MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-214J19
Chromosome	9 (Build37)
Map Location	108,018,315 - 108,171,043
singlet/doublet	doublet
Overlap gene	Bsn, LOC100042108, Dag1
Upstream gene	Dock3, Mapkapk3, Cish, Hemk1, 6430571L13Rik, Cacna2d2, Tmem115, Cyb561d2, Tusc4, Zmynd10, Rassf1, Tusc2, Hyal2, Hyal1, Nat6, Hyal3, Ifrd2, BY080835, Sema3b, Gnai2, Slc38a3, Gnat1, Sema3f, Rbm5, Rbm6, Mon1a, Mst1r, 4921517D21Rik, Camkv, Traip, Ube1l, D330022A01Rik, 6230427J02Rik, 1700021K14Rik, Ihpk1, Gmppb, Rnf123, Amigo3, Mst1, Apeh
Downstream gene	Nicn1, EG434437, Tcta, Rhoa, Gpx1, Usp4, LOC623859, 1700102P08Rik, Ccdc36, BC048562, Klhdc8b, LOC100042228, Ccdc71, Lamb2, Usp19, Qars, Qrich1, Impdh2, 4733401H18Rik, Dalrd3, Wdr6, 4933406E20Rik, Arih2, ENSMUSG00000074075, Slc25a20, Prkar2a, Ihpk2, Nckipsd, Celsr3, Slc26a6, LOC100038959, Tmem89, Uqcrc1, Col7a1, Pfkfb4, Scotin, Trex1, 6620401K05Rik, Ccdc72, Ccdc51, EG665413, Plxnb1, E330009P21Rik, Fbxw13, Fbxw12
Link	Open Mouse BAC browser

Click to get alignment info.

name	Dock3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208869 MGI:2429763
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mapkapk3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102626 MGI:2143163
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cish (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12700 MGI:103159
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hemk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69536 MGI:1916786
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	6430571L13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235599 MGI:2445137
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cacna2d2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56808 MGI:1929813
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem115 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56395 MGI:1930765
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyb561d2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56368 MGI:1929280
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tusc4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56032 MGI:1914482
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zmynd10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:114602 MGI:2387863
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rassf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56289 MGI:1928386
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tusc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80385 MGI:1931086
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hyal2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15587 MGI:1196334
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hyal1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15586 MGI:96298
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nat6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56441 MGI:1888902
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hyal3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109685 MGI:1330288
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ifrd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15983 MGI:1316708
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BY080835 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434436 MGI:3612240
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sema3b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20347 MGI:107561
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Gnai2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14678 MGI:95772
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc38a3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76257 MGI:1923507
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gnat1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14685 MGI:95778
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sema3f (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20350 MGI:1096347
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rbm5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83486 MGI:1933204
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rbm6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19654 MGI:1338037
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Mon1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72825 MGI:1920075
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mst1r (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19882 MGI:99614
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4921517D21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67722 MGI:1914972
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Camkv (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235604 MGI:2384296
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Traip (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22036 MGI:1096377
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ube1l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74153 MGI:1349462
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D330022A01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320169 MGI:2443519
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	6230427J02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68176 MGI:1915426
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700021K14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69398 MGI:1916648
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 1 Protein

name	Ihpk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27399 MGI:1351633
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gmppb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:331026 MGI:2660880
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnf123 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:84585 MGI:2148796
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Amigo3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320844 MGI:2444854
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mst1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15235 MGI:96080
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Apeh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235606 MGI:88041
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bsn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12217 MGI:1277955
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042108 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042108
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 62 ESTs, 4 Proteins pseudo : _no_value

name	Dag1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13138 MGI:101864
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nicn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66257 MGI:1913507
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG434437 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434437 MGI:3646700
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tcta (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102791 MGI:1918829
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rhoa (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11848 MGI:1096342
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpx1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14775 MGI:104887
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Usp4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22258 MGI:98905
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC623859 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:623859
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 31 mRNAs, 1343 ESTs, 6 Proteins pseudo : _no_value

name	1700102P08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:112418 MGI:2148248
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc36 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434438 MGI:3612242
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs, 2 Proteins

name	BC048562 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434439 MGI:3618861
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klhdc8b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78267 MGI:1925517
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042228 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042228
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Ccdc71 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72454 MGI:1919704
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lamb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16779 MGI:99916
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Usp19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71472 MGI:1918722
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Qars (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:97541 MGI:1915851
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Qrich1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69232 MGI:1916482
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Impdh2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23918 MGI:109367
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4733401H18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66706 MGI:1913956
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dalrd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67789 MGI:1915039
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wdr6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83669 MGI:1930140
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4933406E20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74443 MGI:1921693
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arih2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23807 MGI:1344361
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	ENSMUSG00000074075 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100038635 MGI:3642291
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 12 ESTs

name	Slc25a20 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57279 MGI:1928738
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prkar2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19087 MGI:108025
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ihpk2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76500 MGI:1923750
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nckipsd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80987 MGI:1931834
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Celsr3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107934 MGI:1858236
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc26a6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171429 MGI:2159728
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100038959 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038959
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 37 ESTs

name	Tmem89 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69384 MGI:1916634
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein

name	Uqcrc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22273 MGI:107876
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Col7a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12836 MGI:88462
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pfkfb4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:270198 MGI:2687284
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Scotin (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66940 MGI:1915044
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Trex1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22040 MGI:1328317
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	6620401K05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235610 MGI:1925349
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc72 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66167 MGI:1913417
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc51 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66658 MGI:1913908
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG665413 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665413 MGI:3643956
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	Plxnb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235611 MGI:2154238
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	E330009P21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320082 MGI:2443323
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fbxw13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:211305 MGI:3505590
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fbxw12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434440 MGI:3584372
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dock3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23510296 GeneID:208869 MGI:2429763
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dedicator of cyto-kinesis 3 transcript_id : NM_153413.1

name	Mapkapk3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388197 GeneID:102626 MGI:2143163
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitogen-activated protein kinase-activated protein kinase 3 transcript_id : NM_178907.2

name	Cish (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129844 GeneID:12700 MGI:103159
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytokine inducible SH2-containing protein transcript_id : NM_009895.3

name	Hemk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21539656 GeneID:69536 MGI:1916786
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : HemK methyltransferase family member 1 transcript_id : NM_133984.1

name	6430571L13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368001 GeneID:235599 MGI:2445137
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6430571L13 gene transcript_id : NM_175486.2

name	Cacna2d2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24475642 GeneID:56808 MGI:1929813
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium channel, voltage-dependent, alpha 2/delta subunit 2 transcript_id : NM_020263.2

name	Tmem115 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130595 GeneID:56395 MGI:1930765
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 115 transcript_id : NM_019704.2

name	Cyb561d2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142363770 GeneID:56368 MGI:1929280
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome b-561 domain containing 2 transcript_id : NM_019720.3

name	Tusc4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9256542 GeneID:56032 MGI:1914482
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tumor suppressor candidate 4 transcript_id : NM_018879.1

name	Zmynd10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803032 GeneID:114602 MGI:2387863
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, MYND domain containing 10 transcript_id : NM_053253.3

name	Rassf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130657 GeneID:56289 MGI:1928386
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Ras association (RalGDS/AF-6) domain family 1 transcript_id : NM_019713.3

name	Tusc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354375 GeneID:80385 MGI:1931086
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tumor suppressor candidate 2 transcript_id : NM_019742.3

name	Hyal2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:45331201 GeneID:15587 MGI:1196334
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hyaluronoglucosaminidase 2 transcript_id : NM_010489.2

name	Hyal1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354500 GeneID:15586 MGI:96298
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hyaluronoglucosaminidase 1 transcript_id : NM_008317.3

name	Nat6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365492 GeneID:56441 MGI:1888902
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : N-acetyltransferase 6 transcript_id : NM_019750.3

name	Hyal3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30842787 GeneID:109685 MGI:1330288
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hyaluronoglucosaminidase 3 transcript_id : NM_178020.2

name	Ifrd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801695 GeneID:15983 MGI:1316708
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interferon-related developmental regulator 2 transcript_id : NM_025903.2

name	BY080835 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486968 GeneID:434436 MGI:3612240
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BY080835 transcript_id : NM_001081244.1

name	Sema3b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112421093 GeneID:20347 MGI:107561
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3B transcript_id : NM_001042779.1

name	Sema3b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112421072 GeneID:20347 MGI:107561
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3B transcript_id : NM_009153.2

name	Gnai2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387600 GeneID:14678 MGI:95772
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : guanine nucleotide binding protein, alpha inhibiting 2 transcript_id : NM_008138.4

name	Slc38a3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328321 GeneID:76257 MGI:1923507
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 38, member 3 transcript_id : NM_023805.2

name	Gnat1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542897 GeneID:14685 MGI:95778
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : guanine nucleotide binding protein, alpha transducing 1 transcript_id : NM_008140.2

name	Sema3f (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801980 GeneID:20350 MGI:1096347
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3 F transcript_id : NM_011349.3

name	Rbm5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328369 GeneID:83486 MGI:1933204
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA binding motif protein 5 transcript_id : NM_148930.2

name	Rbm6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142357262 GeneID:19654 MGI:1338037
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA binding motif protein 6 transcript_id : NM_011251.2

name	Rbm6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803537 GeneID:19654 MGI:1338037
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA binding motif protein 6 transcript_id : NM_029169.2

name	Mon1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142363576 GeneID:72825 MGI:1920075
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MON1 homolog A (yeast) transcript_id : NM_028369.2

name	Mst1r (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6677764 GeneID:19882 MGI:99614
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : macrophage stimulating 1 receptor (c-met-related tyrosine kinase) transcript_id : NM_009074.1

name	4921517D21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802953 GeneID:67722 MGI:1914972
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4921517D21 gene transcript_id : NM_026338.2

name	Camkv (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130190 GeneID:235604 MGI:2384296
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CaM kinase-like vesicle-associated transcript_id : NM_145621.2

name	Traip (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130111 GeneID:22036 MGI:1096377
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TRAF-interacting protein transcript_id : NM_011634.3

name	Ube1l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802750 GeneID:74153 MGI:1349462
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin-activating enzyme E1-like transcript_id : NM_023738.3

name	D330022A01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351769 GeneID:320169 MGI:2443519
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA D330022A01 gene transcript_id : NM_177090.3

name	6230427J02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802918 GeneID:68176 MGI:1915426
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6230427J02 gene transcript_id : NM_026597.2

name	1700021K14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260307 GeneID:69398 MGI:1916648
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 1 Protein product : RIKEN cDNA 1700021K14 gene transcript_id : XM_001476112.1

name	Ihpk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254567 GeneID:27399 MGI:1351633
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : inositol hexaphosphate kinase 1 transcript_id : NM_013785.2

name	Gmppb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110626021 GeneID:331026 MGI:2660880
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GDP-mannose pyrophosphorylase B transcript_id : NM_177910.3

name	Rnf123 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:54027903 GeneID:84585 MGI:2148796
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger protein 123 transcript_id : NM_032543.1

name	Amigo3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373780 GeneID:320844 MGI:2444854
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adhesion molecule with Ig like domain 3 transcript_id : NM_177275.3

name	Mst1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982292 GeneID:15235 MGI:96080
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : macrophage stimulating 1 (hepatocyte growth factor-like) transcript_id : NM_008243.2

name	Apeh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122788 GeneID:235606 MGI:88041
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acylpeptide hydrolase transcript_id : NM_146226.1

name	Bsn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487406 GeneID:12217 MGI:1277955
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bassoon transcript_id : NM_007567.2

name	Dag1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801883 GeneID:13138 MGI:101864
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dystroglycan 1 transcript_id : NM_010017.2

name	Nicn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892621 GeneID:66257 MGI:1913507
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nicolin 1 transcript_id : NM_025449.3

name	EG434437 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62000669 GeneID:434437 MGI:3646700
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG434437 transcript_id : NM_001013814.1

name	Tcta (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31077076 GeneID:102791 MGI:1918829
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : T-cell leukemia translocation altered gene transcript_id : NM_133986.1

name	Rhoa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46195812 GeneID:11848 MGI:1096342
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ras homolog gene family, member A transcript_id : NM_016802.3

name	Gpx1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:145275166 GeneID:14775 MGI:104887
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutathione peroxidase 1 transcript_id : NM_008160.5

name	Usp4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755942 GeneID:22258 MGI:98905
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin specific peptidase 4 (proto-oncogene) transcript_id : NM_011678.1

name	1700102P08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716520 GeneID:112418 MGI:2148248
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700102P08 gene transcript_id : NM_053216.1

name	Ccdc36 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260310 GeneID:434438 MGI:3612242
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs, 2 Proteins product : coiled-coil domain containing 36 transcript_id : XM_486258.5

name	BC048562 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:52138533 GeneID:434439 MGI:3618861
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC048562 transcript_id : NM_001004192.1

name	Klhdc8b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037522 GeneID:78267 MGI:1925517
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kelch domain containing 8B transcript_id : NM_030075.1

name	LOC100042228 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260318 GeneID:100042228
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : hypothetical protein LOC100042228 transcript_id : XM_001478646.1

name	Ccdc71 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802051 GeneID:72454 MGI:1919704
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 71 transcript_id : NM_133744.3

name	Lamb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982222 GeneID:16779 MGI:99916
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : laminin, beta 2 transcript_id : NM_008483.2

name	Usp19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47825365 GeneID:71472 MGI:1918722
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin specific peptidase 19 transcript_id : NM_027804.2

name	Qars (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:55741702 GeneID:97541 MGI:1915851
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutaminyl-tRNA synthetase transcript_id : NM_133794.1

name	Qrich1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142371811 GeneID:69232 MGI:1916482
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutamine-rich 1 transcript_id : NM_175143.3

name	Impdh2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130027 GeneID:23918 MGI:109367
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : inosine 5'-phosphate dehydrogenase 2 transcript_id : NM_011830.3

name	4733401H18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12963602 GeneID:66706 MGI:1913956
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4733401H18 gene transcript_id : NM_023247.1

name	Dalrd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110611930 GeneID:67789 MGI:1915039
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DALR anticodon binding domain containing 3 transcript_id : NM_026378.3

name	Wdr6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981423 GeneID:83669 MGI:1930140
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD repeat domain 6 transcript_id : NM_031392.2

name	4933406E20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892569 GeneID:74443 MGI:1921693
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933406E20 gene transcript_id : NM_028944.3

name	Arih2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892776 GeneID:23807 MGI:1344361
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ariadne homolog 2 (Drosophila) transcript_id : NM_011790.3

name	ENSMUSG00000074075 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260312 GeneID:100038635 MGI:3642291
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 12 ESTs product : predicted gene, ENSMUSG00000074075 transcript_id : XM_001476249.1

name	Slc25a20 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142356864 GeneID:57279 MGI:1928738
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 25 (mitochondrial carnitine/acylcarnitine translocase), member 20 transcript_id : NM_020520.3

name	Prkar2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130621 GeneID:19087 MGI:108025
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein kinase, cAMP dependent regulatory, type II alpha transcript_id : NM_008924.2

name	Ihpk2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037446 GeneID:76500 MGI:1923750
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : inositol hexaphosphate kinase 2 transcript_id : NM_029634.1

name	Nckipsd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892390 GeneID:80987 MGI:1931834
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NCK interacting protein with SH3 domain transcript_id : NM_030729.4

name	Celsr3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125719164 GeneID:107934 MGI:1858236
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cadherin EGF LAG seven-pass G-type receptor 3 transcript_id : NM_080437.2

name	Slc26a6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133779000 GeneID:171429 MGI:2159728
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 26, member 6 transcript_id : NM_134420.3

name	LOC100038959 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260321 GeneID:100038959
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 37 ESTs product : similar to chloride-formate exchanger transcript_id : XM_001471980.1

name	Tmem89 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260323 GeneID:69384 MGI:1916634
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein product : transmembrane protein 89 transcript_id : XM_135161.4

name	Uqcrc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46593020 GeneID:22273 MGI:107876
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquinol-cytochrome c reductase core protein 1 transcript_id : NM_025407.2

name	Col7a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115647998 GeneID:12836 MGI:88462
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : procollagen, type VII, alpha 1 transcript_id : NM_007738.3

name	Pfkfb4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111120327 GeneID:270198 MGI:2687284
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 6-phosphofructo-2-kinase/fructose-2, 6-biphosphatase 4 transcript_id : NM_173019.5

name	Scotin (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892939 GeneID:66940 MGI:1915044
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : scotin gene transcript_id : NM_025858.2

name	Scotin (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367784 GeneID:66940 MGI:1915044
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : scotin gene transcript_id : NM_026381.2

name	Trex1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:59624978 GeneID:22040 MGI:1328317
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : three prime repair exonuclease 1 transcript_id : NM_011637.6

name	Trex1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:59624980 GeneID:22040 MGI:1328317
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : three prime repair exonuclease 1 transcript_id : NM_001012236.1

name	6620401K05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142356371 GeneID:235610 MGI:1925349
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6620401K05 gene transcript_id : NM_172774.2

name	Ccdc72 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384868 GeneID:66167 MGI:1913417
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 72 transcript_id : NM_183250.2

name	Ccdc51 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377296 GeneID:66658 MGI:1913908
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 51 transcript_id : NM_025689.2

name	EG665413 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94386569 GeneID:665413 MGI:3643956
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : predicted gene, EG665413 transcript_id : XM_976757.1

name	Plxnb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27370139 GeneID:235611 MGI:2154238
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : plexin B1 transcript_id : NM_172775.1

name	E330009P21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388093 GeneID:320082 MGI:2443323
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA E330009P21 gene transcript_id : NM_177069.3

name	Fbxw13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115299748 GeneID:211305 MGI:3505590
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box and WD-40 domain protein 13 transcript_id : NM_177598.3

name	Fbxw12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372704 GeneID:434440 MGI:3584372
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box and WD-40 domain protein 12 transcript_id : NM_001008428.2

name	Dock3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23510297 GeneID:208869 MGI:2429763
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005625 - soluble fraction [Evidence IDA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0051020 - GTPase binding [Evidence IEA]; GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 exception : unclassified translation discrepancy note : presenilin-binding protein; modifier of cell adhesion product : dedicator of cyto-kinesis 3 protein_id : NP_700462.1

name	Mapkapk3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542089 CCDS:CCDS23487.1 GeneID:102626 MGI:2143163
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 product : mitogen-activated protein kinase-activated protein kinase 3 protein_id : NP_849238.1

name	Cish (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753426 GeneID:12700 MGI:103159
definition	GO_component : GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0009968 - negative regulation of signal transduction [Evidence IEA]; GO:0007205 - protein kinase C activation [Evidence IDA]; GO:0001558 - regulation of cell growth [Evidence IEA] codon_start : 1 note : cytokine-inducible SH2 protein product : cytokine inducible SH2-containing protein protein_id : NP_034025.1

name	Hemk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21539657 CCDS:CCDS23488.1 GeneID:69536 MGI:1916786
definition	GO_function : GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : HemK methyltransferase family member 1 protein_id : NP_598745.1

name	6430571L13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28202049 CCDS:CCDS23489.1 GeneID:235599 MGI:2445137
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : hypothetical protein LOC235599 protein_id : NP_780695.1

name	Cacna2d2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15529968 GeneID:56808 MGI:1929813
definition	GO_component : GO:0005786 - signal recognition particle (sensu Eukaryota) [Evidence IEA]; GO:0005891 - voltage-gated calcium channel complex [Evidence IDA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0005245 - voltage-gated calcium channel activity [Evidence IDA] GO_process : GO:0006816 - calcium ion transport [Evidence IC]; GO:0006614 - SRP-dependent cotranslational protein targeting to membrane [Evidence IEA] codon_start : 1 exception : mismatches in translation note : alpha 2 delta calcium channel subunit; ducky product : calcium channel, voltage-dependent, alpha 2/delta subunit 2 protein_id : NP_064659.1

name	Tmem115 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790165 CCDS:CCDS23490.1 GeneID:56395 MGI:1930765
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : placental protein 6 product : PL6 protein protein_id : NP_062678.1

name	Cyb561d2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790029 CCDS:CCDS23491.1 GeneID:56368 MGI:1929280
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006118 - electron transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : gene for 101F6 protein product : tumor suppressor, region 10 protein_id : NP_062694.1

name	Tusc4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9256543 CCDS:CCDS23492.1 GeneID:56032 MGI:1914482
definition	GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0045786 - negative regulation of progression through cell cycle [Evidence IEA] codon_start : 1 note : nitrogen permase homolog product : G21 protein protein_id : NP_061367.1

name	Zmynd10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982595 CCDS:CCDS23493.1 GeneID:114602 MGI:2387863
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : zinc finger, MYND domain-containing 10 protein_id : NP_444483.2

name	Rassf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790187 CCDS:CCDS23494.1 GeneID:56289 MGI:1928386
definition	codon_start : 1 note : 123F protein product : Ras association (RalGDS/AF-6) domain family 1 protein_id : NP_062687.1

name	Tusc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9789955 CCDS:CCDS23495.1 GeneID:80385 MGI:1931086
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : lung cancer candidiate, FUS; fusion 1; PDGFA associated protein 2 product : tumor suppressor candidate 2 protein_id : NP_062716.1

name	Hyal2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:45331202 CCDS:CCDS23496.1 GeneID:15587 MGI:1196334
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0004415 - hyalurononglucosaminidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016798 - hydrolase activity, acting on glycosyl bonds [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : hyaluronidase 2 protein_id : NP_034619.2

name	Hyal1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982262 CCDS:CCDS23497.1 GeneID:15586 MGI:96298
definition	GO_function : GO:0004415 - hyalurononglucosaminidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016798 - hydrolase activity, acting on glycosyl bonds [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : hyaluronidase 1 protein_id : NP_032343.2

name	Nat6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9789957 CCDS:CCDS23498.1 GeneID:56441 MGI:1888902
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0008080 - N-acetyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007049 - cell cycle [Evidence IEA]; GO:0045786 - negative regulation of progression through cell cycle [Evidence IEA] codon_start : 1 note : fusion 2 product : N-acetyltransferase 6 protein_id : NP_062724.1

name	Hyal3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29788991 CCDS:CCDS23499.1 GeneID:109685 MGI:1330288
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016798 - hydrolase activity, acting on glycosyl bonds [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hyaluronidase 3 protein_id : NP_821139.1

name	Ifrd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385396 CCDS:CCDS23500.1 GeneID:15983 MGI:1316708
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 product : interferon-related developmental regulator 2 protein_id : NP_080179.1

name	BY080835 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486969 GeneID:434436 MGI:3612240
definition	codon_start : 1 product : hypothetical LOC434436 protein_id : NP_001074713.1

name	Sema3b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112421094 GeneID:20347 MGI:107561
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007399 - nervous system development [Evidence IEA] codon_start : 1 product : semaphorin 3B protein_id : NP_001036244.1

name	Sema3b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112421073 CCDS:CCDS23501.1 GeneID:20347 MGI:107561
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007399 - nervous system development [Evidence IEA] codon_start : 1 product : semaphorin 3B protein_id : NP_033179.2

name	Gnai2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41054806 CCDS:CCDS23502.1 GeneID:14678 MGI:95772
definition	GO_function : GO:0005525 - GTP binding [Evidence ISS] [Evidence IEA]; GO:0003924 - GTPase activity [Evidence TAS]; GO:0019001 - guanyl nucleotide binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007213 - acetylcholine receptor signaling, muscarinic pathway [Evidence IMP]; GO:0008283 - cell proliferation [Evidence IPI]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence TAS]; GO:0007193 - G-protein signaling, adenylate cyclase inhibiting pathway [Evidence ISS] [Evidence IMP]; GO:0008016 - regulation of heart contraction [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : guanine nucleotide binding protein, alpha inhibiting 2 protein_id : NP_032164.2

name	Slc38a3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328322 CCDS:CCDS23503.1 GeneID:76257 MGI:1923507
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IDA] GO_function : GO:0015171 - amino acid transporter activity [Evidence IEA]; GO:0015297 - antiporter activity [Evidence IEA]; GO:0015186 - L-glutamine transporter activity [Evidence IDA]; GO:0005290 - L-histidine transporter activity [Evidence IDA]; GO:0031402 - sodium ion binding [Evidence IEA]; GO:0015293 - symporter activity [Evidence IEA] GO_process : GO:0006868 - glutamine transport [Evidence IDA]; GO:0015817 - histidine transport [Evidence IDA]; GO:0006811 - ion transport [Evidence IEA]; GO:0006814 - sodium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : N system amino acids transporter NAT-1 protein_id : NP_076294.2

name	Gnat1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680041 CCDS:CCDS23504.1 GeneID:14685 MGI:95778
definition	GO_component : GO:0005834 - heterotrimeric G-protein complex [Evidence ISS] [Evidence TAS]; GO:0005624 - membrane fraction [Evidence TAS] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence TAS] [Evidence ISS]; GO:0019001 - guanyl nucleotide binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0008283 - cell proliferation [Evidence IDA]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IDA]; GO:0007199 - G-protein signaling, coupled to cGMP nucleotide second messenger [Evidence TAS]; GO:0007602 - phototransduction [Evidence IMP]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA]; GO:0007601 - visual perception [Evidence TAS] codon_start : 1 product : guanine nucleotide binding protein, alpha transducing 1 protein_id : NP_032166.1

name	Sema3f (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543683 CCDS:CCDS23505.1 GeneID:20350 MGI:1096347
definition	GO_function : GO:0045499 - chemorepellant activity [Evidence IDA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0050919 - negative chemotaxis [Evidence IGI] [Evidence IDA]; GO:0001755 - neural crest cell migration [Evidence IMP] codon_start : 1 product : sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3 F protein_id : NP_035479.2

name	Rbm5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22507333 CCDS:CCDS23506.1 GeneID:83486 MGI:1933204
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : RNA binding motif protein 5 protein_id : NP_683732.1

name	Rbm6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755294 GeneID:19654 MGI:1338037
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : isoform a is encoded by transcript variant 1 product : RNA binding motif protein 6 isoform a protein_id : NP_035381.1

name	Rbm6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82524276 CCDS:CCDS23507.1 GeneID:19654 MGI:1338037
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : RNA binding motif protein 6 isoform b protein_id : NP_083445.1

name	Mon1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312179 CCDS:CCDS23508.1 GeneID:72825 MGI:1920075
definition	GO_function : GO:0003674 - molecular_function [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : MON1 homolog A protein_id : NP_082645.1

name	Mst1r (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677765 CCDS:CCDS23509.1 GeneID:19882 MGI:99614
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA]; GO:0001725 - stress fiber [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 exception : mismatches in translation note : c-met-related tyrosine kinase; friend virus susceptibility 2; receptor protein tyrosine kinase, c-met-related product : macrophage stimulating 1 receptor protein_id : NP_033100.1

name	4921517D21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385842 CCDS:CCDS23510.1 GeneID:67722 MGI:1914972
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC67722 protein_id : NP_080614.1

name	Camkv (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704242 GeneID:235604 MGI:2384296
definition	codon_start : 1 product : vesicle-associated calmodulin-binding protein protein_id : NP_663596.1

name	Traip (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560535 CCDS:CCDS23511.1 GeneID:22036 MGI:1096377
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005057 - receptor signaling protein activity [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IPI] [Evidence IDA] codon_start : 1 product : TRAF-interacting protein protein_id : NP_035764.2

name	Ube1l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794156 GeneID:74153 MGI:1349462
definition	GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0019782 - ISG15 activating enzyme activity [Evidence IDA]; GO:0004839 - ubiquitin activating enzyme activity [Evidence IEA] GO_process : GO:0032020 - ISG15-protein conjugation [Evidence IDA]; GO:0019941 - modification-dependent protein catabolism [Evidence IDA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : ubiquitin activating enzyme E1-like product : ubiquitin-activating enzyme E1-like protein_id : NP_076227.1

name	6230427J02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037107 GeneID:68176 MGI:1915426
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC68176 protein_id : NP_080873.1

name	D330022A01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893013 GeneID:320169 MGI:2443519
definition	codon_start : 1 product : hypothetical protein LOC320169 protein_id : NP_796064.1

name	1700021K14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260308 GeneID:69398 MGI:1916648
definition	codon_start : 1 product : hypothetical protein LOC69398 protein_id : XP_001476162.1

name	Ihpk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254568 CCDS:CCDS23514.1 GeneID:27399 MGI:1351633
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005737 - cytoplasm [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0050517 - inositol hexakisphosphate kinase activity [Evidence IEA] [Evidence ISS]; GO:0004428 - inositol or phosphatidylinositol kinase activity [Evidence ISS]; GO:0008440 - inositol trisphosphate 3-kinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006020 - myo-inositol metabolism [Evidence ISS]; GO:0016310 - phosphorylation [Evidence ISS] codon_start : 1 note : inositol hexakisphosphate kinase 6 product : inositol hexaphosphate kinase 1 protein_id : NP_038813.2

name	Gmppb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244556 CCDS:CCDS23515.1 GeneID:331026 MGI:2660880
definition	GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0004475 - mannose-1-phosphate guanylyltransferase activity [Evidence ISS]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA] GO_process : GO:0009058 - biosynthesis [Evidence IEA] codon_start : 1 product : GDP-mannose pyrophosphorylase B protein_id : NP_808578.1

name	Rnf123 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54027904 GeneID:84585 MGI:2148796
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : ubiquitin ligase product : ring finger protein 123 protein_id : NP_115932.1

name	Amigo3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893353 CCDS:CCDS23516.1 GeneID:320844 MGI:2444854
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence ISS] [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence ISS] [Evidence IEA]; GO:0007157 - heterophilic cell adhesion [Evidence ISS] codon_start : 1 note : alivin 3; amphoterin induced gene and ORF 3 product : adhesion molecule with Ig like domain 3 protein_id : NP_796249.1

name	Mst1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982293 GeneID:15235 MGI:96080
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0007596 - blood coagulation [Evidence IEA]; GO:0007566 - embryo implantation [Evidence IC]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : hepatocyte growth factor-like product : macrophage stimulating 1 (hepatocyte growth factor-like) protein_id : NP_032269.2

name	Apeh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122789 GeneID:235606 MGI:88041
definition	GO_function : GO:0004254 - acylaminoacyl-peptidase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : N-acylaminoacyl peptide hydrolase product : acylpeptide hydrolase protein_id : NP_666338.1

name	Bsn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487407 CCDS:CCDS23517.1 GeneID:12217 MGI:1277955
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0016021 - integral to membrane [Evidence ISS]; GO:0000300 - peripheral to membrane of membrane fraction [Evidence ISS]; GO:0045202 - synapse [Evidence ISS] [Evidence IDA]; GO:0019717 - synaptosome [Evidence IEA] [Evidence ISS] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : presynaptic cytomatrix protein product : bassoon protein protein_id : NP_031593.2

name	Dag1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859532 CCDS:CCDS23518.1 GeneID:13138 MGI:101864
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0016011 - dystroglycan complex [Evidence IDA]; GO:0005626 - insoluble fraction [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0002011 - morphogenesis of an epithelial sheet [Evidence IMP] codon_start : 1 note : dystrophin associated glycoprotein 1; beta-dystroglycan; alpha-dystroglycan product : dystroglycan 1 protein_id : NP_034147.1

name	Nicn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384852 GeneID:66257 MGI:1913507
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : nicolin 1 protein_id : NP_079725.1

name	EG434437 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62000670 CCDS:CCDS23519.1 GeneID:434437 MGI:3646700
definition	codon_start : 1 function : glycine metabolism product : aminomethyltransferase protein_id : NP_001013836.1

name	Tcta (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31077077 CCDS:CCDS23520.1 GeneID:102791 MGI:1918829
definition	codon_start : 1 product : T-cell leukemia translocation altered protein_id : NP_598747.1

name	Rhoa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542143 CCDS:CCDS23521.1 GeneID:11848 MGI:1096342
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005829 - cytosol [Evidence IDA] [Evidence TAS]; GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence ISS] [Evidence TAS] [Evidence IDA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004871 - signal transducer activity [Evidence ISS] GO_process : GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence IDA] [Evidence ISS]; GO:0007155 - cell adhesion [Evidence IMP]; GO:0030154 - cell differentiation [Evidence IDA]; GO:0007160 - cell-matrix adhesion [Evidence IDA]; GO:0007229 - integrin-mediated signaling pathway [Evidence TAS]; GO:0043524 - negative regulation of neuron apoptosis [Evidence IMP]; GO:0043123 - positive regulation of I-kappaB kinase/NF-kappaB cascade [Evidence ISS]; GO:0042346 - positive regulation of NF-kappaB import into nucleus [Evidence ISS]; GO:0007266 - Rho protein signal transduction [Evidence ISS] [Evidence IEA] [Evidence TAS]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA]; GO:0043149 - stress fiber formation [Evidence IDA]; GO:0007519 - striated muscle development [Evidence IDA] codon_start : 1 note : Rho family GTPase; aplysia ras-related homolog A; aplysia ras-related homolog A2; aplysia ras-related homolog A1; ras homolog A2; ras homolog A1; ras homolog gene family, member A2; ras homolog gene family, member A1 product : ras homolog gene family, member A protein_id : NP_058082.2

name	Gpx1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84871986 CCDS:CCDS23522.1 GeneID:14775 MGI:104887
definition	EC_number : 1.11.1.9 GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0004602 - glutathione peroxidase activity [Evidence NAS] [Evidence IDA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0004601 - peroxidase activity [Evidence IEA]; GO:0008430 - selenium binding [Evidence IEA] GO_process : GO:0008631 - induction of apoptosis by oxidative stress [Evidence IMP]; GO:0006979 - response to oxidative stress [Evidence IEA]; GO:0000302 - response to reactive oxygen species [Evidence IMP] codon_start : 1 note : cellular glutathione peroxidase product : glutathione peroxidase 1 protein_id : NP_032186.2 transl_except : (pos:108241782..108241784,aa:Sec)

name	Usp4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755943 CCDS:CCDS23523.1 GeneID:22258 MGI:98905
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004221 - ubiquitin thiolesterase activity [Evidence IEA] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : ubiquitous nuclear protein product : ubiquitin specific protease 4 (proto-oncogene) protein_id : NP_035808.1

name	1700102P08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716521 CCDS:CCDS23524.1 GeneID:112418 MGI:2148248
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC112418 protein_id : NP_444446.1

name	Ccdc36 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260311 GeneID:434438 MGI:3612242
definition	codon_start : 1 product : similar to Ccdc36 protein protein_id : XP_486258.4

name	BC048562 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:52138534 CCDS:CCDS23525.1 GeneID:434439 MGI:3618861
definition	codon_start : 1 product : hypothetical protein LOC434439 protein_id : NP_001004192.1

name	Klhdc8b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037523 CCDS:CCDS23526.1 GeneID:78267 MGI:1925517
definition	codon_start : 1 product : kelch domain containing 8B protein_id : NP_084351.1

name	LOC100042228 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260319 GeneID:100042228
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478696.1

name	Ccdc71 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526948 CCDS:CCDS23527.1 GeneID:72454 MGI:1919704
definition	codon_start : 1 product : coiled-coil domain containing 71 protein_id : NP_598505.1

name	Lamb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982223 CCDS:CCDS23528.1 GeneID:16779 MGI:99916
definition	GO_component : GO:0005605 - basal lamina [Evidence IEA]; GO:0005604 - basement membrane [Evidence IDA]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0005201 - extracellular matrix structural constituent [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 note : Laminin S product : laminin, beta 2 protein_id : NP_032509.2

name	Usp19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47825366 CCDS:CCDS23529.1 GeneID:71472 MGI:1918722
definition	GO_function : GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : ubiquitin carboxyl-terminal hydrolase 19; ubiquitin thiolesterase 19; ubiquitin-specific processing protease 19; deubiquitinating enzyme 19; ubiquitin specific protease 19 product : ubiquitin-specific protease 19 protein_id : NP_082080.2

name	Qars (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:55741703 CCDS:CCDS23530.1 GeneID:97541 MGI:1915851
definition	GO_component : GO:0017101 - aminoacyl-tRNA synthetase multienzyme complex [Evidence ISS] GO_function : GO:0004812 - aminoacyl-tRNA ligase activity [Evidence IEA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0004818 - glutamate-tRNA ligase activity [Evidence IEA]; GO:0004819 - glutamine-tRNA ligase activity [Evidence IEA] [Evidence ISS]; GO:0016874 - ligase activity [Evidence IEA]; GO:0019901 - protein kinase binding [Evidence ISS]; GO:0003723 - RNA binding [Evidence ISS] GO_process : GO:0006916 - anti-apoptosis [Evidence ISS]; GO:0006424 - glutamyl-tRNA aminoacylation [Evidence IEA]; GO:0043037 - translation [Evidence IC] codon_start : 1 exception : mismatches in translation note : glutamine-tRNA ligase product : glutaminyl-tRNA synthetase protein_id : NP_598555.1

name	Qrich1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424734 GeneID:69232 MGI:1916482
definition	codon_start : 1 product : glutamine-rich 1 protein_id : NP_780352.1

name	Impdh2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981382 GeneID:23918 MGI:109367
definition	GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0003938 - IMP dehydrogenase activity [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA] GO_process : GO:0006177 - GMP biosynthesis [Evidence IEA]; GO:0046651 - lymphocyte proliferation [Evidence IMP]; GO:0006164 - purine nucleotide biosynthesis [Evidence IMP] codon_start : 1 note : IMP dehydrogenase product : inosine 5'-phosphate dehydrogenase 2 protein_id : NP_035960.2

name	4733401H18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963603 CCDS:CCDS23531.1 GeneID:66706 MGI:1913956
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 product : nuclear protein E3-3 protein_id : NP_075736.1

name	Dalrd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110611931 GeneID:67789 MGI:1915039
definition	GO_function : GO:0004812 - aminoacyl-tRNA ligase activity [Evidence IEA]; GO:0004814 - arginine-tRNA ligase activity [Evidence IEA]; GO:0005524 - ATP binding [Evidence IEA] GO_process : GO:0006420 - arginyl-tRNA aminoacylation [Evidence IEA] codon_start : 1 product : DALR anticodon binding domain containing 3 protein_id : NP_080654.3

name	Wdr6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13878227 CCDS:CCDS23532.1 GeneID:83669 MGI:1930140
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : WD repeat domain 6 protein_id : NP_113569.1

name	4933406E20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981299 CCDS:CCDS23533.1 GeneID:74443 MGI:1921693
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] GO_function : GO:0005506 - iron ion binding [Evidence IEA]; GO:0031418 - L-ascorbic acid binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016706 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors [Evidence IEA]; GO:0016702 - oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0019538 - protein metabolism [Evidence IEA] codon_start : 1 product : hypoxia-inducible factor prolyl 4-hydroxylase protein_id : NP_083220.3

name	Arih2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753118 CCDS:CCDS23534.1 GeneID:23807 MGI:1344361
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IPI] codon_start : 1 note : ariadne 2 product : ariadne homolog 2 protein_id : NP_035920.1

name	ENSMUSG00000074075 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260313 GeneID:100038635 MGI:3642291
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476299.1

name	Slc25a20 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10048462 CCDS:CCDS23535.1 GeneID:57279 MGI:1928738
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IEA] [Evidence IDA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : mitochondrial carnitine-acylcarnitine translocase product : carnitine/acylcarnitine translocase protein_id : NP_065266.1

name	Prkar2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22550094 CCDS:CCDS23536.1 GeneID:19087 MGI:108025
definition	GO_component : GO:0005952 - cAMP-dependent protein kinase complex [Evidence IEA] GO_function : GO:0030552 - cAMP binding [Evidence IEA]; GO:0008603 - cAMP-dependent protein kinase regulator activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : protein kinase, cAMP dependent regulatory, type II alpha protein_id : NP_032950.1

name	Ihpk2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037447 CCDS:CCDS23537.1 GeneID:76500 MGI:1923750
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] [Evidence IDA] GO_function : GO:0050517 - inositol hexakisphosphate kinase activity [Evidence IEA]; GO:0008440 - inositol trisphosphate 3-kinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : inositol hexaphosphate kinase 2 protein_id : NP_083910.1

name	Nckipsd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49258190 CCDS:CCDS23538.1 GeneID:80987 MGI:1931834
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 note : Wiskott-Aldrich syndrome homolog (human) binding protein product : NCK interacting protein with SH3 domain protein_id : NP_109654.2

name	Celsr3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125719165 CCDS:CCDS23539.1 GeneID:107934 MGI:1858236
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007413 - axonal fasciculation [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007156 - homophilic cell adhesion [Evidence IEA]; GO:0007218 - neuropeptide signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : cadherin EGF LAG seven-pass G-type receptor 3 protein_id : NP_536685.2

name	Slc26a6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981655 GeneID:171429 MGI:2159728
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0015380 - anion exchanger activity [Evidence IDA]; GO:0015108 - chloride transporter activity [Evidence IDA]; GO:0015499 - formate transporter activity [Evidence IDA]; GO:0008271 - sulfate porter activity [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0015701 - bicarbonate transport [Evidence IDA]; GO:0006821 - chloride transport [Evidence IDA]; GO:0015724 - formate transport [Evidence IDA]; GO:0008272 - sulfate transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : solute carrier family 26, member 6 protein_id : NP_599252.2

name	LOC100038959 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260322 GeneID:100038959
definition	codon_start : 1 product : similar to chloride-formate exchanger protein_id : XP_001472030.1

name	Tmem89 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260324 GeneID:69384 MGI:1916634
definition	codon_start : 1 product : hypothetical protein LOC69384 protein_id : XP_135161.4

name	Uqcrc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46593021 CCDS:CCDS23540.1 GeneID:22273 MGI:107876
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005746 - mitochondrial electron transport chain [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0004222 - metalloendopeptidase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0008121 - ubiquinol-cytochrome-c reductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : ubiquinol-cytochrome c reductase core protein 1 protein_id : NP_079683.2

name	Col7a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115647999 GeneID:12836 MGI:88462
definition	GO_component : GO:0005581 - collagen [Evidence IEA]; GO:0005737 - cytoplasm [Evidence IEA]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0030020 - extracellular matrix structural constituent conferring tensile strength [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0006817 - phosphate transport [Evidence IEA] codon_start : 1 product : procollagen, type VII, alpha 1 protein_id : NP_031764.2

name	Pfkfb4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84662740 CCDS:CCDS23541.1 GeneID:270198 MGI:2687284
definition	GO_function : GO:0003873 - 6-phosphofructo-2-kinase activity [Evidence IEA] [Evidence ISS]; GO:0005524 - ATP binding [Evidence IEA]; GO:0004331 - fructose-2,6-bisphosphate 2-phosphatase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006003 - fructose 2,6-bisphosphate metabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : 6-phosphofructo-2-kinase/fructose-2, 6-biphosphatase 4 protein_id : NP_766607.3

name	Scotin (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703698 CCDS:CCDS23543.1 GeneID:66940 MGI:1915044
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IDA]; GO:0005635 - nuclear envelope [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0008632 - apoptotic program [Evidence IDA]; GO:0006917 - induction of apoptosis [Evidence IDA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : scotin isoform 1 protein_id : NP_080134.1

name	Scotin (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21746147 GeneID:66940 MGI:1915044
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IDA]; GO:0005635 - nuclear envelope [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0008632 - apoptotic program [Evidence IDA]; GO:0006917 - induction of apoptosis [Evidence IDA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : scotin isoform 2 protein_id : NP_080657.1

name	Trex1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:59624981 CCDS:CCDS23544.1 GeneID:22040 MGI:1328317
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005635 - nuclear envelope [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0008408 - 3'-5' exonuclease activity [Evidence ISS]; GO:0008853 - exodeoxyribonuclease III activity [Evidence IEA]; GO:0004527 - exonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0042803 - protein homodimerization activity [Evidence ISS]; GO:0003697 - single-stranded DNA binding [Evidence ISS] GO_process : GO:0006310 - DNA recombination [Evidence ISS]; GO:0006281 - DNA repair [Evidence IEA]; GO:0006260 - DNA replication [Evidence ISS]; GO:0006298 - mismatch repair [Evidence ISS]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 note : DNase III; trophoblast expressed 1; three prime exonuclease 1 product : three prime repair exonuclease 1 protein_id : NP_001012236.1

name	Trex1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:59624979 CCDS:CCDS23544.1 GeneID:22040 MGI:1328317
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005635 - nuclear envelope [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0008408 - 3'-5' exonuclease activity [Evidence ISS]; GO:0008853 - exodeoxyribonuclease III activity [Evidence IEA]; GO:0004527 - exonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0042803 - protein homodimerization activity [Evidence ISS]; GO:0003697 - single-stranded DNA binding [Evidence ISS] GO_process : GO:0006310 - DNA recombination [Evidence ISS]; GO:0006281 - DNA repair [Evidence IEA]; GO:0006260 - DNA replication [Evidence ISS]; GO:0006298 - mismatch repair [Evidence ISS]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 note : DNase III; trophoblast expressed 1; three prime exonuclease 1 product : three prime repair exonuclease 1 protein_id : NP_035767.4

name	6620401K05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27819649 CCDS:CCDS23545.1 GeneID:235610 MGI:1925349
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006281 - DNA repair [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 exception : mismatches in translation product : ATR interacting protein protein_id : NP_766362.1

name	Ccdc72 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34304024 GeneID:66167 MGI:1913417
definition	codon_start : 1 product : coiled-coil domain containing 72 protein_id : NP_899073.1

name	Ccdc51 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313384 GeneID:66658 MGI:1913908
definition	codon_start : 1 product : coiled-coil domain containing 51 protein_id : NP_079965.1

name	EG665413 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94386570 GeneID:665413 MGI:3643956
definition	codon_start : 1 product : hypothetical protein protein_id : XP_981851.1

name	Plxnb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370140 CCDS:CCDS23546.1 GeneID:235611 MGI:2154238
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0050772 - positive regulation of axonogenesis [Evidence IGI] codon_start : 1 exception : mismatches in translation product : plexin B1 protein_id : NP_766363.1

name	E330009P21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28892973 CCDS:CCDS23547.1 GeneID:320082 MGI:2443323
definition	GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : F-box domain containing protein protein_id : NP_796043.1

name	Fbxw13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29243960 CCDS:CCDS23548.1 GeneID:211305 MGI:3505590
definition	GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : F-box and WD-40 domain protein 13 protein_id : NP_808266.1

name	Fbxw12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56605676 CCDS:CCDS23549.1 GeneID:434440 MGI:3584372
definition	GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : F-box and WD-40 domain protein 12 protein_id : NP_001008428.1

name	LOC100042108 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149260316 GeneID:100042108
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 62 ESTs, 4 Proteins product : similar to Gcsh protein pseudo : _no_value transcript_id : XR_033694.1

name	LOC623859 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149260317 GeneID:623859
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 31 mRNAs, 1343 ESTs, 6 Proteins product : similar to MGC27348 protein pseudo : _no_value transcript_id : XR_033739.1

clone name	MSMg01-458B13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-234J09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-397G04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-506H22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-058K15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-331D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-369L09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-366J16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-124F11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-360L19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-526G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-362K19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-080P16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-445G16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-394N08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309D11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-183B21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-209J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-210G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-073B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-454N11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-159E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-483P02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-111O10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-061E14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-058J01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-052B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-264F15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505I03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-189J17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388O01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-519B01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-359M20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-291E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-161L20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-090N01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-052P22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-096I10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-367K21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-081G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-083D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-536N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-232D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-175K20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-180K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-482B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-509G20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471K04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-292J23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-407H12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-276C15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-051I08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-399O21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-155I01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-405E16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-469B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-461A11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-463B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-182B24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-511I16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-443L09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-271G09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-449E14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-205F01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-356K01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-303I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-206N04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-386A15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-533K19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-134I15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-513J07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-517E06
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-026O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348H10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166K17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280J03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331N20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250H09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126E08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-229G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052K21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-166O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-226E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218J15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068J11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-079P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098F22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003I23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-049H13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142E10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-026F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344I16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-028I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253G10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-048J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279L18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109P09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-025P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323P18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-127F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323M02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-218P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-153P10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099M01
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-214J19.b	B6Ng01-214J19.g
ACC	GA031817	GA031818
length	1,148	1,022
definition	B6Ng01-214J19.b	B6Ng01-214J19.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(108,169,895 - 108,171,043)	(108,018,315 - 108,019,326)
sequence	gaattcaaaccatactcacccttgctgtggggttcctgctgtatacaaac tttacattcagccaggcgtggtggcacacgcctttaatcccagcatttgg gaggcagaggcaggtggatttctgagttcgaggccagcctggtctacaaa gtgagttccaggacagccagggctatacagagaaaccctgtctcgaaacc cccccccccaaaaaaaaagaactttacattcctagagaggccaagtatgg ctcaactgagaggtgtcacccatgtcaacagttaagagcactgggtgttt ttcaggaggactcatgtttgattcggtgaacccacacaggtgaccagaaa tcatttgtaacttcagttgccttggtgcacaaagtcacatggtagtcaaa tatatatacaaacaaaagaccatacacattaaagtaaaaacaaataaatc tttaaaaagtaaaaataaagaaagcctggtggtctggtgtggtgactcac acctgtaatctcagttctgggcaggctggggcatgagaacttttcaaaag acagtttgggccacataggagttccagtgtagcctgaggtatatagaaaa gaaaaaaggacaggaaggagaaagaaggaaggaaagaaagaaggaaggag agataaaatgaaggaaaagaaaagaaatggagcgtggaaatgcagtgtct tacaatggaacacagaattggcagccagccgggcaagccgatggtgacgc taaaacttgcctactggcagtttctctcttatcagccatactttctgccc gggctgcaggacaatttgcctagtgttaagtccaaacaaagggaaccctt cccttgttctgacgtggctggacgggtctgccaggcactgttccaggcat gcttgctggtctggcatgtgagttagtagtctacccttggtcagccactg gtctagtcctgctctgtcagaagaggaggatgactcagccccagagccac actcttagaaggatagggcactgggcccttggtgcttcaacaacatgcca gaattaaagagcaggcctggtatcctaccttagaagaccagtattctgtc atgtgtttactggattggtctgagggagatgcatggtcttagctttca	gaattcttcatcagtcatgtctgcccgggctgggggctgaggtgggaggg gagacaagccgccttcgctgctgtcttccacgtagtcatgcctcagctgg ctgccaaagtcatctgaagactcagctgtgtcctgctgttccctctgacg tccccatgccaaggagtcgtcctcctctagaatgtcccccagttcctcat ccgagtcgaaggcctcgggcgtgatggacagggagtgaggacgccgtttc tggtcttcaaccgcactgctgctgctgcggggtggcttgctccattccgc actgggagctacagcctgggcctccagtgaagggcgcaagctactaccca ctttgtggagctccgaggggctgggtggacgtgggcctgtcacccctgca ctgtcaagctgttccacttcttgctgtacaacacctgtgatctcgctctg ggagctggagacaccgtcggaggagtagcctgtgtcactgaggctctgtg ggcttcgagacaggtcctgagaataaggcttggggactggttcctgcata gggtaaaaagcaggcatttactcctgatctcctgtcaatcccaaggacca cgggaaggggccctccacaccctaggggctatctctctggccccacataa cttacagacttcacagcaagagaaactttactagatgaatgtgtgggaga ccagcaaagtggcagacacaggacgtgtctccatcccacagactccagac cagctgaacttcatttgttgtttgttgttgttgtttgtgacagggtctct ctacagagccttggctgttcctagaactcaccaggtagactaggcttagc cttggaactcacaaagatcttgacctgcctctgccttccaaagttgttgg gactaaaaggagtgtgccatcatcccagttgatctactggaaacttaatc caaaaccctctttcaacttagggtgtctcatgtgacccaatagatctgtc ttaggcttcattgttagccttt
quality values	Open. Hide. 62 47 33 42 62 37 39 62 62 62 44 37 62 62 62 62 59 43 62 62 62 54 62 62 62 62 62 62 62 62 62 59 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 59 62 62 59 59 62 62 62 62 62 62 62 62 54 59 62 62 62 59 62 56 62 62 49 62 62 43 49 62 62 62 59 59 62 62 62 62 62 62 62 49 49 62 62 42 54 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 40 54 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 59 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 38 62 62 62 62 62 62 62 62 62 45 58 58 54 58 54 58 54 58 58 58 58 58 54 44 45 52 52 52 54 52 42 58 42 42 58 58 49 54 39 58 54 58 52 52 52 58 58 58 58 42 42 58 52 46 47 52 54 52 52 58 41 41 52 48 58 54 52 52 52 54 39 38 52 54 52 52 54 58 58 42 58 49 30 58 51 49 48 58 50 48 58 38 48 35 32 40 50 51 52 58 51 51 50 58 49 37 49 42 54 49 58 54 39 58 50 41 50 36 54 58 50 51 58 51 39 50 58 48 54 58 58 30 49 49 58 54 36 58 54 50 50 58 58 51 27 49 36 33 51 30 17 31 37 31 46 41 34 42 42 54 32 39 54 52 50 50 26 46 35 39 37 44 43 50 38 42 42 34 58 50 50 50 38 49 40 53 36 52 58 32 32 41 41 32 54 54 50 39 52 42 38 46 36 50 27 32 51 35 52 39 33 37 53 34 20 54 54 54 41 38 42 37 32 49 38 42 42 40 49 53 34 40 31 54 54 22 33 35 35 37 33 27 46 45 40 34 40 32 53 38 32 43 34 34 31 54 28 32 40 47 29 39 29 30 51 40 26 43 36 31 36 33 41 17 9 33 12 10 52 53 34 32 33 26 32 31 25 24 14 45 27 35 31 32 53 26 18 47 31 37 29 42 51 33 51 23 31 32 27 46 30 24 20 23 51 36 31 37 36 29 32 31 26 31 27 17 11 8 12 14 17 32 29 46 25 13 25 46 35 38 32 31 31 26 31 27 13 40 19 30 29 31 30 41 21 33 33 31 18 33 22 25 32 31 23 26 34 27 17 30 21 33 22 24 21 26 25 14 30 23 27 31 31 41 12 21 20 29 20 35 25 12 32 27 11 17 32 46 44 31 27 22 21 20 32 31 14 19 11 19 17 18 28 20 27 32 32 24 20 21 26 11 18 33 25 31 29 27 25 25 29 23 13 36 34 16 15 6 25 36 10 10 31 6 14 34 19 32 24 10 4 4 25 32 16 7 9 14 9 33 26 10 13 16 15 21 32 22 32 6 5 6 13 10 18 11 11 13 25 39 28 7 8 32 14 10 19 8 25 43 10 19 11 32 16 6 9 15 5 13 11 8 5 4 8 7 13 14 18 8 20 7 7 13 28 38 7 10 27 38 11 10 18 5 4 10 5 9 6 27 6 10 7 4 5 6 8 18 10 14 13 21 13 9 5 9 7 24 6 21 5 6 4 5 7 4 5 8 16 21 8 14 6 4 6 11 1 5 18 28 22 11 16 19 8 14 2 4 13 3 11 1 1 5 15 13 5 17 5 8 3 3 3 4 4 12 5 12 13 9 6 15 18 20 9 16 11 28 17 4 4	Open. Hide. 62 49 53 44 62 62 62 62 59 59 62 59 59 50 59 59 59 46 49 62 62 62 59 62 62 62 62 62 62 62 62 62 62 49 49 62 62 62 62 59 59 59 62 62 62 62 59 59 54 62 62 59 59 59 59 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 54 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 54 54 62 62 62 59 62 62 62 54 49 54 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 59 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 59 62 62 62 62 62 62 62 59 62 62 59 62 62 59 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 43 49 49 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 51 59 59 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 56 56 51 56 56 56 62 62 62 62 49 51 62 62 62 62 62 51 54 56 56 62 62 56 51 56 54 62 49 33 62 62 56 62 56 51 56 46 56 62 62 62 62 62 56 51 62 62 47 42 62 56 62 56 62 62 62 47 56 51 51 56 56 56 56 62 62 62 56 62 62 62 54 62 62 62 62 62 50 62 62 56 56 62 56 62 42 62 62 62 62 56 56 47 32 56 62 62 38 56 47 52 47 52 40 29 52 62 48 62 62 38 62 62 62 54 62 52 54 52 42 62 50 52 62 62 62 52 62 54 46 54 52 62 62 62 43 62 54 62 62 58 52 39 52 58 58 34 47 42 52 52 30 52 44 40 33 35 34 33 40 43 38 52 41 58 39 39 41 47 48 47 50 52 33 41 42 41 43 52 52 52 18 31 41 52 50 52 46 52 52 54 39 54 49 42 42 54 42 52 46 52 27 51 30 54 46 43 50 42 32 47 40 36 39 54 40 54 52 30 23 42 33 32 50 45 21 26 45 21 46 38 30 32 25 32 58 39 46 47 50 21 50 50 46 47 29 39 58 52 54 49 49 47 48 58 27 38 23 20 32 25 47 31 50 32 27 24 40 39 28 37 32 41 11 26 51 32 31 58 36 32 46 39 37 31 50 50 37 39 23 52 19 52 39 39 39 30 20 35 29 39 37 37 31 13 52 13 39 53 26 43 31 30 50 18 19 28 22 31 28 39 58 29 49 30 32 39 8 52 39 46 11 28 53 21 31 32 13 46 51 38 37 29 15 21 32 42 30 29 14 31 9 25 35 45 29 41 29 31 32 32 21 17 32 14 30 29 39 25 18 16 13 24 33 13 6 20 7 11 18 9 25 30 38 40 37 24 16 13 12 11 39 30 33 16 19 12 23 40 17 25 26 16 8 9 15 18 33 28 34 8 16 28 12 15 35 14 9 7 12 23 27 17 32 23 24 12 13 20 34 8 6 13 27 25 33 25 33 24 30 23 27 13 17 12 21 28 45 14 12 9 9 18 19 16 30 37 24 31 17 11 10 31 27 6 9 26 27 16 32 32 23 29 12 13 24 30 27 28 30 27 25 22 6 13 28 11 22 17 23 19 29 30 12 15 21 9 25 36 22 9 12 14 6 15 28 18 14 5 5 12 19 21 32 31 23 15 14 32 24 15 5 7 9 21 23 25 21 39 19 7 10 10 14 5 10 6 10 9 14 8 8 23 20 31 10 25 5 5 7 37 17 12 16 12 5 5 5 6 28 22 11 14 13 16 12 6 13 21 31 6 7 6 6 11 29 8 27 9

Alignment Information

BAC End 1

BAC End 2

seq1: chr9_108169895_108171043
seq2: B6Ng01-214J19.b_47_1194 (reverse)

seq1  TGAAAGCTAAGACCTTCGTTCTCCCTCAGACCAAATCCAGTAAACACCAT  50
      |||||||||||||| |   ||||||||||||| ||||||||||||| |||
seq2  TGAAAGCTAAGACCATGCATCTCCCTCAGACC-AATCCAGTAAACA-CAT  48

seq1  GAACAG-ATACTCGTTCTTCTAAGGTAGGATTCCAGGGCTTGCTCTTT-A  98
      | |||| ||||| | |||||||||||||||| ||| ||| |||||||| |
seq2  G-ACAGAATACT-GGTCTTCTAAGGTAGGATACCA-GGCCTGCTCTTTAA  95

seq1  TTCTGGCATGTTGCTGAGGCACCAAGGG-CCAGTGCCCTATCC-TCTAAG  146
      ||||||||||||| ||| |||||||||| |||||||||||||| ||||||
seq2  TTCTGGCATGTTGTTGAAGCACCAAGGGCCCAGTGCCCTATCCTTCTAAG  145

seq1  AGTGTGGCTCTTGGGGCTGAGTCTTCCTCCTCTTCTGACAGAGCAGGACT  196
      |||||||||| |||||||||||| ||||||||||||||||||||||||||
seq2  AGTGTGGCTC-TGGGGCTGAGTCATCCTCCTCTTCTGACAGAGCAGGACT  194

seq1  AGACCAGT-GCTGACCAAGGGTAGACTACTAACTCACATGCCAGACCAGC  245
      |||||||| |||||||||||||||||||||||||||||||||||||||||
seq2  AGACCAGTGGCTGACCAAGGGTAGACTACTAACTCACATGCCAGACCAGC  244

seq1  AAGCATGCCTGGAACAGTGCCTGGCAGACCCGTCCAGCCACGTCAGAACA  295
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGCATGCCTGGAACAGTGCCTGGCAGACCCGTCCAGCCACGTCAGAACA  294

seq1  AGGGAAGGGTTCCCTTTGTTTGGACTTAACACTAGGCAAATTGTCCTGCA  345
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGGAAGGGTTCCCTTTGTTTGGACTTAACACTAGGCAAATTGTCCTGCA  344

seq1  GCCCGGGCAGAAAGTATGGCTGATAAGAGAGAAACTGCCAGTAGGCAAGT  395
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCCGGGCAGAAAGTATGGCTGATAAGAGAGAAACTGCCAGTAGGCAAGT  394

seq1  TTTAGCGTCACCATCGGCTTGCCCGGCTGGCTGCCAATTCTGTGTTCCAT  445
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTAGCGTCACCATCGGCTTGCCCGGCTGGCTGCCAATTCTGTGTTCCAT  444

seq1  TGTAAGACACTGCATTTCCACGCTCCATTTCTTTTCTTTTCCTTCATTTT  495
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTAAGACACTGCATTTCCACGCTCCATTTCTTTTCTTTTCCTTCATTTT  494

seq1  ATCTCTCCTTCCTTCTTTCTTTCCTTCCTTCTTTCTCCTTCCTGTCCTTT  545
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCTCTCCTTCCTTCTTTCTTTCCTTCCTTCTTTCTCCTTCCTGTCCTTT  544

seq1  TTTCTTTTCTATATACCTCAGGCTACACTGGAACTCCTATGTGGCCCAAA  595
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCTTTTCTATATACCTCAGGCTACACTGGAACTCCTATGTGGCCCAAA  594

seq1  CTGTCTTTTGAAAAGTTCTCATGCCCCAGCCTGCCCAGAACTGAGATTAC  645
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTCTTTTGAAAAGTTCTCATGCCCCAGCCTGCCCAGAACTGAGATTAC  644

seq1  AGGTGTGAGTCACCACACCAGACCACCAGGCTTTCTTTATTTTTACTTTT  695
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGTGTGAGTCACCACACCAGACCACCAGGCTTTCTTTATTTTTACTTTT  694

seq1  TAAAGATTTATTTGTTTTTACTTTAATGTGTATGGTCTTTTGTTTGTATA  745
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAAGATTTATTTGTTTTTACTTTAATGTGTATGGTCTTTTGTTTGTATA  744

seq1  TATATTTGACTACCATGTGACTTTGTGCACCAAGGCAACTGAAGTTACAA  795
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATATTTGACTACCATGTGACTTTGTGCACCAAGGCAACTGAAGTTACAA  794

seq1  ATGATTTCTGGTCACCTGTGTGGGTTCACCGAATCAAACATGAGTCCTCC  845
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGATTTCTGGTCACCTGTGTGGGTTCACCGAATCAAACATGAGTCCTCC  844

seq1  TGAAAAACACCCAGTGCTCTTAACTGTTGACATGGGTGACACCTCTCAGT  895
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAAAAACACCCAGTGCTCTTAACTGTTGACATGGGTGACACCTCTCAGT  894

seq1  TGAGCCATACTTGGCCTCTCTAGGAATGTAAAGTTCTTTTTTTTTGGGGG  945
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGCCATACTTGGCCTCTCTAGGAATGTAAAGTTCTTTTTTTTTGGGGG  944

seq1  GGGGGGTTTCGAGACAGGGTTTCTCTGTATAGCCCTGGCTGTCCTGGAAC  995
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGGGGTTTCGAGACAGGGTTTCTCTGTATAGCCCTGGCTGTCCTGGAAC  994

seq1  TCACTTTGTAGACCAGGCTGGCCTCGAACTCAGAAATCCACCTGCCTCTG  1045
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCACTTTGTAGACCAGGCTGGCCTCGAACTCAGAAATCCACCTGCCTCTG  1044

seq1  CCTCCCAAATGCTGGGATTAAAGGCGTGTGCCACCACGCCTGGCTGAATG  1095
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCCCAAATGCTGGGATTAAAGGCGTGTGCCACCACGCCTGGCTGAATG  1094

seq1  TAAAGTTTGTATACAGCAGGAACCCCACAGCAAGGGTGAGTATGGTTTGA  1145
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAAGTTTGTATACAGCAGGAACCCCACAGCAAGGGTGAGTATGGTTTGA  1144

seq1  ATTC  1149
      ||||
seq2  ATTC  1148

seq1: chr9_108018315_108019326
seq2: B6Ng01-214J19.g_68_1089

seq1  GAATTCTTCATCAGTCATGTCTGCCCGGGCTGGGGGCTGAGGTGGGAGGG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTTCATCAGTCATGTCTGCCCGGGCTGGGGGCTGAGGTGGGAGGG  50

seq1  GAGACAAGCCGCCTTCGCTGCTGTCTTCCACGTAGTCATGCCTCAGCTGG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGACAAGCCGCCTTCGCTGCTGTCTTCCACGTAGTCATGCCTCAGCTGG  100

seq1  CTGCCAAAGTCATCTGAAGACTCAGCTGTGTCCTGCTGTTCCCTCTGACG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGCCAAAGTCATCTGAAGACTCAGCTGTGTCCTGCTGTTCCCTCTGACG  150

seq1  TCCCCATGCCAAGGAGTCGTCCTCCTCTAGAATGTCCCCCAGTTCCTCAT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCCCATGCCAAGGAGTCGTCCTCCTCTAGAATGTCCCCCAGTTCCTCAT  200

seq1  CCGAGTCGAAGGCCTCGGGCGTGATGGACAGGGAGTGAGGACGCCGTTTC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCGAGTCGAAGGCCTCGGGCGTGATGGACAGGGAGTGAGGACGCCGTTTC  250

seq1  TGGTCTTCAACCGCACTGCTGCTGCTGCGGGGTGGCTTGCTCCATTCCGC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGTCTTCAACCGCACTGCTGCTGCTGCGGGGTGGCTTGCTCCATTCCGC  300

seq1  ACTGGGAGCTACAGCCTGGGCCTCCAGTGAAGGGCGCAAGCTACTACCCA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGGGAGCTACAGCCTGGGCCTCCAGTGAAGGGCGCAAGCTACTACCCA  350

seq1  CTTTGTGGAGCTCCGAGGGGCTGGGTGGACGTGGGCCTGTCACCCCTGCA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTGTGGAGCTCCGAGGGGCTGGGTGGACGTGGGCCTGTCACCCCTGCA  400

seq1  CTGTCAAGCTGTTCCACTTCTTGCTGTACAACACCTGTGATCTCGCTCTG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTCAAGCTGTTCCACTTCTTGCTGTACAACACCTGTGATCTCGCTCTG  450

seq1  GGAGCTGGAGACACCGTCGGAGGAGTAGCCTGTGTCACTGAGGCTCTGTG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAGCTGGAGACACCGTCGGAGGAGTAGCCTGTGTCACTGAGGCTCTGTG  500

seq1  GGCTTCGAGACAGGTCCTGAGAATAAGGCTTGGGGACTGGTTCCTGCATA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCTTCGAGACAGGTCCTGAGAATAAGGCTTGGGGACTGGTTCCTGCATA  550

seq1  GGGTAAAAAGCAGGCATTTACTCCTGATCTCCTGTCAATCCCAAGGACCA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGTAAAAAGCAGGCATTTACTCCTGATCTCCTGTCAATCCCAAGGACCA  600

seq1  CGGGAAGGGGCCCTCCACACCCTAGGGGCTATCTCTCTGGCCCCACATAA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGGGAAGGGGCCCTCCACACCCTAGGGGCTATCTCTCTGGCCCCACATAA  650

seq1  CTTACAGACTTCACAGCAAGAGAAACTTTACTAGATGAATGTGTGGGAGA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTACAGACTTCACAGCAAGAGAAACTTTACTAGATGAATGTGTGGGAGA  700

seq1  CCAGCAAAGTGGCAGACACAGGACGTGTCTCCATCCCACAGACTCCAGAC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGCAAAGTGGCAGACACAGGACGTGTCTCCATCCCACAGACTCCAGAC  750

seq1  CAGCTGAACTTCATTTGTTGTTTGTTGTTGTTGTTTTGTGACAGGGTCTC  800
      ||||||||||||||||||||||||||||||||| ||||||||||||||||
seq2  CAGCTGAACTTCATTTGTTGTTTGTTGTTGTTG-TTTGTGACAGGGTCTC  799

seq1  TCTACAGAGCCTTGGCTG-TCCTAGAACTCACCAGGTAGACTAGGC-TAG  848
      |||||||||||||||||| ||||||||||||||||||||||||||| |||
seq2  TCTACAGAGCCTTGGCTGTTCCTAGAACTCACCAGGTAGACTAGGCTTAG  849

seq1  CCTT-GAACTCACAAAGATC-TGA-CTGCCTCTGCC-TCCAAAG-TGTTG  893
      |||| ||||||||||||||| ||| ||||||||||| ||||||| |||||
seq2  CCTTGGAACTCACAAAGATCTTGACCTGCCTCTGCCTTCCAAAGTTGTTG  899

seq1  GGACT-AAAGGAGTGTGCCATCATCCCAG-TGATCTACT-GAAACTTAAT  940
      ||||| ||||||||||||||||||||||| ||||||||| ||||||||||
seq2  GGACTAAAAGGAGTGTGCCATCATCCCAGTTGATCTACTGGAAACTTAAT  949

seq1  -CTAGACCCTCTTTCAAC-TAGGGTGTCTC-TGTGACCCCAATAGATCTG  987
       | | ||||||||||||| ||||||||||| ||||| |||||||||||||
seq2  CCAAAACCCTCTTTCAACTTAGGGTGTCTCATGTGA-CCCAATAGATCTG  998

seq1  TCTTAGGCCTACATTGTTAGCCCTT  1012
      ||||||| || ||||||||||| ||
seq2  TCTTAGG-CTTCATTGTTAGCCTTT  1022

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information