MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-318J16
Chromosome	9 (Build37)
Map Location	38,393,523 - 38,572,238
singlet/doublet	doublet
Overlap gene	Olfr913, Olfr914, Olfr915, Olfr916, Olfr917, Olfr918, GA_x5J8B7W60AJ-925630-926226, Olfr919, Loh11cr2a, Olfr920
Upstream gene	Spa17, Siae, Tbrg1, Panx3, LOC666881, EG627798, Olfr160, Olfr151, Olfr874, Olfr875, Olfr876, Olfr877, Olfr145, EG627852, Olfr878, GA_x5J8B7W60AJ-1667802-1666911, Olfr880-ps1, Olfr881, Olfr882-ps1, Olfr883, Olfr884, Olfr1550-ps1, Olfr885, Olfr886-ps1, Olfr887, Olfr888, Olfr889, Olfr890, Olfr891, Olfr892-ps1, Olfr893, Olfr894, Olfr143, Olfr895, Olfr896-ps1, Olfr897-ps1, Olfr25, Olfr898, Olfr899, Olfr900, Olfr147, Olfr901, Olfr902, Olfr903-ps1, Olfr904, Olfr905, Olfr906, Olfr907, Olfr908, Olfr909, Olfr910, Olfr912
Downstream gene	Olfr921, Olfr922, Olfr923, Olfr924, Olfr26, Olfr925-ps1, Olfr926, GA_x5J8B7W60AJ-719102-719883, Olfr928-ps1, GA_x5J8B7W60AJ-703922-704828, Olfr930, GA_x5J8B7W60AJ-666029-666595, Olfr1545-ps1, Olfr932-ps1, Olfr933, Olfr934, Olfr935, Olfr146, EG628171, Olfr937, LOC667260, Olfr938, Olfr939-ps1, GA_x5J8B7W60AJ-540286-540740, Olfr941-ps1, Olfr27, Olfr942-ps1, Olfr943, Olfr944, Olfr144, Olfr945, GA_x5J8B7W60AJ-354484-355428, Olfr947-ps1, Olfr948, LOC667312, Olfr949-ps1, Olfr950-ps1, Olfr951, Olfr952, Olfr953-ps1, Olfr954, Olfr955, Olfr956-ps1, Olfr44, Olfr957, Olfr958, Olfr959, AW551984, Olfr148, Olfr960, Olfr961, GA_x5J8B7W60AJ-4787-4010, Olfr963, Olfr964-ps1, Olfr149, Olfr965, Olfr966-ps1, Olfr150, Olfr967
Link	Open Mouse BAC browser

Click to get alignment info.

name	Spa17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20686 MGI:1333778
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Siae (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22619 MGI:104803
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tbrg1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21376 MGI:1100877
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Panx3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208098 MGI:1918881
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666881 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666881
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 Proteins pseudo : _no_value

name	EG627798 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627798 MGI:3643577
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 508 ESTs, 7 Proteins

name	Olfr160 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80706 MGI:1931271
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr151 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:406176 MGI:2661338
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr874 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258882 MGI:3030708
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr875 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258744 MGI:3030709
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr876 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258883 MGI:3030710
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr877 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258412 MGI:3030711
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr145 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258310 MGI:2177528
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG627852 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627852 MGI:3646260
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Olfr878 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258794 MGI:3030712
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W60AJ-1667802-1666911 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257796
definition	note : olfactory receptor GA_x5J8B7W60AJ-1667802-1666911 pseudo : _no_value

name	Olfr880-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404440 MGI:3030714
definition	note : olfactory receptor 880, pseudogene 1 pseudo : _no_value

name	Olfr881 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258413 MGI:3030715
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr882-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257995 MGI:3030716
definition	gene_synonym : MOR162-10P note : olfactory receptor 882, pseudogene 1 pseudo : _no_value

name	Olfr883 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258414 MGI:3030717
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr884 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257996 MGI:3030718
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1550-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257970 MGI:3031384
definition	gene_synonym : MOR162-11P note : olfactory receptor 1550, pseudogene 1 pseudo : _no_value

name	Olfr885 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257885 MGI:3030719
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr886-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257994 MGI:3030720
definition	gene_synonym : MOR0-12P note : olfactory receptor 886, pseudogene 1 pseudo : _no_value

name	Olfr887 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258415 MGI:3030721
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr888 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258416 MGI:3030722
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr889 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258475 MGI:3030723
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr890 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258474 MGI:3030724
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr891 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258471 MGI:3030725
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr892-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257911 MGI:3030726
definition	gene_synonym : MOR170-12 note : olfactory receptor 892, pseudogene 1 pseudo : _no_value

name	Olfr893 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258333 MGI:3030727
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr894 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258868 MGI:3030728
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr143 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258802 MGI:2177526
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr895 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258875 MGI:3030729
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr896-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258030 MGI:3030730
definition	gene_synonym : MOR170-10P note : olfactory receptor 896, pseudogene 1 pseudo : _no_value

name	Olfr897-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258473 MGI:3030731
definition	gene_synonym : MOR170-7 note : olfactory receptor 897, pseudogene 1 pseudo : _no_value

name	Olfr25 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18323 MGI:109310
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr898 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258871 MGI:3030732
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr899 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258472 MGI:3030733
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr900 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258874 MGI:3030734
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr147 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258869 MGI:2660712
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr901 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258028 MGI:3030735
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr902 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258798 MGI:3030736
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr903-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404441 MGI:3030737
definition	note : olfactory receptor 903, pseudogene 1 pseudo : _no_value

name	Olfr904 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258797 MGI:3030738
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr905 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258800 MGI:3030739
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr906 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258799 MGI:3030740
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr907 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258801 MGI:3030741
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr908 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258872 MGI:3030742
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr909 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258873 MGI:3030743
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr910 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258807 MGI:3030744
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr912 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258806 MGI:3030746
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr913 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258225 MGI:3030747
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr914 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258782 MGI:3030748
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr915 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258781 MGI:3030749
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr916 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258780 MGI:3030750
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr917 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258183 MGI:3030751
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr918 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258372 MGI:3030752
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W60AJ-925630-926226 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257789
definition	note : olfactory receptor GA_x5J8B7W60AJ-925630-926226 pseudo : _no_value

name	Olfr919 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258432 MGI:3030753
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Loh11cr2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67776 MGI:1915026
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr920 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258783 MGI:3030754
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr921 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258778 MGI:3030755
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr922 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258777 MGI:3030756
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr923 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258812 MGI:3030757
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr924 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404322 MGI:3030758
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr26 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18324 MGI:109309
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr925-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258013 MGI:3030759
definition	gene_synonym : MOR171-36P note : olfactory receptor 925, pseudogene 1 pseudo : _no_value

name	Olfr926 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258811 MGI:3030760
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W60AJ-719102-719883 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257790
definition	note : olfactory receptor GA_x5J8B7W60AJ-719102-719883 pseudo : _no_value

name	Olfr928-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404443 MGI:3030762
definition	note : olfactory receptor 928, pseudogene 1 pseudo : _no_value

name	GA_x5J8B7W60AJ-703922-704828 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257791
definition	note : olfactory receptor GA_x5J8B7W60AJ-703922-704828 pseudo : _no_value

name	Olfr930 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258269 MGI:3030764
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W60AJ-666029-666595 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257792
definition	note : olfactory receptor GA_x5J8B7W60AJ-666029-666595 pseudo : _no_value

name	Olfr1545-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258000 MGI:3031379
definition	gene_synonym : MOR171-39P note : olfactory receptor 1545, pseudogene 1 pseudo : _no_value

name	Olfr932-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404446 MGI:3030766
definition	note : olfactory receptor 932, pseudogene 1 pseudo : _no_value

name	Olfr933 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258433 MGI:3030767
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr934 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258434 MGI:3030768
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr935 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258741 MGI:3030769
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr146 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258742 MGI:2660711
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG628171 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628171 MGI:3646521
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1822 Proteins

name	Olfr937 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258431 MGI:3030771
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667260 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667260
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 716 ESTs, 20 Proteins pseudo : _no_value

name	Olfr938 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258430 MGI:3030772
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr939-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404447 MGI:3030773
definition	note : olfactory receptor 939, pseudogene 1 pseudo : _no_value

name	GA_x5J8B7W60AJ-540286-540740 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257793
definition	note : olfactory receptor GA_x5J8B7W60AJ-540286-540740 pseudo : _no_value

name	Olfr941-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258014 MGI:3030775
definition	gene_synonym : MOR171-35P note : olfactory receptor 941, pseudogene 1 pseudo : _no_value

name	Olfr27 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258826 MGI:109308
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr942-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404449 MGI:3030776
definition	note : olfactory receptor 942, pseudogene 1 pseudo : _no_value

name	Olfr943 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258323 MGI:3030777
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr944 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258500 MGI:3030778
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr144 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257959 MGI:2177527
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr945 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258499 MGI:3030779
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W60AJ-354484-355428 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257795
definition	note : olfactory receptor GA_x5J8B7W60AJ-354484-355428 pseudo : _no_value

name	Olfr947-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257924 MGI:3030781
definition	gene_synonym : MOR171-43 note : olfactory receptor 947, pseudogene 1 pseudo : _no_value

name	Olfr948 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257912 MGI:3030782
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667312 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667312
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Olfr949-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258194 MGI:3030783
definition	gene_synonym : MOR171-26P note : olfactory receptor 949, pseudogene 1 pseudo : _no_value

name	Olfr950-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404451 MGI:3030784
definition	note : olfactory receptor 950, pseudogene 1 pseudo : _no_value

name	Olfr951 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258046 MGI:3030785
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr952 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235248 MGI:3030786
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr953-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404452 MGI:3030787
definition	note : olfactory receptor 953, pseudogene 1 pseudo : _no_value

name	Olfr954 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258328 MGI:3030788
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr955 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258242 MGI:3030789
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr956-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257993 MGI:3030790
definition	gene_synonym : MOR171-40P note : olfactory receptor 956, pseudogene 1 pseudo : _no_value

name	Olfr44 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18343 MGI:1333829
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr957 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258740 MGI:3030791
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr958 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258327 MGI:3030792
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr959 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258501 MGI:3030793
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AW551984 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244810 MGI:2143322
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr148 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258498 MGI:2660713
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr960 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258276 MGI:3030794
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr961 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258497 MGI:3030795
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W60AJ-4787-4010 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257794
definition	note : olfactory receptor GA_x5J8B7W60AJ-4787-4010 pseudo : _no_value

name	Olfr963 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258087 MGI:3030797
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr964-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258855 MGI:3030798
definition	gene_synonym : MOR224-1 note : olfactory receptor 964, pseudogene 1 pseudo : _no_value

name	Olfr149 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235256 MGI:2660716
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr965 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258165 MGI:3030799
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr966-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258001 MGI:3030800
definition	gene_synonym : MOR171-38P note : olfactory receptor 966, pseudogene 1 pseudo : _no_value

name	Olfr150 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258602 MGI:2659178
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 680 Proteins

name	Olfr967 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258086 MGI:3030801
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Spa17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755613 GeneID:20686 MGI:1333778
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sperm autoantigenic protein 17 transcript_id : NM_011449.1

name	Siae (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802058 GeneID:22619 MGI:104803
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sialic acid acetylesterase transcript_id : NM_011734.3

name	Tbrg1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:54607162 GeneID:21376 MGI:1100877
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transforming growth factor beta regulated gene 1 transcript_id : NM_025289.2

name	Panx3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86262154 GeneID:208098 MGI:1918881
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pannexin 3 transcript_id : NM_172454.2

name	EG627798 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94386060 GeneID:627798 MGI:3643577
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 507 ESTs, 7 Proteins product : predicted gene, EG627798 transcript_id : XM_892497.2

name	Olfr160 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13386471 GeneID:80706 MGI:1931271
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 160 transcript_id : NM_030553.1

name	Olfr151 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46575898 GeneID:406176 MGI:2661338
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 151 transcript_id : NM_207664.1

name	Olfr874 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115529464 GeneID:258882 MGI:3030708
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 874 transcript_id : NM_146882.2

name	Olfr875 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129346 GeneID:258744 MGI:3030709
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 875 transcript_id : NM_146749.1

name	Olfr876 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129116 GeneID:258883 MGI:3030710
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 876 transcript_id : NM_146883.1

name	Olfr877 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239251 GeneID:258412 MGI:3030711
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 877 transcript_id : NM_146417.1

name	Olfr145 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49170037 GeneID:258310 MGI:2177528
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 145 transcript_id : NM_146313.1

name	EG627852 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149259878 GeneID:627852 MGI:3646260
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG627852 transcript_id : XM_892556.2

name	Olfr878 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129256 GeneID:258794 MGI:3030712
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 878 transcript_id : NM_146798.1

name	Olfr881 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239239 GeneID:258413 MGI:3030715
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 881 transcript_id : NM_146418.1

name	Olfr883 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112982849 GeneID:258414 MGI:3030717
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 883 transcript_id : NM_146419.2

name	Olfr884 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801361 GeneID:257996 MGI:3030718
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 884 transcript_id : NM_001011798.1

name	Olfr885 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801271 GeneID:257885 MGI:3030719
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 885 transcript_id : NM_001011739.1

name	Olfr887 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239243 GeneID:258415 MGI:3030721
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 887 transcript_id : NM_146423.1

name	Olfr888 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239241 GeneID:258416 MGI:3030722
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 888 transcript_id : NM_146424.1

name	Olfr889 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239245 GeneID:258475 MGI:3030723
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 889 transcript_id : NM_146482.1

name	Olfr890 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239247 GeneID:258474 MGI:3030724
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 890 transcript_id : NM_146481.1

name	Olfr891 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121582634 GeneID:258471 MGI:3030725
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 891 transcript_id : NM_146478.2

name	Olfr893 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129624 GeneID:258333 MGI:3030727
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 893 transcript_id : NM_146336.1

name	Olfr894 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129136 GeneID:258868 MGI:3030728
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 894 transcript_id : NM_146868.1

name	Olfr143 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121583730 GeneID:258802 MGI:2177526
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 143 transcript_id : NM_146806.2

name	Olfr895 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129130 GeneID:258875 MGI:3030729
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 895 transcript_id : NM_146875.1

name	Olfr25 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22380658 GeneID:18323 MGI:109310
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 25 transcript_id : NM_146870.1

name	Olfr898 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129138 GeneID:258871 MGI:3030732
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 898 transcript_id : NM_146871.1

name	Olfr899 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239235 GeneID:258472 MGI:3030733
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 899 transcript_id : NM_146479.1

name	Olfr900 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129128 GeneID:258874 MGI:3030734
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 900 transcript_id : NM_146874.1

name	Olfr147 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49170055 GeneID:258869 MGI:2660712
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 147 transcript_id : NM_146869.1

name	Olfr901 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801377 GeneID:258028 MGI:3030735
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 901 transcript_id : NM_001011806.1

name	Olfr902 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129252 GeneID:258798 MGI:3030736
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 902 transcript_id : NM_146802.1

name	Olfr904 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116174757 GeneID:258797 MGI:3030738
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 904 transcript_id : NM_146801.2

name	Olfr905 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129248 GeneID:258800 MGI:3030739
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 905 transcript_id : NM_146804.1

name	Olfr906 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116174751 GeneID:258799 MGI:3030740
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 906 transcript_id : NM_146803.2

name	Olfr907 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129242 GeneID:258801 MGI:3030741
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 907 transcript_id : NM_146805.1

name	Olfr908 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129132 GeneID:258872 MGI:3030742
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 908 transcript_id : NM_146872.1

name	Olfr909 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129134 GeneID:258873 MGI:3030743
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 909 transcript_id : NM_146873.1

name	Olfr910 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129236 GeneID:258807 MGI:3030744
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 910 transcript_id : NM_146811.1

name	Olfr912 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110681705 GeneID:258806 MGI:3030746
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 912 transcript_id : NM_146810.2

name	Olfr913 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58372119 GeneID:258225 MGI:3030747
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 913 transcript_id : NM_001011523.1

name	Olfr914 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121583648 GeneID:258782 MGI:3030748
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 914 transcript_id : NM_146786.2

name	Olfr915 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129278 GeneID:258781 MGI:3030749
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 915 transcript_id : NM_146785.1

name	Olfr916 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129284 GeneID:258780 MGI:3030750
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 916 transcript_id : NM_146784.1

name	Olfr917 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801489 GeneID:258183 MGI:3030751
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 917 transcript_id : NM_001011864.1

name	Olfr918 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129550 GeneID:258372 MGI:3030752
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 918 transcript_id : NM_146375.1

name	Olfr919 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239209 GeneID:258432 MGI:3030753
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 919 transcript_id : NM_146440.1

name	Loh11cr2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254243 GeneID:67776 MGI:1915026
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : loss of heterozygosity, 11, chromosomal region 2, gene A homolog (human) transcript_id : NM_172767.2

name	Olfr920 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129274 GeneID:258783 MGI:3030754
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 920 transcript_id : NM_146787.1

name	Olfr921 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129282 GeneID:258778 MGI:3030755
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 921 transcript_id : NM_146782.1

name	Olfr922 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129288 GeneID:258777 MGI:3030756
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 922 transcript_id : NM_146781.1

name	Olfr923 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129228 GeneID:258812 MGI:3030757
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 923 transcript_id : NM_146816.1

name	Olfr924 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46430571 GeneID:404322 MGI:3030758
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 924 transcript_id : NM_207560.1

name	Olfr26 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49170057 GeneID:18324 MGI:109309
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 26 transcript_id : NM_146783.1

name	Olfr926 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129226 GeneID:258811 MGI:3030760
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 926 transcript_id : NM_146815.1

name	Olfr930 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129742 GeneID:258269 MGI:3030764
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 930 transcript_id : NM_146272.1

name	Olfr933 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239215 GeneID:258433 MGI:3030767
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 933 transcript_id : NM_146441.1

name	Olfr934 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239051 GeneID:258434 MGI:3030768
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 934 transcript_id : NM_146442.1

name	Olfr935 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129352 GeneID:258741 MGI:3030769
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 935 transcript_id : NM_146746.1

name	Olfr146 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239231 GeneID:258742 MGI:2660711
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 146 transcript_id : NM_146747.1

name	EG628171 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149259888 GeneID:628171 MGI:3646521
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1822 Proteins product : predicted gene, EG628171 transcript_id : XM_892905.2

name	Olfr937 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239211 GeneID:258431 MGI:3030771
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 937 transcript_id : NM_146439.1

name	Olfr938 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239205 GeneID:258430 MGI:3030772
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 938 transcript_id : NM_146438.1

name	Olfr27 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126215541 GeneID:258826 MGI:109308
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 27 transcript_id : NM_146829.2

name	Olfr943 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22380648 GeneID:258323 MGI:3030777
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 943 transcript_id : NM_146326.1

name	Olfr944 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239219 GeneID:258500 MGI:3030778
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 944 transcript_id : NM_146507.1

name	Olfr144 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46575900 GeneID:257959 MGI:2177527
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 144 transcript_id : NM_207665.1

name	Olfr945 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239213 GeneID:258499 MGI:3030779
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 945 transcript_id : NM_146506.1

name	Olfr948 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801299 GeneID:257912 MGI:3030782
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 948 transcript_id : NM_001011756.1

name	Olfr951 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801389 GeneID:258046 MGI:3030785
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 951 transcript_id : NM_001011812.1

name	Olfr952 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27544958 GeneID:235248 MGI:3030786
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 952 transcript_id : NM_146503.1

name	Olfr954 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129637 GeneID:258328 MGI:3030788
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 954 transcript_id : NM_146331.1

name	Olfr955 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46369484 GeneID:258242 MGI:3030789
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 955 transcript_id : NM_207141.1

name	Olfr44 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134948544 GeneID:18343 MGI:1333829
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 44 transcript_id : NM_146830.2

name	Olfr957 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129350 GeneID:258740 MGI:3030791
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 957 transcript_id : NM_146745.1

name	Olfr958 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129633 GeneID:258327 MGI:3030792
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 958 transcript_id : NM_146330.1

name	Olfr959 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27544952 GeneID:258501 MGI:3030793
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 959 transcript_id : NM_146508.1

name	AW551984 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142360631 GeneID:244810 MGI:2143322
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AW551984 transcript_id : NM_178737.4

name	Olfr148 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22203774 GeneID:258498 MGI:2660713
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 148 transcript_id : NM_146505.1

name	Olfr960 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129724 GeneID:258276 MGI:3030794
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 960 transcript_id : NM_146279.1

name	Olfr961 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239049 GeneID:258497 MGI:3030795
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 961 transcript_id : NM_146504.1

name	Olfr963 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801417 GeneID:258087 MGI:3030797
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 963 transcript_id : NM_001011827.1

name	Olfr149 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:54261731 GeneID:235256 MGI:2660716
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 149 transcript_id : NM_207138.1

name	Olfr965 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801475 GeneID:258165 MGI:3030799
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 965 transcript_id : NM_001011859.1

name	Olfr150 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149259893 GeneID:258602 MGI:2659178
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 680 Proteins product : olfactory receptor 150 transcript_id : XM_146788.5

name	Olfr967 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801415 GeneID:258086 MGI:3030801
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 967 transcript_id : NM_001011826.1

name	Spa17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755614 CCDS:CCDS22982.1 GeneID:20686 MGI:1333778
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008603 - cAMP-dependent protein kinase regulator activity [Evidence IEA] GO_process : GO:0007339 - binding of sperm to zona pellucida [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : band 34 product : sperm autoantigenic protein 17 protein_id : NP_035579.1

name	Siae (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560532 CCDS:CCDS22983.1 GeneID:22619 MGI:104803
definition	GO_component : GO:0005764 - lysosome [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004759 - serine esterase activity [Evidence IEA]; GO:0001681 - sialate O-acetylesterase activity [Evidence IEA] codon_start : 1 note : clone 165 product : yolk sac gene 2 protein_id : NP_035864.2

name	Tbrg1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:42476294 GeneID:21376 MGI:1100877
definition	codon_start : 1 product : transforming growth factor beta regulated gene 1 protein_id : NP_079565.1

name	Panx3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:86262155 CCDS:CCDS22984.1 GeneID:208098 MGI:1918881
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : pannexin 3 protein_id : NP_766042.2

name	EG627798 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82929887 GeneID:627798 MGI:3643577
definition	codon_start : 1 product : hypothetical protein protein_id : XP_897590.1

name	Olfr160 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386472 GeneID:80706 MGI:1931271
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS] GO_function : GO:0004984 - olfactory receptor activity [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : olfactory receptor 7b; GA_x6K02T2PVTD-31389446-31388517; olfactory receptor MOR171-3 product : olfactory receptor 160 protein_id : NP_085030.1

name	Olfr151 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46575899 GeneID:406176 MGI:2661338
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : GA_x6K02T2PVTD-31408136-31407207; M71 odorant receptor product : olfactory receptor 151 protein_id : NP_997547.1

name	Olfr874 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115529465 CCDS:CCDS22986.1 GeneID:258882 MGI:3030708
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-31428850-31429782; olfactory receptor MOR161-2; odorant receptor K22 product : olfactory receptor 874 protein_id : NP_667093.2

name	Olfr875 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129347 CCDS:CCDS22987.1 GeneID:258744 MGI:3030709
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PVTD-31458511-31459443; olfactory receptor MOR161-4 product : olfactory receptor 875 protein_id : NP_666960.1

name	Olfr876 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129117 CCDS:CCDS22988.1 GeneID:258883 MGI:3030710
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PVTD-31489645-31490577; olfactory receptor MOR161-1 product : olfactory receptor 876 protein_id : NP_667094.1

name	Olfr877 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239252 CCDS:CCDS22989.1 GeneID:258412 MGI:3030711
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-31540342-31541277; olfactory receptor MOR161-5 product : olfactory receptor 877 protein_id : NP_666529.1

name	Olfr145 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49170038 CCDS:CCDS22990.1 GeneID:258310 MGI:2177528
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-31578734-31579666; olfactory receptor MOR161-6 product : olfactory receptor 145 protein_id : NP_666425.1

name	EG627852 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149259879 GeneID:627852 MGI:3646260
definition	codon_start : 1 product : similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) protein_id : XP_897649.2

name	Olfr878 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129257 CCDS:CCDS22991.1 GeneID:258794 MGI:3030712
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-31600511-31601440; olfactory receptor MOR163-1 product : olfactory receptor 878 protein_id : NP_667009.1

name	Olfr881 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239240 CCDS:CCDS22992.1 GeneID:258413 MGI:3030715
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-31676771-31677700; olfactory receptor MOR162-7 product : olfactory receptor 881 protein_id : NP_666530.1

name	Olfr883 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239238 CCDS:CCDS22993.1 GeneID:258414 MGI:3030717
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-31705144-31706073; olfactory receptor MOR162-6 product : olfactory receptor 883 protein_id : NP_666531.1

name	Olfr884 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801362 CCDS:CCDS22994.1 GeneID:257996 MGI:3030718
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-31726544-31727473; olfactory receptor MOR162-9P product : olfactory receptor 884 protein_id : NP_001011798.1

name	Olfr885 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801272 CCDS:CCDS22995.1 GeneID:257885 MGI:3030719
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-31740639-31741568; olfactory receptor MOR162-12 product : olfactory receptor 885 protein_id : NP_001011739.1

name	Olfr887 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239244 CCDS:CCDS22996.1 GeneID:258415 MGI:3030721
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-31764095-31765024; olfactory receptor MOR162-5 product : olfactory receptor 887 protein_id : NP_666634.1

name	Olfr888 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239242 CCDS:CCDS22997.1 GeneID:258416 MGI:3030722
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-31787920-31788864; olfactory receptor MOR162-4 product : olfactory receptor 888 protein_id : NP_666635.1

name	Olfr889 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239246 GeneID:258475 MGI:3030723
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-31795028-31795957; olfactory receptor MOR162-2 product : olfactory receptor 889 protein_id : NP_666693.1

name	Olfr890 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239248 CCDS:CCDS22998.1 GeneID:258474 MGI:3030724
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PVTD-31822365-31823309; MOR162-15_p; olfactory receptor MOR162-3 product : olfactory receptor 890 protein_id : NP_666692.1

name	Olfr891 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121582635 CCDS:CCDS22999.1 GeneID:258471 MGI:3030725
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-31862167-31861217; olfactory receptor MOR170-9 product : olfactory receptor 891 protein_id : NP_666689.2

name	Olfr893 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129625 CCDS:CCDS23000.1 GeneID:258333 MGI:3030727
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PVTD-31889215-31890153; olfactory receptor MOR170-11 product : olfactory receptor 893 protein_id : NP_666448.1

name	Olfr894 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129137 CCDS:CCDS23001.1 GeneID:258868 MGI:3030728
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-31898993-31899934; olfactory receptor MOR170-5 product : olfactory receptor 894 protein_id : NP_667079.1

name	Olfr143 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121583731 CCDS:CCDS23002.1 GeneID:258802 MGI:2177526
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-31941084-31942025; olfactory receptor MOR170-6 product : olfactory receptor 143 protein_id : NP_667017.2

name	Olfr895 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129131 CCDS:CCDS23003.1 GeneID:258875 MGI:3030729
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PVTD-31962461-31963411; olfactory receptor MOR170-1 product : olfactory receptor 895 protein_id : NP_667086.1

name	Olfr25 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22380659 CCDS:CCDS23004.1 GeneID:18323 MGI:109310
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : olfactory receptor MOR170-4; GA_x6K02T2PVTD-32017922-32018863 product : olfactory receptor 25 protein_id : NP_667081.1

name	Olfr898 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129139 CCDS:CCDS23005.1 GeneID:258871 MGI:3030732
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PVTD-32037624-32038565; olfactory receptor MOR170-3 product : olfactory receptor 898 protein_id : NP_667082.1

name	Olfr899 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239236 GeneID:258472 MGI:3030733
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : GA_x6K02T2PVTD-32060891-32061865; olfactory receptor MOR170-8 product : olfactory receptor 899 protein_id : NP_666690.1

name	Olfr900 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129129 GeneID:258874 MGI:3030734
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : GA_x6K02T2PVTD-32071567-32072508; olfactory receptor MOR170-2 product : olfactory receptor 900 protein_id : NP_667085.1

name	Olfr147 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49170056 CCDS:CCDS23008.1 GeneID:258869 MGI:2660712
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-32098059-32099003; olfactory receptor MOR164-1 product : olfactory receptor 147 protein_id : NP_667080.1

name	Olfr901 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801378 CCDS:CCDS23009.1 GeneID:258028 MGI:3030735
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-32123032-32123967; olfactory receptor MOR162-8 product : olfactory receptor 901 protein_id : NP_001011806.1

name	Olfr902 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129253 GeneID:258798 MGI:3030736
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : GA_x6K02T2PVTD-32141623-32142552; olfactory receptor MOR169-1 product : olfactory receptor 902 protein_id : NP_667013.1

name	Olfr904 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116174758 CCDS:CCDS23011.1 GeneID:258797 MGI:3030738
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-32156773-32157705; olfactory receptor MOR167-3 product : olfactory receptor 904 protein_id : NP_667012.2

name	Olfr905 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129249 CCDS:CCDS23012.1 GeneID:258800 MGI:3030739
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PVTD-32165709-32166641; olfactory receptor MOR167-1 product : olfactory receptor 905 protein_id : NP_667015.1

name	Olfr906 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116174752 CCDS:CCDS23013.1 GeneID:258799 MGI:3030740
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-32194085-32195020; olfactory receptor MOR167-2 product : olfactory receptor 906 protein_id : NP_667014.2

name	Olfr907 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129243 CCDS:CCDS23014.1 GeneID:258801 MGI:3030741
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PVTD-32204729-32205661; olfactory receptor MOR165-5 product : olfactory receptor 907 protein_id : NP_667016.1

name	Olfr908 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129133 GeneID:258872 MGI:3030742
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : GA_x6K02T2PVTD-32216179-32217111; olfactory receptor MOR165-2 product : olfactory receptor 908 protein_id : NP_667083.1

name	Olfr909 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129135 CCDS:CCDS23015.1 GeneID:258873 MGI:3030743
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PVTD-32223906-32224841; olfactory receptor MOR165-1 product : olfactory receptor 909 protein_id : NP_667084.1

name	Olfr910 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129237 CCDS:CCDS23016.1 GeneID:258807 MGI:3030744
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-32239063-32239995; olfactory receptor MOR165-3 product : olfactory receptor 910 protein_id : NP_667022.1

name	Olfr912 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110681706 CCDS:CCDS23017.1 GeneID:258806 MGI:3030746
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-32283590-32284522; olfactory receptor MOR165-4 product : olfactory receptor 912 protein_id : NP_667021.2

name	Olfr913 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58372120 CCDS:CCDS23018.1 GeneID:258225 MGI:3030747
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PVTD-32296575-32297513; olfactory receptor MOR165-9P product : olfactory receptor 913 protein_id : NP_001011523.1

name	Olfr914 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121583649 CCDS:CCDS23019.1 GeneID:258782 MGI:3030748
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-32308823-32309773; olfactory receptor MOR165-7 product : olfactory receptor 914 protein_id : NP_666997.2

name	Olfr915 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129279 GeneID:258781 MGI:3030749
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : GA_x6K02T2PVTD-32349884-32348952; olfactory receptor MOR167-4 product : olfactory receptor 915 protein_id : NP_666996.1

name	Olfr916 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129285 CCDS:CCDS23020.1 GeneID:258780 MGI:3030750
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-32360710-32359778; olfactory receptor MOR168-1 product : olfactory receptor 916 protein_id : NP_666995.1

name	Olfr917 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801490 CCDS:CCDS23021.1 GeneID:258183 MGI:3030751
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-32368166-32367237; olfactory receptor MOR168-2P product : olfactory receptor 917 protein_id : NP_001011864.1

name	Olfr918 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129551 CCDS:CCDS23022.1 GeneID:258372 MGI:3030752
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PVTD-32375756-32374818; olfactory receptor MOR164-3 product : olfactory receptor 918 protein_id : NP_666487.1

name	Olfr919 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239210 CCDS:CCDS23023.1 GeneID:258432 MGI:3030753
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-32400678-32399743; olfactory receptor MOR171-23 product : olfactory receptor 919 protein_id : NP_666651.1

name	Loh11cr2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254244 CCDS:CCDS23024.1 GeneID:67776 MGI:1915026
definition	GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0045786 - negative regulation of progression through cell cycle [Evidence IEA] codon_start : 1 exception : mismatches in translation product : loss of heterozygosity, 11, chromosomal region 2, gene A homolog protein_id : NP_766355.2

name	Olfr920 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129275 CCDS:CCDS23025.1 GeneID:258783 MGI:3030754
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PVTD-32458442-32459374; olfactory receptor MOR165-6 product : olfactory receptor 920 protein_id : NP_666998.1

name	Olfr921 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129283 CCDS:CCDS23026.1 GeneID:258778 MGI:3030755
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PVTD-32478047-32478988; olfactory receptor MOR165-8 product : olfactory receptor 921 protein_id : NP_666993.1

name	Olfr922 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129289 CCDS:CCDS23027.1 GeneID:258777 MGI:3030756
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-32518237-32519172; olfactory receptor MOR161-3 product : olfactory receptor 922 protein_id : NP_666992.1

name	Olfr923 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129229 CCDS:CCDS23028.1 GeneID:258812 MGI:3030757
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PVTD-32530445-32531380; olfactory receptor MOR164-2 product : olfactory receptor 923 protein_id : NP_667027.1

name	Olfr924 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46430572 CCDS:CCDS23029.1 GeneID:404322 MGI:3030758
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-32543982-32544908 product : olfactory receptor 924 protein_id : NP_997443.1

name	Olfr26 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49170058 CCDS:CCDS23030.1 GeneID:18324 MGI:109309
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : olfactory receptor MOR171-9; GA_x6K02T2PVTD-32550930-32551856 product : olfactory receptor 26 protein_id : NP_666994.1

name	Olfr926 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129227 CCDS:CCDS23031.1 GeneID:258811 MGI:3030760
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-32573036-32573962; olfactory receptor MOR171-8 product : olfactory receptor 926 protein_id : NP_667026.1

name	Olfr930 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129743 CCDS:CCDS23032.1 GeneID:258269 MGI:3030764
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-32626123-32627049; olfactory receptor MOR171-46 product : olfactory receptor 930 protein_id : NP_666384.1

name	Olfr933 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239216 CCDS:CCDS23033.1 GeneID:258433 MGI:3030767
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-32671531-32672457; olfactory receptor MOR171-22 product : olfactory receptor 933 protein_id : NP_666652.1

name	Olfr934 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239052 CCDS:CCDS23034.1 GeneID:258434 MGI:3030768
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-32678895-32677963; olfactory receptor MOR224-6 product : olfactory receptor 934 protein_id : NP_666653.1

name	Olfr935 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129353 CCDS:CCDS23035.1 GeneID:258741 MGI:3030769
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-32691280-32690354; olfactory receptor MOR171-11 product : olfactory receptor 935 protein_id : NP_666957.1

name	Olfr146 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239232 CCDS:CCDS23036.1 GeneID:258742 MGI:2660711
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-32715386-32714466; olfactory receptor MOR171-10 product : olfactory receptor 146 protein_id : NP_666958.1

name	EG628171 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149259889 GeneID:628171 MGI:3646521
definition	codon_start : 1 product : similar to olfactory receptor Olfr936 protein_id : XP_897998.2

name	Olfr937 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239212 CCDS:CCDS23037.1 GeneID:258431 MGI:3030771
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-32756567-32755632; olfactory receptor MOR171-24 product : olfactory receptor 937 protein_id : NP_666650.1

name	Olfr938 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239206 CCDS:CCDS23038.1 GeneID:258430 MGI:3030772
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-32774646-32773699; olfactory receptor MOR171-25 product : olfactory receptor 938 protein_id : NP_666649.1

name	Olfr27 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126215542 GeneID:258826 MGI:109308
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-32841223-32842158 product : olfactory receptor 27 protein_id : NP_667040.2

name	Olfr943 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22380649 CCDS:CCDS23039.1 GeneID:258323 MGI:3030777
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PVTD-32881408-32882343; olfactory receptor MOR171-44 product : olfactory receptor 943 protein_id : NP_666438.1

name	Olfr944 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239220 CCDS:CCDS23040.1 GeneID:258500 MGI:3030778
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-32914568-32915503; olfactory receptor MOR171-19 product : olfactory receptor 944 protein_id : NP_666718.1

name	Olfr144 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46575901 CCDS:CCDS23041.1 GeneID:257959 MGI:2177527
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-32935684-32934749; olfactory receptor MOR171-41P; odorant receptor product : olfactory receptor 144 protein_id : NP_997548.1

name	Olfr945 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239214 CCDS:CCDS23042.1 GeneID:258499 MGI:3030779
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-32955932-32954982; olfactory receptor MOR171-20 product : olfactory receptor 945 protein_id : NP_666717.1

name	Olfr948 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801300 CCDS:CCDS23043.1 GeneID:257912 MGI:3030782
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-33016899-33015934; olfactory receptor MOR171-45 product : olfactory receptor 948 protein_id : NP_001011756.1

name	Olfr951 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801390 CCDS:CCDS23044.1 GeneID:258046 MGI:3030785
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-33090395-33091330; olfactory receptor MOR171-33P product : olfactory receptor 951 protein_id : NP_001011812.1

name	Olfr952 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27544959 CCDS:CCDS23045.1 GeneID:235248 MGI:3030786
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-33124064-33123120; olfactory receptor MOR171-21 product : olfactory receptor 952 protein_id : NP_666714.1

name	Olfr954 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129638 CCDS:CCDS23046.1 GeneID:258328 MGI:3030788
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-33158015-33158950; olfactory receptor MOR171-42 product : olfactory receptor 954 protein_id : NP_666443.1

name	Olfr955 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46369485 CCDS:CCDS23047.1 GeneID:258242 MGI:3030789
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-33167297-33166353; olfactory receptor MOR171-34 product : olfactory receptor 955 protein_id : NP_997024.1

name	Olfr44 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134948545 CCDS:CCDS23048.1 GeneID:18343 MGI:1333829
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : olfactory receptor MOR171-5; GA_x6K02T2PVTD-33181773-33180838; odorant receptor K11 product : olfactory receptor 44 protein_id : NP_667041.2

name	Olfr957 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129351 CCDS:CCDS23049.1 GeneID:258740 MGI:3030791
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PVTD-33208209-33207274; olfactory receptor MOR171-12 product : olfactory receptor 957 protein_id : NP_666956.1

name	Olfr958 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129634 CCDS:CCDS23050.1 GeneID:258327 MGI:3030792
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-33247839-33246901; olfactory receptor MOR224-9 product : olfactory receptor 958 protein_id : NP_666442.1

name	Olfr959 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27544953 CCDS:CCDS23051.1 GeneID:258501 MGI:3030793
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-33270211-33269276; olfactory receptor MOR224-3; odorant receptor product : olfactory receptor 959 protein_id : NP_666719.1

name	AW551984 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30520173 CCDS:CCDS23052.1 GeneID:244810 MGI:2143322
definition	GO_process : GO:0007229 - integrin-mediated signaling pathway [Evidence IEA] codon_start : 1 product : BCSC-1 protein_id : NP_848852.1

name	Olfr148 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22203775 CCDS:CCDS23053.1 GeneID:258498 MGI:2660713
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-33310486-33311418; olfactory receptor MOR224-4 product : olfactory receptor 148 protein_id : NP_666716.1

name	Olfr960 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129725 CCDS:CCDS23054.1 GeneID:258276 MGI:3030794
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-33320043-33320987; olfactory receptor MOR224-12 product : olfactory receptor 960 protein_id : NP_666391.1

name	Olfr961 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239050 CCDS:CCDS23055.1 GeneID:258497 MGI:3030795
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-33343617-33344561; olfactory receptor MOR224-5 product : olfactory receptor 961 protein_id : NP_666715.1

name	Olfr963 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801418 CCDS:CCDS23056.1 GeneID:258087 MGI:3030797
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-33365879-33366814; olfactory receptor MOR224-7P product : olfactory receptor 963 protein_id : NP_001011827.1

name	Olfr149 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54261732 CCDS:CCDS23057.1 GeneID:235256 MGI:2660716
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-33400306-33399371; olfactory receptor MOR224-8 product : olfactory receptor 149 protein_id : NP_997021.1

name	Olfr965 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801476 CCDS:CCDS23058.1 GeneID:258165 MGI:3030799
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-33416730-33417668; olfactory receptor MOR171-28 product : olfactory receptor 965 protein_id : NP_001011859.1

name	Olfr150 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149259894 GeneID:258602 MGI:2659178
definition	codon_start : 1 product : olfactory receptor 150 protein_id : XP_146788.3

name	Olfr967 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801416 CCDS:CCDS23059.1 GeneID:258086 MGI:3030801
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-33447884-33448816; olfactory receptor MOR171-30P product : olfactory receptor 967 protein_id : NP_001011826.1

name	LOC666881 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666881
definition	number : 1 pseudo : _no_value

name	LOC666881 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666881
definition	number : 2 pseudo : _no_value

name	LOC667312 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667312
definition	number : 1 pseudo : _no_value

name	LOC667312 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667312
definition	number : 2 pseudo : _no_value

name	LOC667260 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149259936 GeneID:667260
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 716 ESTs, 20 Proteins product : similar to gamma actin-like protein pseudo : _no_value transcript_id : XR_033953.1

clone name	MSMg01-298A15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-474A23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-469E09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-338L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-432M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-542C13
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-211D21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-369F18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-119P01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-290N02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-544B16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-427O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-488A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352L14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-146B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-168A04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-500N12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-173G11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-316O08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-307P07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-430N23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-290K11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-382K20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-442D05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-137D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-454N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-214I08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-098P14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-460B05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-405H12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-316P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-356B18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-188K17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-089I15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-402N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-485H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-452P08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-494P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-445D23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-355E19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-335G16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-390E03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-358O10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-464E10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-482O16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-366J07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-373H24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-262L03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-492A13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-339I17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-384F13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-413E08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-437B11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-118E05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-132P21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-544G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-467N06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-356I19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-446E09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-516O15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-092F15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-066C23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-098I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377E05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-063C03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-272F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-099A11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-483J22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-167P06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-153G14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-263P20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-526O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-511C10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-441B12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-379G13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-101I11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-409D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-515A21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-515M19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-059L06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-145L18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-125O02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-421C21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-517A18
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-548J14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-185A06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-135J14
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-504O01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-441B12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-431N05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-190P15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-367A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-321G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-393N21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-368H11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-177C08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-420K24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-118K11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-105E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-189D23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-365H09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-138F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-519N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-305D03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-097C18
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-067A12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-100G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-461B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-261I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-263I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-430A14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-536I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-540A11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-473G03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-312L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059M03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226C10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-274L05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-061I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312K12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-226L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-096F21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-055G05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183C11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-325O11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035K09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-176G22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284K17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-291F10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-014C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182A08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077J03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-198B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098E21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116I07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-264N02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-282P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196K01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-321N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045H22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299N14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-197L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303I02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-237H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076G17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-115H19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-277L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284C03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-226C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168L20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183E08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-029H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291K16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304K08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-324G23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-050B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315K21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182C11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-083G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-082A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059C11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-311F18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-349M17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017C08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-004F09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-195A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349M17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-199O06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157O09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-012D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-321G10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248N17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-254I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075C07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-257C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131G23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-299I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-164B20
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-318J16.b	B6Ng01-318J16.g
ACC	GA108449	GA108450
length	1,003	1,081
definition	B6Ng01-318J16.b	B6Ng01-318J16.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(38,571,240 - 38,572,238)	(38,393,523 - 38,394,605)
sequence	gaattcaagttagggcttacctcatagtgttaattataattttatatatt aacatttttaactttgtgcaattattattttttaatttattttttaatta ggtattttcttcatttacatttcaaatgctatccccaaaatcccccagac cctctccccccacttccctcccccctcccacttcttggccctggcgttcc cccatactgaggcatataaagtttgcaagaccaaggcattatttattcta aatttaatatttcactttgttagtgctatgcttcctgttggtataacatt aaacagttttagtgagctaaggtaactcttcaccttcccgtttgcttctg aagagatatgagaagaggcagaatatgtgcactaggaagcaagagatagg aatcaaagatggaagaacttatcaagactgagatatgacctagtatatcc tccaatggactgccaaagctggtcacagaaaagacatgtgaaaacattaa tgagatcaaggaggtgccacagaaagaaactgagacctcaatgttacata ttgagatccagaaacaagacattccgtagggtgaattataaatatcctaa ctgaagaccagcttttggaaatttcctcagattttaatgtcacagcagaa aatcgccaagcccagatgtcacactgtgaaaatcattgacccccaaggag catccacgacgacagtttgaaaatgagtaagttttagtacccatcttgtg gtgcgtgtgatccctgcagcccaatgtagaatgggccagagaagcaaaag agagcaaagcatcaatgtaggttgtgctggcttttcataagaggtaagtg cacctgtaaggaaaatgtttaaaatgacaaccaccatatttagataagaa tcagaactcaatgagaactaagtttagtgtaagaaaaaaattcaagtagc ttacaaaggaaagactttgagtgatggttttcaacctttattatcttcat gac	gaattccagacattggacagttggagattgattttccttttgattgtgag tgtgccctgatattttcccctcttgatggaagtattttagtggagcccac agtaagagacttttaattgtaaaaagactttggattttaaaagagattag atattttaaagggattgaaattttaagaattttcaaagactgtgggactc ttaaagttatttagagttccatgccaagcatcttccctctgaacatcagc tctattcacggctagtcataaaggctctatcacctcccaaaagaggatga tgaggaaacaggaaaacactttttgaaagaaaggtagattaattgattgg aagggaccagcaacttctcacatttttcatacaaactattaacaattaat tatggatacataaaactggctaggaggtaataagattttataaaaagagt tttagaggtttaatgtgattttatttatacttgctcatctgttttgttta ggaagttatcaaagattatattattattccctttttatttaatgataaaa gggaattcatgggactctcacaaattagtcattttaatgagtgaagatga cctcatggagccatttacatcagagcttatctctgatgtatgtgcactgg cattttacaaatagtgaaaaataattttgtttttataaacagtgtgttct ttcttttatatttcacaatttaagatcatctgtcctttggctgcttgccc agaggtgatacagctggatcccttggtagacagttatagttttagaaaac cctccatttagctgttccacctcatttccaatgagatgcatgggactaga tgaataaattattattatatttgatccatgtatgcagtgtacatgagtaa agacaacatacctctgattatatgtggaccaatttttgtcactaagagaa tctataccttttcttgaaaactaataaaataagcataaatgtagtggaag gaactttaatggctaaatattgtgattccttcgtttacagttcactgtgg ctttgtgtactaaacaggattggatatgttc
quality values	Open. Hide. 46 23 24 24 62 38 22 47 62 62 62 62 62 62 49 62 62 62 62 47 62 62 49 62 62 62 62 62 62 62 62 59 59 59 43 49 62 59 54 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 59 54 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 49 49 62 62 62 62 62 47 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 56 62 62 62 62 62 54 54 62 62 62 47 62 62 62 62 62 62 62 62 62 47 38 62 62 62 62 47 54 62 62 62 62 56 62 62 62 62 62 62 62 62 62 47 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 43 47 47 54 54 58 58 49 36 28 58 54 58 39 58 52 54 58 52 58 58 58 54 58 58 58 58 58 58 58 37 54 41 58 58 54 50 54 58 58 58 58 38 54 52 58 54 58 58 58 54 52 54 54 54 54 52 50 58 58 41 54 54 54 52 54 52 52 45 54 54 52 52 52 54 33 58 46 32 58 58 51 53 53 53 46 48 47 38 47 41 42 53 51 50 51 49 51 58 58 58 58 50 36 33 54 49 51 58 58 58 58 54 58 58 50 58 40 43 58 58 51 58 51 51 50 37 58 32 58 58 53 46 53 47 58 46 52 41 53 53 50 52 50 35 58 49 49 54 50 54 50 52 36 22 52 34 54 58 52 50 52 58 39 51 50 52 42 51 50 49 35 46 52 51 50 58 58 50 51 53 40 51 58 54 28 32 58 58 58 54 37 38 41 42 35 23 49 31 49 45 51 38 49 32 46 32 24 38 36 31 45 52 54 49 39 33 54 54 49 33 28 39 34 52 37 47 39 40 54 54 53 53 31 52 30 18 42 49 33 42 54 31 45 54 19 33 34 32 51 52 53 29 40 33 33 33 37 27 54 46 27 53 35 24 37 36 40 47 34 33 25 51 30 36 34 46 46 27 28 53 47 40 37 31 33 46 18 52 49 29 17 7 46 51 41 32 32 23 43 23 32 30 51 33 21 43 33 42 35 22 22 31 51 30 31 16 51 33 26 42 23 42 36 32 31 34 36 30 48 46 7 6 9 31 46 31 16 46 25 31 21 30 33 26 32 28 23 31 26 29 30 42 12 9 46 7 9 5 41 41 28 23 21 17 41 41 35 39 46 30 30 31 31 32 18 12 48 31 23 39 41 32 31 31 37 46 41 25 16 32 26 19 34 11 24 25 32 20 11 10 19 12 14 16 10 14 16 33 30 31 11 22 11 21 32 21 30 19 30 44 24 19 12 16 33 21 10 9 4 9 17 37 32 39 24 31 7 11 14 8 15 16 28 12 8 7 11 9 7 24 7 8 14 13 23 9 39 15 20 32 28 27 37 32 24 32 16 31 16 22 21 20 24 13 28 32 6 8 21 27 6 11 28 47 22 15 6 11 26 8 7 14 29 22 16 25 19 19 3	Open. Hide. 62 35 51 42 62 62 47 33 62 49 62 56 47 62 44 49 44 62 62 62 62 62 62 62 49 49 32 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 62 62 62 54 62 62 62 59 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 62 62 59 59 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 62 59 62 62 62 59 62 62 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 54 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 59 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 42 62 62 62 62 62 62 62 62 62 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 54 47 49 58 58 52 58 58 54 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 52 58 58 58 58 54 58 58 58 58 54 58 54 54 53 58 58 58 52 58 58 54 54 54 52 58 58 58 54 39 58 58 54 58 58 58 54 58 58 58 53 58 58 47 58 58 58 58 58 48 51 48 58 54 50 58 58 58 58 46 52 58 58 54 50 58 47 58 41 38 58 53 53 58 58 58 58 36 33 58 53 58 54 50 51 50 58 51 51 49 51 52 53 53 50 46 58 58 38 50 58 51 58 58 51 58 58 58 58 46 41 33 58 49 24 41 58 53 40 50 58 58 39 32 44 26 31 54 58 58 50 50 29 58 52 53 41 58 32 50 53 52 51 49 50 51 53 54 51 54 31 54 42 38 53 54 52 54 53 45 53 39 54 54 41 34 52 54 49 42 52 52 39 54 51 50 49 42 45 54 54 54 54 54 54 35 42 53 45 49 54 54 54 51 54 54 54 49 47 52 42 51 35 35 33 54 54 54 54 54 54 45 53 45 54 39 41 33 54 49 25 31 45 37 18 15 35 33 31 40 40 33 29 49 41 32 33 32 53 30 40 35 52 45 53 52 34 43 45 31 49 40 47 34 31 32 45 35 32 52 42 31 49 32 36 40 37 18 51 31 41 33 24 31 31 31 31 41 45 40 51 31 31 32 46 40 27 32 40 40 19 32 36 31 26 31 33 36 31 33 33 33 32 33 48 46 31 30 31 38 48 46 31 31 41 25 26 37 32 29 30 47 40 31 26 32 31 42 23 12 26 43 17 18 29 38 32 19 34 47 31 25 33 11 31 25 37 41 27 27 32 32 32 32 31 39 47 29 27 25 33 31 31 26 32 42 25 31 32 21 48 26 31 27 21 24 24 26 21 30 37 37 31 38 44 35 27 19 31 18 22 25 32 37 27 22 31 34 30 21 29 24 32 8 22 32 23 27 29 24 14 21 32 48 28 23 21 14 18 16 29 18 21 15 22 29 20 21 23 27 34 14 10 9 4 20 24 24 31 19 26 16 13 11 19 11 31 47 48 48 30 20 13 25 26 28 28 19 24 16 21 6 5 21 16 28 27 16 13 11 14 17 16 38 38 20 16 16 21 15 15 34 34 24 9 19 9 19 4 8 34 21 9 15 9 26 22 21 19 27 18 40 11 11 12 7 11 6 3 3 6 19 17 3 5 11 13 19 11 26 13 2 4 12 10 16 11 17 13 25 11 5 2 6 9 22 9 17 22 14 28 6 4 27 18 3 2 2 28 8 7 10 3 1 3 10 10 7 15 5 6 2 4 8 9 14 22 8 10 5 10 4 6 21 11 17 17 4 11 5 6 2 1 4 9 5 6 11 4 3 3 11 20 15 6

Alignment Information

BAC End 1

BAC End 2

seq1: chr9_38571240_38572238
seq2: B6Ng01-318J16.b_46_1048 (reverse)

seq1  GTCATGAAGATATTAAAGTTTG-AAACCATCACTCAAAGTC-TTCCTTTG  48
      |||||||||||| ||||| ||| |||||||||||||||||| ||||||||
seq2  GTCATGAAGATAATAAAGGTTGAAAACCATCACTCAAAGTCTTTCCTTTG  50

seq1  TAGCCTACTTG-ATTTTTTTCTTACACTAAACTTAGTTTCTCATTGAGTT  97
      ||  ||||||| |||||||||||||||||||||||| |||||||||||||
seq2  TAAGCTACTTGAATTTTTTTCTTACACTAAACTTAG-TTCTCATTGAGTT  99

seq1  CTGATTCTTATCTAAATATGGTGGTTGTCATTTTAAACA-TTTCCTTACA  146
      ||||||||||||||||||||||||||||||||||||||| ||||||||||
seq2  CTGATTCTTATCTAAATATGGTGGTTGTCATTTTAAACATTTTCCTTACA  149

seq1  GGTGCACTTACCTCTTATG-AAAGCCAGCACAACCTACATTGATGCTTTG  195
      ||||||||||||||||||| ||||||||||||||||||||||||||||||
seq2  GGTGCACTTACCTCTTATGAAAAGCCAGCACAACCTACATTGATGCTTTG  199

seq1  CTCTCTTTTGCTTCTCTGGCCCATTCTACATTGGGCTGCAGGGATCACAC  245
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTCTTTTGCTTCTCTGGCCCATTCTACATTGGGCTGCAGGGATCACAC  249

seq1  GCACCACAAGATGGGTACTAAAACTTACTCATTTTCAAACTGTCGTCGTG  295
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCACCACAAGATGGGTACTAAAACTTACTCATTTTCAAACTGTCGTCGTG  299

seq1  GATGCTCCTTGGGGGTCAATGATTTTCACAGTGTGACATCTGGGCTTGGC  345
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATGCTCCTTGGGGGTCAATGATTTTCACAGTGTGACATCTGGGCTTGGC  349

seq1  GATTTTCTGCTGTGACATTAAAATCTGAGGAAATTTCCAAAAGCTGGTCT  395
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATTTTCTGCTGTGACATTAAAATCTGAGGAAATTTCCAAAAGCTGGTCT  399

seq1  TCAGTTAGGATATTTATAATTCACCCTACGGAATGTCTTGTTTCTGGATC  445
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGTTAGGATATTTATAATTCACCCTACGGAATGTCTTGTTTCTGGATC  449

seq1  TCAATATGTAACATTGAGGTCTCAGTTTCTTTCTGTGGCACCTCCTTGAT  495
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAATATGTAACATTGAGGTCTCAGTTTCTTTCTGTGGCACCTCCTTGAT  499

seq1  CTCATTAATGTTTTCACATGTCTTTTCTGTGACCAGCTTTGGCAGTCCAT  545
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCATTAATGTTTTCACATGTCTTTTCTGTGACCAGCTTTGGCAGTCCAT  549

seq1  TGGAGGATATACTAGGTCATATCTCAGTCTTGATAAGTTCTTCCATCTTT  595
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGAGGATATACTAGGTCATATCTCAGTCTTGATAAGTTCTTCCATCTTT  599

seq1  GATTCCTATCTCTTGCTTCCTAGTGCACATATTCTGCCTCTTCTCATATC  645
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATTCCTATCTCTTGCTTCCTAGTGCACATATTCTGCCTCTTCTCATATC  649

seq1  TCTTCAGAAGCAAACGGGAAGGTGAAGAGTTACCTTAGCTCACTAAAACT  695
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTCAGAAGCAAACGGGAAGGTGAAGAGTTACCTTAGCTCACTAAAACT  699

seq1  GTTTAATGTTATACCAACAGGAAGCATAGCACTAACAAAGTGAAATATTA  745
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTAATGTTATACCAACAGGAAGCATAGCACTAACAAAGTGAAATATTA  749

seq1  AATTTAGAATAAATAATGCCTTGGTCTTGCAAACTTTATATGCCTCAGTA  795
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTTAGAATAAATAATGCCTTGGTCTTGCAAACTTTATATGCCTCAGTA  799

seq1  TGGGGGAACGCCAGGGCCAAGAAGTGGGAGGGGGGAGGGAAGTGGGGGGA  845
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGGGAACGCCAGGGCCAAGAAGTGGGAGGGGGGAGGGAAGTGGGGGGA  849

seq1  GAGGGTCTGGGGGATTTTGGGGATAGCATTTGAAATGTAAATGAAGAAAA  895
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGGTCTGGGGGATTTTGGGGATAGCATTTGAAATGTAAATGAAGAAAA  899

seq1  TACCTAATTAAAAAATAAATTAAAAAATAATAATTGCACAAAGTTAAAAA  945
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACCTAATTAAAAAATAAATTAAAAAATAATAATTGCACAAAGTTAAAAA  949

seq1  TGTTAATATATAAAATTATAATTAACACTATGAGGTAAGCCCTAACTTGA  995
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTAATATATAAAATTATAATTAACACTATGAGGTAAGCCCTAACTTGA  999

seq1  ATTC  999
      ||||
seq2  ATTC  1003

seq1: chr9_38393523_38394605
seq2: B6Ng01-318J16.g_67_1147

seq1  GAATTCCAGACATTGGACAGTTGGAGATTGATTTTCCTTTTGATTGTGAG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCAGACATTGGACAGTTGGAGATTGATTTTCCTTTTGATTGTGAG  50

seq1  TGTGCCCTGATATTTTCCCCTCTTGATGGAAGTATTTTAGTGGAGCCCAC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGCCCTGATATTTTCCCCTCTTGATGGAAGTATTTTAGTGGAGCCCAC  100

seq1  AGTAAGAGACTTTTAATTGTAAAAAGACTTTGGATTTTAAAAGAGATTAG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTAAGAGACTTTTAATTGTAAAAAGACTTTGGATTTTAAAAGAGATTAG  150

seq1  ATATTTTAAAGGGATTGAAATTTTAAGAATTTTCAAAGACTGTGGGACTC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATTTTAAAGGGATTGAAATTTTAAGAATTTTCAAAGACTGTGGGACTC  200

seq1  TTAAAGTTATTTAGAGTTCCATGCCAAGCATCTTCCCTCTGAACATCAGC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAAAGTTATTTAGAGTTCCATGCCAAGCATCTTCCCTCTGAACATCAGC  250

seq1  TCTATTCACGGCTAGTCATAAAGGCTCTATCACCTCCCAAAAGAGGATGA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTATTCACGGCTAGTCATAAAGGCTCTATCACCTCCCAAAAGAGGATGA  300

seq1  TGAGGAAACAGGAAAACACTTTTTGAAAGAAAGGTAGATTAATTGATTGG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGGAAACAGGAAAACACTTTTTGAAAGAAAGGTAGATTAATTGATTGG  350

seq1  AAGGGACCAGCAACTTCTCACATTTTTCATACAAACTATTAACAATTAAT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGGACCAGCAACTTCTCACATTTTTCATACAAACTATTAACAATTAAT  400

seq1  TATGGATACATAAAACTGGCTAGGAGGTAATAAGATTTTATAAAAAGAGT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATGGATACATAAAACTGGCTAGGAGGTAATAAGATTTTATAAAAAGAGT  450

seq1  TTTAGAGGTTTAATGTGATTTTATTTATACTTGCTCATCTGTTTTGTTTA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTAGAGGTTTAATGTGATTTTATTTATACTTGCTCATCTGTTTTGTTTA  500

seq1  GGAAGTTATCAAAGATTATATTATTATTCCCTTTTTATTTAATGATAAAA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAAGTTATCAAAGATTATATTATTATTCCCTTTTTATTTAATGATAAAA  550

seq1  GGGAATTCATGGGACTCTCACAAATTAGTCATTTTAATGAGTGAAGATGA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGAATTCATGGGACTCTCACAAATTAGTCATTTTAATGAGTGAAGATGA  600

seq1  CCTCATGGAGCCATTTACATCAGAGCTTATCTCTGATGTATGTGCACTGG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCATGGAGCCATTTACATCAGAGCTTATCTCTGATGTATGTGCACTGG  650

seq1  CATTTTACAAATAGTGAAAAATAATTTTGTTTTTATAAACAGTGTGTTCT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATTTTACAAATAGTGAAAAATAATTTTGTTTTTATAAACAGTGTGTTCT  700

seq1  TTCTTTTATATTTCACAATTTAAGATCATCTGTCCTTTGGCTGCTTGCCC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTTTTATATTTCACAATTTAAGATCATCTGTCCTTTGGCTGCTTGCCC  750

seq1  AGAGGTGATACAGCTGGATCCCTTGGTAGACAGTTATAGTTTTAGAAAAC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGGTGATACAGCTGGATCCCTTGGTAGACAGTTATAGTTTTAGAAAAC  800

seq1  CCTCCATTTAGCTGTTCCACCTCATTTCCAATGAGATGCATGGGACTAGA  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCCATTTAGCTGTTCCACCTCATTTCCAATGAGATGCATGGGACTAGA  850

seq1  TGAATAAATTATTATTATATTTGATCCATGTATGCAGTGTACATGAGTAA  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAATAAATTATTATTATATTTGATCCATGTATGCAGTGTACATGAGTAA  900

seq1  AGACAACATACCTCTGATTAATATGTGGACCAATTTTTGTCACTAAGAGA  950
      ||||||||||||||||||| ||||||||||||||||||||||||||||||
seq2  AGACAACATACCTCTGATT-ATATGTGGACCAATTTTTGTCACTAAGAGA  949

seq1  ATCTATACC-TTTCTTGAAAACTAATAAAATAAGCATAAATGTAGTTGAA  999
      ||||||||| |||||||||||||||||||||||||||||||||||| |||
seq2  ATCTATACCTTTTCTTGAAAACTAATAAAATAAGCATAAATGTAGTGGAA  999

seq1  GGAACTTTAATGGCTAAATTATTGTGATTTCTTTCAATTTACAATTTCAC  1049
      |||||||||||||||||| |||||||||| |||    ||||| | |||||
seq2  GGAACTTTAATGGCTAAA-TATTGTGATTCCTT--CGTTTAC-AGTTCAC  1045

seq1  TGTTGCTTTGTGTACTAAACAGTAT--GATATGTTC  1083
      ||| |||||||||||||||||| ||  |||||||||
seq2  TGTGGCTTTGTGTACTAAACAGGATTGGATATGTTC  1081

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information