148

seq1  AGAAACAGCCCCCAGGGATGGTTTAATGATACTTACTCTTAGCCAGGAGT  1191
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAAACAGCCCCCAGGGATGGTTTAATGATACTTACTCTTAGCCAGGAGT  1198

seq1  AAAAGAATTC  1201
      ||||||||||
seq2  AAAAGAATTC  1208

seq1: chr9_22615675_22616820
seq2: B6Ng01-190I09.g_66_1199

seq1  GAATTCCTCTTGAAAGGATTCTCAGGTTCAGTTTTCTTTTTCCTAATTTG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCTCTTGAAAGGATTCTCAGGTTCAGTTTTCTTTTTCCTAATTTG  50

seq1  CTGGTGGCATCTATTACAGGGAGATAGAAATGGGTCAATGGAATCAAAAG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGTGGCATCTATTACAGGGAGATAGAAATGGGTCAATGGAATCAAAAG  100

seq1  TCTTGGTTTACTGTTTATGGCAGTCAGAGGGAAGCTCCCTGGTGGGTATA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTGGTTTACTGTTTATGGCAGTCAGAGGGAAGCTCCCTGGTGGGTATA  150

seq1  GAGAGACTCTGGACTTTGGTTTAAGAACCAACTCTATGTGCCTGGAAGGA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGAGACTCTGGACTTTGGTTTAAGAACCAACTCTATGTGCCTGGAAGGA  200

seq1  ATGAGGAAGGACCCTGAGCTGTGTAGTCATTGCGCATCCAGAGCTCAGTT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGAGGAAGGACCCTGAGCTGTGTAGTCATTGCGCATCCAGAGCTCAGTT  250

seq1  CAGCTACCAATAGAGCAGAGATAACCAGAGGCTTGTAGGTAGGACTCCTA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCTACCAATAGAGCAGAGATAACCAGAGGCTTGTAGGTAGGACTCCTA  300

seq1  GGAAGCAGGAGGCAAGTGCCCTCCTAACTTTAACGCCTTACACCCTCTGT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAAGCAGGAGGCAAGTGCCCTCCTAACTTTAACGCCTTACACCCTCTGT  350

seq1  CAGGAAGACCTTACTCAGTTATCCTTAAGTTGCTTTTATGGGCTCTTCCT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGAAGACCTTACTCAGTTATCCTTAAGTTGCTTTTATGGGCTCTTCCT  400

seq1  GCCATACAGCCTTTACTTCTTGAGCCTGCCAGTTTGGTCCCTTTGGCACT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCATACAGCCTTTACTTCTTGAGCCTGCCAGTTTGGTCCCTTTGGCACT  450

seq1  AGTACAGTGTGCTGCTGCTGTCTTTGCTGGCGCTGAGGTCCCAGTGCAGC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTACAGTGTGCTGCTGCTGTCTTTGCTGGCGCTGAGGTCCCAGTGCAGC  500

seq1  AGTGATGTTCCTAGGATTGCAGCCTCCACATTTTAAGGTGACACCACATT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGATGTTCCTAGGATTGCAGCCTCCACATTTTAAGGTGACACCACATT  550

seq1  TCCTGGGGTCTTTACTGTAGCTCATACAATTGCTCCGAAGAAAAATGGGA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTGGGGTCTTTACTGTAGCTCATACAATTGCTCCGAAGAAAAATGGGA  600

seq1  CAAATTTTGTACCATTATTTTTGCCACATGATACTGAAGTGGAACTAGAT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAATTTTGTACCATTATTTTTGCCACATGATACTGAAGTGGAACTAGAT  650

seq1  AGATCCTTAGAGCTCCCAAAATCCCTCTGGAGACCAGCACTATCAGATTT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGATCCTTAGAGCTCCCAAAATCCCTCTGGAGACCAGCACTATCAGATTT  700

seq1  TGTCAAGACTATGGCTCAAGGAGCTGAAATGTCAGTATCTTCTCTCCATC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTCAAGACTATGGCTCAAGGAGCTGAAATGTCAGTATCTTCTCTCCATC  750

seq1  CCAGGTGCCCCTGCTGTATCTAGGGCTTCTGTAAGGGCCAGATCCTTTTC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGGTGCCCCTGCTGTATCTAGGGCTTCTGTAAGGGCCAGATCCTTTTC  800

seq1  TGCAGACTGTAAGGCAGAAGAAGGGACACTCCTGGTAGTTAAGCCACCAG  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCAGACTGTAAGGCAGAAGAAGGGACACTCCTGGTAGTTAAGCCACCAG  850

seq1  ATCATCAAACAGGCCTGCACT-GGGGATTGATCTTATCACTGTGTTTCCT  899
      ||||||||||||||||||||| ||||||||||||||||||||||||||||
seq2  ATCATCAAACAGGCCTGCACTGGGGGATTGATCTTATCACTGTGTTTCCT  900

seq1  ATTCCTGGCA-CAGGACAAAGCACTTCCCACATGTGGACTCATCCAATTG  948
      |||||||||| |||||||||||||||||||||||||||||||||||||||
seq2  ATTCCTGGCACCAGGACAAAGCACTTCCCACATGTGGACTCATCCAATTG  950

seq1  CCTCAGTCCTT-GGGGGAGGCAGTCAAAAAGAACTAGTAGCTCACTACCT  997
      ||||||||||| ||||||||||||| ||||||||||||||||||||||||
seq2  CCTCAGTCCTTGGGGGGAGGCAGTC-AAAAGAACTAGTAGCTCACTACCT  999

seq1  GAAAACCTTGCTAACGCCTCCTCGTTAACAGTAACAAGTCCCTTTGGCTT  1047
      |||||||||||||||||||||||||  ||||||   ||| |||||||| |
seq2  GAAAACCTTGCTAACGCCTCCTCGT--ACAGTA--CAGT-CCTTTGGCCT  1044

seq1  GCTGTCATTTGTATACAAATTCCAAATTGGCTTTTGCACACAGGGCTGGG  1097
      |||||||||||| ||| |||||||||||||| ||  |||||| |||| ||
seq2  GCTGTCATTTGTTTAC-AATTCCAAATTGGC-TTGCCACACA-GGCT-GG  1090

seq1  AAGAAACCGTGGATGCTGCCATTGCCTACCTTTTGAAAACCTG-CCTGTC  1146
      |||||  ||| ||||||||||||| |||||||||||||  ||| ||||||
seq2  AAGAA--CGT-GATGCTGCCATTG-CTACCTTTTGAAA--CTGCCCTGTC  1134

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information